ID: 956444302

View in Genome Browser
Species Human (GRCh38)
Location 3:69310448-69310470
Sequence AATTATCTGCAGAAAGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 2, 3: 60, 4: 616}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956444302 Original CRISPR AATTATCTGCAGAAAGTGGA AGG Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903987810 1:27241748-27241770 AATTACCTTAAGATAGTGGAAGG - Intronic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
905627986 1:39501041-39501063 AATTCATGGCAGAAAGTGGAAGG + Intronic
905921551 1:41722584-41722606 AAATACCTGCTAAAAGTGGAGGG - Intronic
906050487 1:42867412-42867434 CATTATCTGCAGAAGATGGCAGG - Intergenic
906223006 1:44097390-44097412 AATTCTCTGAAGAAAGTCAATGG + Intergenic
906821305 1:48933304-48933326 AATTATCTGCACTAAGTAGGAGG - Intronic
906879674 1:49576460-49576482 AGTTATGTGCAGAAAATGGCAGG - Intronic
908305652 1:62813087-62813109 AATTCTGTGAAGAAAGTGAATGG - Intronic
909172609 1:72315466-72315488 AATTATCTGCAGAAGATGGCAGG + Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
909850752 1:80460219-80460241 AATTATGTGAAGAAAGTCAACGG + Intergenic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
910531605 1:88242383-88242405 AATTATGTGAAGAAAGTCAATGG - Intergenic
910588215 1:88901724-88901746 AATTATCTGCAGAAGATGGCAGG - Intergenic
910638992 1:89439976-89439998 CATTATCTGCAGAAGATGGCAGG + Intergenic
910941049 1:92534396-92534418 AATTATTTGAAGAAAGTCAATGG - Intronic
911174586 1:94806429-94806451 AATTATCCGAAGTAAGTAGAGGG - Intergenic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911320984 1:96413736-96413758 AGCTATCTGCAGAAAGTGGATGG + Intergenic
911706631 1:101021277-101021299 AATTATCAGCAGAAAATGGCAGG + Intronic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911800603 1:102133222-102133244 AATTATGTGAAGAATGTTGATGG - Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911995354 1:104758694-104758716 AATTATATGCAGATAGTAAAAGG + Intergenic
912106274 1:106280431-106280453 AATTTTCTTCAAAAAGTGCAAGG + Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912468542 1:109890779-109890801 AATTATCTACACAGAGTGGCTGG - Intergenic
912578281 1:110695658-110695680 AATTATTTTCAGAATGGGGATGG - Intergenic
913133864 1:115868210-115868232 GATTACTTACAGAAAGTGGATGG - Intergenic
913386421 1:118262820-118262842 GATTCTCTGCAGATAGTGGCTGG - Intergenic
913484505 1:119321684-119321706 AAATATCTACAGAGAGTAGATGG + Intergenic
914376725 1:147079082-147079104 AATTATCAGCTGACAGGGGACGG + Intergenic
916572215 1:166037855-166037877 AATTATCTGCAGAGCATGTATGG + Intergenic
917007459 1:170431043-170431065 AATTCTCTGAAGAAAGTCAATGG - Intergenic
917022904 1:170609757-170609779 AATTCTGTGAAGAAAGTGAATGG + Intergenic
917041439 1:170810119-170810141 AATTAACTGCAGGAAGTAGCTGG - Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
918402731 1:184179959-184179981 AAATATCTGAAGAAAAAGGATGG + Intergenic
918456967 1:184731030-184731052 AATTATCTTCAAAAATTGTATGG - Intronic
918755717 1:188337811-188337833 AGTTATCTGGAGAAGATGGAAGG + Intergenic
918816466 1:189191751-189191773 AAATGGCTACAGAAAGTGGATGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
921619818 1:217313135-217313157 AATTATCTGCAGACGATGGTAGG - Intergenic
923845394 1:237725193-237725215 AATTATCTAGAAAAAGTGGGAGG + Intronic
923966761 1:239150114-239150136 CCTTATCTGCAAAAAGTGGATGG - Intergenic
924815291 1:247436191-247436213 AATTATTTGGAAAATGTGGATGG + Intronic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1064300437 10:14118359-14118381 AAATTTCTGCAGAAATTTGATGG + Intronic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1064836504 10:19537513-19537535 GAATATCTGGAGAAAGAGGAGGG - Intronic
1064927122 10:20581753-20581775 AATTCTATGCAGAAAAGGGAGGG + Intergenic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065075590 10:22075852-22075874 AATTATGTGAAGAAAGTCAATGG + Intergenic
1066150567 10:32611944-32611966 AATTCTCTGAAGAAAGTCAATGG + Intronic
1066572087 10:36784486-36784508 AATCAGCTGCAGAAAGTGAATGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067232616 10:44422732-44422754 AATTCTCAACAGAAAGAGGAGGG - Intergenic
1067333138 10:45340215-45340237 AGTTATATGCAGAAAATGGCAGG - Intergenic
1067364566 10:45613227-45613249 AATTATTAGAAGAAATTGGAGGG + Intergenic
1067579132 10:47429355-47429377 AATTCTGTGCAGAAAGTCGGTGG + Intergenic
1067792502 10:49298751-49298773 AATAATCTGCAGCTAGGGGAAGG - Intergenic
1068145505 10:53065165-53065187 AATTATCTGAATAATGTAGAAGG - Intergenic
1068442670 10:57078772-57078794 AATTATGTGAAGAAAGTCAATGG + Intergenic
1068573931 10:58662301-58662323 AATTATCTGAAGGAATTGGAAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069121028 10:64569221-64569243 AAATATCAACAGAAAATGGAGGG + Intergenic
1069312770 10:67059406-67059428 AATTAATTGCAAAAATTGGAGGG + Intronic
1069388182 10:67903681-67903703 AACTATCCGCAGAAATTGGCCGG - Intronic
1069494669 10:68892647-68892669 AATTTTCTGCAAAATGTCGAAGG + Exonic
1069573727 10:69510104-69510126 AATTATGTGAAGAAAGTCAATGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1070215478 10:74375126-74375148 ATTTATATGCAGAAAGTGTAAGG - Intronic
1070226556 10:74514381-74514403 AAATATCTCCAGAAGGTGAAGGG - Intronic
1071075007 10:81739518-81739540 AATTATGTGAAGAAAGTCGTTGG - Intergenic
1071113042 10:82184627-82184649 AATTGTCTCCAGAAAGTGAATGG - Intronic
1071190501 10:83093792-83093814 AATTATTTGAAGAAAGTCAATGG - Intergenic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071390096 10:85165405-85165427 AAATATTTGGAAAAAGTGGATGG + Intergenic
1071937687 10:90549274-90549296 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073957686 10:108891655-108891677 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1074483975 10:113854990-113855012 CAGTATCTGCAGAAGGTGGACGG + Exonic
1075261672 10:120968708-120968730 AATTATCTGCAGATGGTATATGG + Intergenic
1076038126 10:127218679-127218701 AAATAACAACAGAAAGTGGAGGG - Intronic
1076621459 10:131791613-131791635 AATTATCTGCAAAGACTGAACGG + Intergenic
1076843850 10:133059598-133059620 AATTACCTGGGGAAAGTGGAGGG + Intergenic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1077652051 11:3981754-3981776 AATCATGTGCAGAATCTGGATGG + Intronic
1078392461 11:10947790-10947812 AATTCTATGCAGAAAGTCAATGG + Intergenic
1078984367 11:16577101-16577123 AATTAACTTCAGAAAGTTAAAGG + Intronic
1079902959 11:26210508-26210530 AATTCTGTGAAGAAAGTGAATGG + Intergenic
1080197944 11:29633511-29633533 ACTTTTCTGCAAAATGTGGAAGG + Intergenic
1080456276 11:32422417-32422439 AATGATAGGCAGAAGGTGGAAGG - Intronic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1081029505 11:38060724-38060746 AAGTACCAGCAGAAAGTGAAAGG + Intergenic
1081093928 11:38908242-38908264 AATTCTCTGGAGAAAGTCAATGG - Intergenic
1081166489 11:39814541-39814563 AATTCTATGAAGAAAGTGAATGG - Intergenic
1081798252 11:45837632-45837654 AATTCTATGAAGAAAGTCGATGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082950982 11:58815778-58815800 AATTCTGTGAAGAAAGTCGATGG + Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1083415123 11:62520558-62520580 ATTTCTCTGCCCAAAGTGGAAGG - Exonic
1083415882 11:62525448-62525470 ATTTCTCTGCCCAAAGTGGAAGG - Exonic
1084331404 11:68432703-68432725 GATTTTCTGCACAAAGTGGGAGG + Intronic
1084956187 11:72692881-72692903 ATGTATGTGCAGAAGGTGGAGGG + Intronic
1085685960 11:78622162-78622184 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1086162306 11:83735517-83735539 AATTATCTGCAACAAATAGAAGG - Intronic
1086827320 11:91515587-91515609 ATTTATCTCCAGAGCGTGGACGG + Intergenic
1087741929 11:101897880-101897902 AATTATGTGAAGAAAGTCAATGG + Intronic
1087975894 11:104545750-104545772 AATTATTTCCAGAAAATTGAAGG - Intergenic
1088191662 11:107234518-107234540 AGTTATCTGCAGAATATGGCAGG + Intergenic
1088269982 11:108024190-108024212 AATTATAGGCAGTAAGTGGCAGG - Intronic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1089022079 11:115226649-115226671 ACTTGTCTGCAGAGAGAGGACGG + Intronic
1089368073 11:117933101-117933123 AATATCCTGCAGAAAGTAGAAGG - Intergenic
1089623167 11:119734432-119734454 AGTTATCTGCAGAGAGAGGTTGG + Intergenic
1089661567 11:119989451-119989473 AATTACCTGTAGAAATAGGATGG + Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1090433017 11:126662526-126662548 CCTTATATGCAGAAGGTGGAAGG + Intronic
1091055975 11:132419550-132419572 AAATCTCTGCAGATGGTGGAAGG + Exonic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092094048 12:5827470-5827492 AATTATCCGGATAAAGTGGCAGG + Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1092703663 12:11260931-11260953 AATTCTCTGAAGAAAGTCAATGG - Intergenic
1092706237 12:11288196-11288218 AATTCTCTGAAGAAAGTCAATGG - Intergenic
1093004859 12:14040391-14040413 AATTATGTGAAGAAAGTCAATGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094490204 12:30956080-30956102 AAATATTTGCAGAGAGTGAAGGG + Intronic
1094795860 12:33971809-33971831 AATTCTCTGAAGAAAGTCAATGG + Intergenic
1095708030 12:45258950-45258972 AAGTATCTTCAGAAAATGGTGGG + Intronic
1095837256 12:46652373-46652395 AATAATCTGTGGAAAGAGGAAGG - Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097486618 12:60211528-60211550 AATCAACTTCAGAAAGTGGGAGG - Intergenic
1097563801 12:61241496-61241518 AATTATCTGTAGAAAAAAGATGG - Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097622940 12:61963694-61963716 AATTATGTGCAGAAAGTCAATGG - Intronic
1098533192 12:71565015-71565037 AATTATATGCATAAAGTACATGG + Intronic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099365921 12:81765357-81765379 AGTTATCTGCAGAATATGGCAGG - Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099853972 12:88141397-88141419 AATAATCTGCAAAAAATGTAAGG - Intronic
1100124663 12:91408820-91408842 AATCACCTGCAGATATTGGAGGG + Intergenic
1100124810 12:91411069-91411091 AATCACCTGCAGATATTGGAGGG + Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1100291589 12:93220181-93220203 AATTATCTGTAGGGAGAGGAGGG + Intergenic
1101384953 12:104248707-104248729 CAGTATCTGCCGTAAGTGGAAGG - Intronic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101630736 12:106491581-106491603 GAGTATCTGCAGAAAGTAAAAGG + Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1103870883 12:124090728-124090750 ATTCAGCTGCAGAAAGTGAATGG + Intronic
1105033330 12:132900520-132900542 AATTATCTGCAGACAATGTCAGG + Intronic
1105840324 13:24248465-24248487 AATTATCTGAAAAAATTAGAAGG + Intronic
1105955818 13:25281775-25281797 AGTTGTGTGCAGGAAGTGGAGGG + Intronic
1106390496 13:29330961-29330983 AATTATGTGAAGAAAGTCAATGG + Intronic
1106854590 13:33835855-33835877 ATTTAACTGCACAAAGTGCAAGG - Intronic
1108840036 13:54601929-54601951 AATTCTCTGAAGAAAGTCAATGG - Intergenic
1109242050 13:59901510-59901532 AATGCTCTGCAGGAAGTGGTAGG - Intronic
1109366931 13:61367900-61367922 AATTATGTGAAGAAAGTCAATGG - Intergenic
1109511025 13:63374330-63374352 GATTAGCTGAAGAAAGAGGATGG - Intergenic
1109588337 13:64440767-64440789 AATTATCTAAAGAAAGTTTAGGG - Intergenic
1110631435 13:77712675-77712697 AATTATGTGAAGAAAGTCAATGG - Intronic
1110972907 13:81788854-81788876 AGTCATTTGCAGAACGTGGATGG - Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111667718 13:91290885-91290907 AAATTTCTACAGAAAGTGGAAGG - Intergenic
1111738568 13:92173784-92173806 AAATATTTGCAGAATGTGGAAGG + Intronic
1112081506 13:95976669-95976691 AATTCTGTGAAGAAAGTTGATGG - Intronic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1112249931 13:97770305-97770327 AATTATCTGCAGAAGATGGCAGG + Intergenic
1112796956 13:103067682-103067704 GATTATGTGAAGAAAGTGGTCGG + Intergenic
1113108087 13:106792586-106792608 AATTCACAGCAGAAAGTGGAAGG + Intergenic
1113370997 13:109725431-109725453 AATTATCAGCTGAAAGAGGAAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114728014 14:24959716-24959738 AATTATGTGCAAAAAGGTGAAGG + Intronic
1115518955 14:34213697-34213719 AATTTCCTTCAGAAATTGGAAGG + Intronic
1116008255 14:39321165-39321187 AGTTATCTACAGTAAGTGCAAGG - Intronic
1116308048 14:43283474-43283496 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117409204 14:55435218-55435240 AATTATTTCCAGAAATTTGATGG + Intronic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119859265 14:77924669-77924691 AATTAGCTGCAGAACCGGGAGGG + Intronic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120169404 14:81233959-81233981 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1120564934 14:86043857-86043879 AATTATGTGAAGAAAGTCAATGG + Intergenic
1120624770 14:86811320-86811342 AATTCTGTGAAGAAAGTCGATGG + Intergenic
1122160228 14:99778527-99778549 AGGAATCTGCAGGAAGTGGATGG - Intronic
1126733496 15:51708707-51708729 AATTAGCTGGACAAAGTGGCGGG + Intronic
1127004003 15:54544913-54544935 AATTATGTGAAGAAAGTTAATGG - Intronic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127359279 15:58230667-58230689 TGTTCTCTGCAGAAACTGGAAGG + Intronic
1127727284 15:61762243-61762265 AATTATCTTCAAATAGTTGAAGG - Intergenic
1128358191 15:66943107-66943129 AATTCTGTGGAGAAAGTTGAAGG + Intergenic
1128941861 15:71794551-71794573 AATTCTGTGAAGAAAGTCGATGG + Intronic
1130193896 15:81761268-81761290 TATTATCTGTAGAACGGGGATGG - Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1132254392 15:100362930-100362952 AATTCTGTGAAGAAAGTCGATGG - Intergenic
1132380993 15:101366658-101366680 AATTTCCTGCAGAAGGTGGCTGG + Intronic
1133686409 16:8169416-8169438 GATCCTCTGCAGAAAATGGAAGG + Intergenic
1134188530 16:12103169-12103191 AATTCTGTGAAGAAAGTGCATGG - Intronic
1135106868 16:19657419-19657441 GTTTATCTGCAGAAATGGGAAGG - Intronic
1136126217 16:28183267-28183289 CAGTTCCTGCAGAAAGTGGAAGG + Intronic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1137827200 16:51509102-51509124 AATTATATATAGAAAGGGGACGG + Intergenic
1138775136 16:59712554-59712576 AAATATCGGCAGTAAGTGTATGG - Intronic
1138781304 16:59791500-59791522 TATTAACTGCAGAGAGTAGAGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1139134568 16:64186376-64186398 AATCTTTTGCAGAAAATGGATGG - Intergenic
1139818397 16:69697067-69697089 AATTATCTGTAAAAAATGAAGGG + Exonic
1141346244 16:83248788-83248810 AATTTCCTGCAGAAAGTGATGGG - Intronic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1142739089 17:1920166-1920188 AATTATCTGCAAATAATGGAAGG + Intergenic
1145051087 17:19661554-19661576 AATTATCTGTAGTTTGTGGATGG + Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1149086003 17:52716894-52716916 AGTCATCTTCTGAAAGTGGAGGG - Intergenic
1149454644 17:56777898-56777920 AGTTTTCTTCAGAAAGTGGATGG - Intergenic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154068461 18:11131068-11131090 AGTTATCTGCAGAAGGTGGCAGG - Intronic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155165297 18:23227253-23227275 AATTTTCTGGGGAAAGTGGGTGG - Intronic
1155865743 18:30962851-30962873 TATTATAAGCAGAAAGTGTATGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156535899 18:37864231-37864253 AATTTGTAGCAGAAAGTGGAAGG + Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156651728 18:39233873-39233895 AATTCTCGGCAGACAGTGGCAGG - Intergenic
1157875094 18:51265464-51265486 AATTATCTGGACATAGTGGTGGG + Intergenic
1157998507 18:52588155-52588177 AGTTATCTGCAGAAGATGGAAGG + Intronic
1158059055 18:53316483-53316505 AATTCTGTGAAGAAAGTCGATGG + Intronic
1159099787 18:63945257-63945279 AATTATGTGAAGAAAGTCGCTGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1162883210 19:13676069-13676091 CAGTATCTGCAGACACTGGAAGG - Intergenic
1164029231 19:21386211-21386233 TCTTATGTGCAGAAAGTTGAGGG - Intergenic
1164097089 19:22021374-22021396 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1164117261 19:22234605-22234627 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1166239555 19:41480631-41480653 AGTTATATGAAGAAACTGGAGGG - Intergenic
1166258502 19:41621763-41621785 TGTTTTCTGCAGAAAGGGGAAGG + Exonic
1166411135 19:42555918-42555940 TTTTTTCTGCAGAAAGGGGAAGG + Intronic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925499410 2:4486952-4486974 AATAATCTGCAGAAAATGGCAGG + Intergenic
925728691 2:6900347-6900369 AATTCTGTGAAGAAAGTCGATGG + Intergenic
927008714 2:18879693-18879715 ACTTATCTGCAGAAGATGGCAGG - Intergenic
928833170 2:35513210-35513232 AATTATATGAAGAAAGTCAATGG + Intergenic
929361223 2:41093621-41093643 AATTATTTGAAGAAAGTTTATGG - Intergenic
930161746 2:48165626-48165648 AATTATCATCAGTAAGTTGAAGG + Intergenic
931914585 2:66939737-66939759 ACTTATGTGCAAAATGTGGAAGG + Intergenic
932963389 2:76442217-76442239 AATTCTCTGCAGAAAGTCATTGG + Intergenic
933487821 2:82945795-82945817 AATTATGTGGAGAAAGTCAATGG + Intergenic
933878516 2:86644646-86644668 AACTAACTGCAGAGAGCGGATGG - Intronic
934099373 2:88637978-88638000 AATTATAAGCAAAAAGTGCAGGG + Intergenic
935010517 2:99131160-99131182 AATTTTGTGAAGAAAGTAGATGG + Intronic
935125856 2:100222157-100222179 AAATATCTGAAGAAAGTAAAGGG - Intergenic
935207756 2:100911250-100911272 AATTACTTGAAGAAAGGGGAAGG - Intronic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
935675108 2:105588374-105588396 AATTCTCTGCTGCAGGTGGATGG + Intergenic
935679006 2:105620078-105620100 AACTATCAGCAGAACCTGGACGG - Intergenic
936786804 2:116103206-116103228 AATTATATGAAGAAAGTCAATGG + Intergenic
937333407 2:121045869-121045891 AATCGTCTGCAGAAAGTGCAGGG + Intergenic
937742342 2:125370426-125370448 AGTTATCTGAATAGAGTGGAAGG - Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939327289 2:140709893-140709915 AAATATATGGAGAAAGTGTAGGG + Intronic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939902291 2:147865257-147865279 AATCATTTGAAGAAACTGGACGG - Intronic
940083841 2:149835618-149835640 AATTATGTGAAGAAAGTCAAGGG + Intergenic
940560689 2:155292007-155292029 AATTCTCTGAAGAAAGTCAATGG + Intergenic
941394086 2:164952846-164952868 TATTATATGCAGAAATTGAAGGG - Intronic
941536905 2:166734870-166734892 AGTTATCTGCAGATTGTGGTAGG - Intergenic
941652778 2:168111260-168111282 CTTAATCTGAAGAAAGTGGAAGG - Intronic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943109164 2:183584426-183584448 AATTATGTGAAGAAAGTCCATGG + Intergenic
943124232 2:183776584-183776606 AATTATGTGAAGAAAGTCAATGG + Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943313711 2:186358954-186358976 AGTTATCTGCACAAAGTTAAAGG + Intergenic
943388126 2:187227107-187227129 AGTTATCTGCAGAAGATGGTAGG - Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943597535 2:189876201-189876223 AGTTACCTGCTGAGAGTGGAGGG + Intronic
943804464 2:192105723-192105745 ACATATATGCAGAAAATGGAAGG + Intronic
943820217 2:192313232-192313254 TAATTTTTGCAGAAAGTGGAAGG + Intergenic
944925910 2:204464357-204464379 AATTCTGTGCAGAAAGTCAATGG - Intergenic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945642175 2:212443808-212443830 ACTTATCTGCAGAACATGGCAGG - Intronic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
946703777 2:222437821-222437843 AGTTATCTGCAGAAAATGGTAGG + Intronic
946837416 2:223786325-223786347 AATAAACTGAAGAAAGTGAAAGG + Intronic
947086441 2:226458325-226458347 AATTATGTGAAGAAAGTAAATGG - Intergenic
947133029 2:226949241-226949263 AATTATGTGAAGAAAGTCAATGG - Intronic
947143163 2:227038592-227038614 AATTATGTGAAGAAAGTCAATGG + Intronic
947329708 2:229015741-229015763 AATTAGCTGCACACAGTGGCGGG - Intronic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
948959445 2:241321018-241321040 AATTATCTGCTTAAATTGGGTGG - Intronic
1169645813 20:7808381-7808403 AATTATGTGAAGAAAGTCAATGG + Intergenic
1169816081 20:9657989-9658011 CATTACCTTCAGAAAGTAGATGG - Intronic
1170141776 20:13132074-13132096 GATTTTCAGCAGAAAGGGGATGG - Intronic
1170497003 20:16935241-16935263 AATTATGTGAAGAAAGTCAATGG - Intergenic
1170993335 20:21326087-21326109 TTTTATCTGTAGAAAGTGGATGG - Intronic
1173008364 20:39158185-39158207 AATGATCTCCACAAACTGGATGG - Intergenic
1174092472 20:48060196-48060218 AATTATCCGGAGGAAGTAGAAGG - Intergenic
1174441478 20:50558844-50558866 AAATTTCTGCAAAAACTGGAGGG - Intronic
1175604606 20:60302351-60302373 AGTTATATGAAGAAAGTGCAGGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177241640 21:18465877-18465899 AATTCTGTGAAGAAAGTGAAGGG - Intronic
1177306228 21:19320474-19320496 AATTAAATGCAGAATGTGGCTGG + Intergenic
1177348550 21:19903474-19903496 AATTATGTGAAGAAAGTCAATGG - Intergenic
1177505564 21:22014211-22014233 AGTTATCTGCAGAAGATGGAAGG + Intergenic
1177591016 21:23167901-23167923 AATTATATGAAGAAAGTCAATGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180572673 22:16743033-16743055 AATTATGTGCAGAATGTCTATGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180591617 22:16942903-16942925 AATTATGTGAAGAAAGTCAATGG - Intergenic
1181453018 22:23036637-23036659 AAGTAGCTGCTGAAAGAGGAAGG + Intergenic
1182879924 22:33724531-33724553 AATTATCTCCAGATAGAGAAGGG + Intronic
1182952228 22:34387883-34387905 AATTCTGTGAAGAAAGTTGATGG + Intergenic
1182991039 22:34768031-34768053 TATTATTTTCAGAAAATGGAAGG + Intergenic
1184340722 22:43884438-43884460 CTTCATCTGCAGAAGGTGGAGGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949245863 3:1924893-1924915 AGTTATCTGCAGAAGGTGGCGGG - Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
950561557 3:13731919-13731941 AATTCTGTGAAGAAAGTTGACGG + Intergenic
951112581 3:18822343-18822365 AATTTTCTGCAGAAAGTCTCAGG + Intergenic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951172615 3:19559425-19559447 AAGTAAATGCAGAAAGTGGTGGG + Intergenic
951311326 3:21129492-21129514 AATTATGTGAAGAAAGTCAATGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952592758 3:34977142-34977164 AATTCTGTGGAGAAAGTTGATGG + Intergenic
952605448 3:35142045-35142067 ATTTATCTGCAGAAGATGGCAGG + Intergenic
953274633 3:41482763-41482785 ACTTGTCTGCAGAGAGAGGAAGG - Intronic
953341801 3:42140691-42140713 AATTTTCTGAAGCAAGTGGAAGG + Intronic
954011793 3:47646679-47646701 AATGAAGTGCAGAAAATGGAGGG - Intronic
956177956 3:66491378-66491400 AGCTATGTGGAGAAAGTGGAAGG + Intronic
956245212 3:67175227-67175249 AAGTATCTGGAGAAAGGGCATGG - Intergenic
956279207 3:67538584-67538606 AATTCTCTGAAGAAAGTCAATGG + Intronic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956349427 3:68318356-68318378 CATTATATGCAGAAATTGGAAGG + Intronic
956444302 3:69310448-69310470 AATTATCTGCAGAAAGTGGAAGG + Intronic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957105014 3:75875865-75875887 AATTATGTGCAGAATGTCTATGG - Intergenic
957211243 3:77261285-77261307 AAGTGTCTGCAGAACCTGGAAGG - Intronic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957747222 3:84361455-84361477 AATTATGTGAAGAAAGTAAATGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
958586657 3:96095842-96095864 AATTATGTGAAGAAAGTCAATGG - Intergenic
958898820 3:99861534-99861556 AATCAACTGCAGAGAGTGGGAGG - Intronic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959747939 3:109799335-109799357 AATTCTCTGAAGAAAGTCAATGG - Intergenic
959843299 3:111003208-111003230 AATTATGTGAAGAAAGTCAATGG - Intergenic
959997856 3:112698292-112698314 AGTTATCTGCAGAAGATGGAAGG - Intergenic
960349526 3:116575671-116575693 AGTTATCTTCAGAAAATGGCAGG - Intronic
961262845 3:125616393-125616415 AGTTATCTGCAGAAGATGGTAGG - Intergenic
961567708 3:127775625-127775647 AATTATCTGCAAATATTTGAGGG - Intronic
961925913 3:130480448-130480470 AATTCTATGGGGAAAGTGGAAGG + Intronic
963661389 3:148132115-148132137 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
964962620 3:162446654-162446676 AATTTTCTGTATAAAGTGTAAGG + Intergenic
965192576 3:165550343-165550365 GTTTTTATGCAGAAAGTGGAAGG + Intergenic
965226770 3:166000794-166000816 AGTTATCTGCAGAAGATGGTAGG + Intergenic
965766450 3:172135700-172135722 GATGAACTGCAGAAACTGGAAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966070520 3:175871864-175871886 AATTATCTGAAGAAAGTCAGTGG + Intergenic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
967419162 3:189254546-189254568 AATTCTCTGAAGAAAGTCAATGG + Intronic
968012788 3:195297381-195297403 AAGCATCTGCAGAATGTGTAAGG - Intronic
968268836 3:197384043-197384065 AATGAGCTGCAGATAGTAGATGG - Intergenic
970299903 4:14670176-14670198 GATTATCTGTAGAAATAGGATGG - Intergenic
970941614 4:21640944-21640966 AGTTATCTGCAGAGAGTGGCAGG - Intronic
971006312 4:22377691-22377713 AATTCTCTGAAGAAAGTCAATGG + Intronic
971125966 4:23755175-23755197 GATTATCTTCTGAAAGTGAAGGG - Intronic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
972227383 4:37029006-37029028 AATTCTCTGAAGAAAGTCAATGG - Intergenic
972308202 4:37852665-37852687 AACTATCTGCTGAAAAAGGAAGG - Intronic
972361366 4:38328467-38328489 AATTATCTGCAGAAAGCATCTGG - Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
973563079 4:52156080-52156102 AATTCTCTGAAGAAAGTCAATGG - Intergenic
974257163 4:59473041-59473063 AATTTTCTGCAAAAAGTTGTTGG + Intergenic
974262374 4:59542299-59542321 AGTTATCTGCAGAAGATGGTAGG + Intergenic
974350089 4:60733286-60733308 AATTCTATGCAGAAAGTCGTTGG + Intergenic
974644619 4:64674794-64674816 AATTATCTGCAGGAAATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975104747 4:70554861-70554883 AATTATGTGAAGAAAGTCAATGG - Intergenic
975846258 4:78528424-78528446 GGTTATCTGCAGAAAGGGAATGG - Intronic
976336003 4:83887492-83887514 AACTATCTTTAGAAAGTTGACGG - Intergenic
976363570 4:84208212-84208234 AATTCTGTGAAGAAAGTTGATGG - Intergenic
977251472 4:94693754-94693776 AATCATCTCCATAATGTGGATGG + Intergenic
977395943 4:96470338-96470360 ACTTATTTCTAGAAAGTGGAAGG + Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977574754 4:98663891-98663913 CATCCTCTGCAGAAAGAGGAAGG + Intergenic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977696178 4:99969017-99969039 AAATATGTGGAGAAAGAGGAGGG - Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
978966848 4:114750914-114750936 AATTATCTGCAGAAGATGGCAGG - Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980387950 4:132111211-132111233 AGTTATCTGCAGAATATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980945662 4:139318020-139318042 TATAATATTCAGAAAGTGGATGG + Intronic
981257239 4:142676456-142676478 AATTCTGTGAAGAAAGTGAATGG - Intronic
981273483 4:142870975-142870997 AATTATGTGAAGAAAGTCAATGG - Intergenic
982224768 4:153155402-153155424 AAGAATATGCAGAAATTGGAGGG + Intronic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
982961442 4:161843289-161843311 AATTATTTGAAGAAAGTCAATGG + Intronic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983167369 4:164494644-164494666 AATTATGTACTGAAAGAGGATGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983339033 4:166434439-166434461 AGTTATCTGCAGAGAATGGAAGG - Intergenic
983346921 4:166538646-166538668 CCTTATCTTCAGAAAGGGGATGG + Intergenic
983366380 4:166795611-166795633 AATTAATTTCAGAAAGTGTATGG - Intronic
983463964 4:168063254-168063276 AAGGATGTGGAGAAAGTGGAAGG + Intergenic
983566331 4:169156500-169156522 AATAATCTGCACAAAGTTGGTGG + Exonic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983650696 4:170033516-170033538 AATTATCTGCTGGAAGTTGCAGG + Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984416901 4:179472722-179472744 AAATTACTGCAGAAAGTAGAAGG + Intergenic
984903548 4:184606426-184606448 AATTATGTGAAGAAAGTCAATGG - Intergenic
985137278 4:186799466-186799488 AACTATCTGCAGAAAGAGGTGGG + Intergenic
985530683 5:432201-432223 AATTTGCTTCAGAAAGTAGAAGG - Intronic
986355157 5:6916484-6916506 AATTATCTGCAAAAAGATAAGGG + Intergenic
986387337 5:7247615-7247637 AAATATCTGAGGAATGTGGAGGG + Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987578345 5:19758341-19758363 AATTATATGCAGAAGATGGCAGG + Intronic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
988228766 5:28448097-28448119 ATTTATCTGCAGAAGATGGTAGG - Intergenic
988414694 5:30931357-30931379 AATGCTCTGCATAAAGGGGAAGG + Intergenic
988414701 5:30931451-30931473 AATTAACTGTAGAAAGCAGAAGG + Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989349514 5:40470265-40470287 AATTCTGTGAAGAAAGTGAATGG + Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
991033542 5:62105893-62105915 AGTTATCTGCAGAAAATGGCAGG - Intergenic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
992383414 5:76260968-76260990 AGTTATGTGAAGAAAGTCGATGG + Intronic
992712591 5:79474760-79474782 AATTCTCTGCAGAAACTGAAAGG + Intronic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993412585 5:87591841-87591863 AGTTATCTGCAGAAGATGGTAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
993791788 5:92218882-92218904 ATTTATCTGCAGAAGATGGCAGG - Intergenic
994015466 5:94959885-94959907 AATTCTCTGAAGAAAGTCAATGG - Intronic
994141759 5:96348914-96348936 AATTATGAGCAGAAAGTGCAAGG + Intergenic
994280104 5:97891511-97891533 AATTCTCTGAAGAAAGTCAATGG + Intergenic
994566604 5:101454553-101454575 AATTACGTGCACAAAGAGGAGGG - Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994964567 5:106652594-106652616 AATTCTGTGAAGAAAGTCGATGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994996172 5:107066084-107066106 TATTAACTGAAGAAAATGGAAGG + Intergenic
995160001 5:108968090-108968112 AATTACCTGCTAAAAGTGGCCGG + Intronic
995301395 5:110588567-110588589 AATTATCTTCACATACTGGAAGG + Intronic
995319773 5:110820538-110820560 CATTATCTGAACAAAGCGGAAGG - Intergenic
995666573 5:114549059-114549081 AATTATTTGAAGAAAGTCAATGG - Intergenic
995794533 5:115927702-115927724 AATAAACTCCAGGAAGTGGAAGG - Intergenic
995849362 5:116528880-116528902 CATTATCTGCTGGAAGGGGACGG - Intronic
996018556 5:118567827-118567849 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
996277049 5:121679705-121679727 AATTATGTGAAGAAAGTTGGTGG - Intergenic
996825560 5:127677806-127677828 AATTATCTGCAGAAGATGGCAGG - Intergenic
997001363 5:129766069-129766091 AGGTATCTGCAGACAATGGAAGG - Exonic
997679360 5:135738451-135738473 CATTTGCTGCAGAAGGTGGAGGG + Intergenic
997860513 5:137411285-137411307 AATTATCCACAGAATGAGGACGG + Intronic
998290339 5:140908580-140908602 AGTTAGCTGCAGAAGATGGAAGG + Intronic
998513757 5:142735004-142735026 ATTTATCTGCAGAAAGGAGAAGG + Intergenic
998708550 5:144793849-144793871 AATTAGCTGGACAAAGTGGCAGG - Intergenic
998771697 5:145553000-145553022 AAATATCTGCAAAAGGTAGAAGG - Intronic
1000384502 5:160661525-160661547 AATAATTTGCAGAGAGTAGAGGG + Intronic
1000970728 5:167711436-167711458 GACTAGCTGCAGAATGTGGAAGG - Intronic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003469924 6:6420103-6420125 AGTTACCTGCAGATGGTGGAAGG + Intergenic
1004963452 6:20820114-20820136 AATTCTCTAAAGTAAGTGGAGGG + Intronic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005929051 6:30467149-30467171 AATCTTCAGCAGAAAATGGAAGG + Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008935870 6:56991655-56991677 AAAAATCTCCAGAAAGTGGCTGG - Intronic
1009717849 6:67423969-67423991 AATTATTTGAAGAAAGTCAATGG + Intergenic
1009739831 6:67730122-67730144 AATTATTTGAAGAAAGTCAATGG + Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010465126 6:76158626-76158648 AATTATATGAAGAAAGTCAATGG + Intergenic
1010469605 6:76211414-76211436 AATTATGTGAAGAAAGTCAATGG - Intergenic
1010818629 6:80388372-80388394 AGTTATCTGCAGATAATGGCAGG - Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1011069098 6:83361637-83361659 ATTTATCTGCAGAAGATGGCAGG - Intronic
1011308014 6:85950643-85950665 AATTCTCTGAAGAAAGTCAATGG - Intergenic
1011527575 6:88281956-88281978 GATTTCCTGGAGAAAGTGGAGGG - Intergenic
1011733521 6:90290760-90290782 AAGTATCTGCAGAAAGTGACAGG + Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012782566 6:103581355-103581377 AATTATGTGAAGAAAGTCAATGG + Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1013274030 6:108567239-108567261 AATGATCTGCAGAGAGTTAAAGG - Intronic
1013332631 6:109120470-109120492 GATTATCTTCAGAGAGGGGAAGG + Intronic
1014065775 6:117123705-117123727 AATTCTGTGCAGAAAGTCAATGG + Intergenic
1014113784 6:117650146-117650168 AATTCTGTGAAGAAAGTGAATGG - Intergenic
1014431201 6:121372864-121372886 AATTCTGTGAAGAAAGTGAATGG - Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1014560224 6:122880828-122880850 AATTCTATGCAGAAAGTCAATGG + Intergenic
1014857560 6:126420589-126420611 AATTATCTGCAGATATTTGCTGG + Intergenic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016527693 6:145021167-145021189 GAGCATCTGCAGAAAGTGGAGGG - Intergenic
1016571558 6:145519302-145519324 ATTTAACTCCAGAAAGTGAATGG + Intronic
1016576261 6:145572615-145572637 AGTTATCTGCAGAAAACGGCAGG + Intronic
1017838110 6:158198822-158198844 AATTAACTGCAGGAAAGGGAGGG - Exonic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018108936 6:160516508-160516530 AATTATGTGAAGAAAGTCAATGG - Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1018944789 6:168340004-168340026 AGTGAGCTGCAGGAAGTGGAAGG - Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1020923795 7:14298171-14298193 AATTATGTGAAGAAAGTCAATGG - Intronic
1021289100 7:18821647-18821669 AATTATCTGCAGACACTGACTGG + Intronic
1021607695 7:22425727-22425749 AATGAACTGCAGGAATTGGAAGG + Intronic
1022174282 7:27858347-27858369 AATTATGTGAAGAAAGTCAATGG - Intronic
1022839952 7:34154781-34154803 AATTAACTGAATAAAGTGCAGGG + Exonic
1023939309 7:44759793-44759815 ATTTCTCTGCAGCAAGTAGAAGG - Intronic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024414584 7:49089815-49089837 ATTTATCTGCAGTTAGTGGAAGG - Intergenic
1027593950 7:80149511-80149533 AATTATCTGCACTAACTTGATGG + Intronic
1027685793 7:81277926-81277948 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1028043857 7:86091437-86091459 AGTTATCTGCAGAAAAGGGCTGG - Intergenic
1028208826 7:88048812-88048834 AATTATCTGTAGAATGTAGAGGG - Intronic
1028935010 7:96455034-96455056 AATTATCTGCAGAAGATGGCAGG - Intergenic
1029556191 7:101270983-101271005 ATTTATCTGAAGAAAGAGAAAGG + Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1031622370 7:123950045-123950067 AATTATCTGCACAATGAGCAAGG + Intronic
1031676555 7:124618320-124618342 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1032118187 7:129135268-129135290 ACTTATCTTCAGGGAGTGGATGG + Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1033978114 7:147126971-147126993 AATCCCCTGCAGAAAGTGAAAGG + Intronic
1034106167 7:148491941-148491963 AATTCTCTTCAGAAATTTGATGG + Intergenic
1034653423 7:152710628-152710650 AATTTTCTGTAAAAAGAGGAAGG - Intergenic
1035495057 7:159317451-159317473 ATTTATGGGCAGAAAATGGAAGG - Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1037416137 8:18651862-18651884 AATTATTGGCAGAACGTGAAGGG + Intronic
1037863175 8:22420943-22420965 AACTCTCTCCAGAAAATGGATGG + Exonic
1038127448 8:24690603-24690625 AATTATCTGGATAAAGGTGATGG + Intergenic
1038379932 8:27083394-27083416 AAATATTTGCAGAATGTTGAAGG - Intergenic
1038754646 8:30329382-30329404 AATTATCTGAAGGAAGTAGTAGG + Intergenic
1039301418 8:36213198-36213220 AATGAGATGCCGAAAGTGGAAGG - Intergenic
1040452323 8:47560486-47560508 ACTTATAAGCAGAAACTGGAAGG - Intronic
1041957251 8:63569791-63569813 AATTATCTGGAGGAAGGGAATGG - Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042070384 8:64926840-64926862 AATTCTCTGAAGAAAGTCAATGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042968894 8:74386710-74386732 AATTCTGTGAAGAAAGTCGATGG + Intronic
1043068015 8:75601233-75601255 AATTCTCTGAAGAAAGTCAATGG - Intergenic
1043963145 8:86441162-86441184 AATTATCTGAAGCATCTGGAGGG + Intronic
1044018947 8:87080600-87080622 AATCATTTGCAGAAAGTAAAAGG - Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1044174229 8:89098005-89098027 AATTATCTTCAAAAAGTACAGGG + Intergenic
1044285975 8:90412476-90412498 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1044844417 8:96366254-96366276 ATTTATGTGCAGAAAGTTTATGG + Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1046840990 8:118856944-118856966 AATTATGTGAAGAAAGTAAATGG - Intergenic
1047648448 8:126894074-126894096 AATTCTCTGAAGAAAGTCAATGG + Intergenic
1049147412 8:141011239-141011261 AATGATCTGCAGCAACTGTATGG - Intergenic
1050212475 9:3277435-3277457 AAGCCTATGCAGAAAGTGGATGG - Exonic
1050284154 9:4083741-4083763 AATCCACTGCAGAAAGTGCAAGG + Intronic
1050392010 9:5153938-5153960 AATTCTCTGAAGAAAGTCAAAGG - Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1050888738 9:10796784-10796806 AGTTATCTGCAGAAGATGGTAGG + Intergenic
1051830542 9:21271098-21271120 AATTATGTGAACAAAGTGAAAGG + Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1052154425 9:25166988-25167010 AATTATGTGAAGAAAGTCAATGG + Intergenic
1052186412 9:25601701-25601723 AATTATGTGCATAGAGTGGCTGG + Intergenic
1052193209 9:25681877-25681899 AAATATCTGCATGAAGTGCAAGG - Intergenic
1052201282 9:25784261-25784283 AAGAAAATGCAGAAAGTGGAGGG - Intergenic
1052286242 9:26789065-26789087 AATAAACTTCAGAAAGGGGAGGG + Intergenic
1054758079 9:68979156-68979178 AATTTTCTGCAGTGATTGGATGG + Intronic
1054877892 9:70115502-70115524 AATTAGCTGGACAAAGTGGTGGG - Intronic
1055674833 9:78647363-78647385 AATTATGTGAAGAAAGTCAATGG - Intergenic
1055744088 9:79423690-79423712 AATTCTCTGAAGAAAGTCAATGG - Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056136767 9:83637444-83637466 ATTTATCTTCAGTAAGTGCAAGG - Intronic
1056314237 9:85372975-85372997 AATTATCTGCTGAAGATGGCAGG + Intergenic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1056465550 9:86850279-86850301 AATTCTGTGCAGAAAGTCAATGG + Intergenic
1056879804 9:90380307-90380329 ATTTATCTACAGAATGTGGCAGG + Intergenic
1057065142 9:92042648-92042670 AATTTTCTGATGAATGTGGAGGG - Intronic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058034148 9:100232880-100232902 AATTATGTGAAGAAAGTCAATGG + Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1058999113 9:110329904-110329926 AAGTATTTGCAGGAAATGGAAGG + Intronic
1059204941 9:112455749-112455771 AATTATCTGCTGACACTGGCAGG - Intronic
1059670380 9:116485414-116485436 AATTCTGTGAAGAAAGTGAATGG - Intronic
1060364054 9:122990970-122990992 AGTTATCTGCATACATTGGAAGG + Intronic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203771432 EBV:51846-51868 AATTTTCTGCAGGACCTGGACGG - Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188312233 X:28631324-28631346 AATAATCTGCACAAAGCTGATGG + Intronic
1188356298 X:29195890-29195912 AAATTTCTACAGAAATTGGAAGG - Intronic
1188359004 X:29229321-29229343 AATTTTCTGCAGAAAATTTAAGG - Intronic
1188560803 X:31466686-31466708 AATTATGTGAAGAAAGTCAATGG + Intronic
1188892851 X:35631928-35631950 AATTCTCTGAAGAAAGTCAATGG + Intergenic
1189591052 X:42511628-42511650 AATTATGTGAAGAAAGTCAATGG - Intergenic
1189594981 X:42554628-42554650 AATTATGTGAAGAAAGTCAATGG + Intergenic
1190593332 X:52027168-52027190 AATTATGTGAAGAAAGTCAATGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191966332 X:66762606-66762628 AATTATGTGAAGAAAGTCAATGG + Intergenic
1192076637 X:68005255-68005277 AATTATGTGAAGAAAGTAAATGG + Intergenic
1192086568 X:68104280-68104302 AATTATGTGAAGAAAGTCAATGG - Intronic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192352637 X:70370264-70370286 AAATGTCTGCAAAAAATGGAAGG + Intronic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193438326 X:81508289-81508311 AATTCTGTGAAGAAAGTCGATGG + Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193957280 X:87878178-87878200 AGTTATCTGCAGAAGGTGGCAGG - Intergenic
1194158938 X:90427042-90427064 AATTATGTGAAGAAAGTCAATGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194443546 X:93961071-93961093 AGTTATCTGCAGAAGATGGAAGG - Intergenic
1194448556 X:94015185-94015207 AAGAAGCTGCAGAAAGTAGAAGG - Intergenic
1194629569 X:96266878-96266900 AATGATCATCAGAAAGTTGAAGG + Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1195348901 X:103978544-103978566 AATTATAGGAAGAAAGAGGAAGG + Intergenic
1195358542 X:104060295-104060317 AATTATAGGAAGAAAGAGGAAGG - Intergenic
1195392916 X:104381745-104381767 AATCATCTGCTGAAAGTGTAAGG - Intergenic
1195554465 X:106206020-106206042 CATTATCTTCCGAAAGTGAAGGG - Exonic
1195778023 X:108429255-108429277 AATTGACTGCAAAAAGTGTAAGG + Intronic
1195832469 X:109074314-109074336 AATTATGTGAAGAAAGTCAATGG + Intergenic
1196044532 X:111243804-111243826 AATTATGTGAAGAAAGTTCATGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197097464 X:122612806-122612828 AGTTATCTGCAGAAGATGGTAGG - Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197327417 X:125110629-125110651 TTTTTTCTGCAGAAATTGGATGG - Intergenic
1198698826 X:139374229-139374251 AATTCTCTGAAGAAAGTCAATGG + Intergenic
1198701296 X:139400264-139400286 AGTTATCTGCAGAAAATGGAAGG - Intergenic
1199007693 X:142721590-142721612 AATTATGTGAAGAAAGTCAATGG - Intergenic
1199011636 X:142765365-142765387 AATTCTCTGAAGAAAGTCAATGG + Intergenic
1199024376 X:142919687-142919709 ACTTATCTGCAGAAGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200505252 Y:4004002-4004024 AATTATGTGAAGAAAGTCAATGG - Intergenic
1201231088 Y:11865229-11865251 AATTTTGTGTAGAAAGTGAATGG - Intergenic
1201367244 Y:13221194-13221216 AATTATCTGAAGAATGTCAATGG + Intergenic
1201404807 Y:13638856-13638878 AATTTTATACAGAAAGTTGAAGG + Intergenic
1201796633 Y:17903443-17903465 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1201804922 Y:18002542-18002564 AGTTATCTGCAGAAAATGGCAGG - Intergenic
1202358017 Y:24072505-24072527 AGTTATCTGCAGAAAATGGCAGG + Intergenic
1202512761 Y:25597608-25597630 AGTTATCTGCAGAAAATGGCAGG - Intergenic