ID: 956444974

View in Genome Browser
Species Human (GRCh38)
Location 3:69317350-69317372
Sequence GGTCTGAGAGGATAAAAACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 174}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956444969_956444974 2 Left 956444969 3:69317325-69317347 CCTCAGTCCAGGGAATCTGGAAT 0: 1
1: 0
2: 1
3: 21
4: 214
Right 956444974 3:69317350-69317372 GGTCTGAGAGGATAAAAACTTGG 0: 1
1: 0
2: 0
3: 8
4: 174
956444966_956444974 12 Left 956444966 3:69317315-69317337 CCAATCAGAACCTCAGTCCAGGG 0: 1
1: 0
2: 0
3: 14
4: 127
Right 956444974 3:69317350-69317372 GGTCTGAGAGGATAAAAACTTGG 0: 1
1: 0
2: 0
3: 8
4: 174
956444972_956444974 -5 Left 956444972 3:69317332-69317354 CCAGGGAATCTGGAATTGGGTCT 0: 1
1: 0
2: 2
3: 31
4: 193
Right 956444974 3:69317350-69317372 GGTCTGAGAGGATAAAAACTTGG 0: 1
1: 0
2: 0
3: 8
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956444974 Original CRISPR GGTCTGAGAGGATAAAAACT TGG Intronic
900756861 1:4441518-4441540 TGTATGAAAGAATAAAAACTTGG - Intergenic
902318469 1:15642028-15642050 GGTTTGAGAGAAGAAAGACTAGG + Intronic
903471734 1:23592060-23592082 GGTCTCAGAGGATCAAATCCAGG + Intronic
904764511 1:32833658-32833680 TGTCTGAAAGAATAAAAAATGGG - Intronic
904961984 1:34340581-34340603 GGTATGAGCAGATAAACACTTGG + Intergenic
905656737 1:39690697-39690719 AGACTGTGAGGAGAAAAACTGGG + Intronic
907560867 1:55386153-55386175 GGGCAGAGAGGAAAAGAACTCGG + Intergenic
909570176 1:77101297-77101319 GGTCTTAGAGAATAATAAATAGG - Intronic
910191932 1:84603943-84603965 TCTTTGAGAGAATAAAAACTGGG - Intergenic
911460739 1:98186997-98187019 GGACTGAGAGGAGAGAAACTAGG - Intergenic
912747838 1:112260318-112260340 GGTGTGAGAAGAGAGAAACTGGG + Intergenic
913284614 1:117215134-117215156 GCTCTTGGAGGGTAAAAACTAGG + Intergenic
916423331 1:164657537-164657559 GTTCTGAGAGGACAGAAACAAGG + Intronic
917045327 1:170853207-170853229 GGTCTGAGAGGATTCAAGGTGGG + Intergenic
917667563 1:177240038-177240060 GGCCTGATGGGATAAAAACGAGG + Intronic
918448784 1:184639775-184639797 TGTCTGAGAGAAAAAAAATTTGG - Intergenic
921066277 1:211624562-211624584 CTTCTGAGAGGTTAAAAACATGG + Intergenic
1063303405 10:4874460-4874482 TGTTGGAGAGGATGAAAACTAGG + Intergenic
1063604373 10:7509284-7509306 GCTCAGAGAGGTTAAAAACTTGG + Intergenic
1066800646 10:39185100-39185122 AATATGCGAGGATAAAAACTAGG - Intergenic
1068262779 10:54604675-54604697 TGGCTGAAAGAATAAAAACTTGG - Intronic
1070438825 10:76422281-76422303 GACCTGAGAGGATAAGATCTTGG - Intronic
1075279540 10:121127957-121127979 GGTCTAAGAGAATGAAAATTAGG - Intergenic
1075285249 10:121179273-121179295 GGTCTGGGAGGAAATAAACAAGG - Intergenic
1075319844 10:121482175-121482197 GATCTGATAGGAAAAAAACAGGG + Intronic
1079502233 11:21114360-21114382 GGTCCAAGAGAAGAAAAACTTGG - Intronic
1081891654 11:46547600-46547622 AAACTGAGAGGATCAAAACTTGG - Intronic
1084562833 11:69913957-69913979 GGTGGGAGATCATAAAAACTAGG - Intergenic
1085049412 11:73372443-73372465 GGTCTGTGAGGACACAGACTTGG - Intergenic
1085218710 11:74854311-74854333 GGAGTGAGAGGAAAGAAACTAGG + Intronic
1087174758 11:95086379-95086401 GGGATGACGGGATAAAAACTGGG + Intergenic
1088379186 11:109174343-109174365 AGTCTGAAAGGATCAAAGCTGGG - Intergenic
1093673724 12:21908637-21908659 AGGCTGAGAGGATGAAAAGTAGG + Intronic
1094870716 12:34597821-34597843 GGTTTGAAAGGAAAAAAACACGG + Intergenic
1094871141 12:34599874-34599896 GGTTTGAAAGGAAAAAAACACGG + Intergenic
1094872407 12:34605694-34605716 GGTTTGAAAGGAAAAAAACACGG + Intergenic
1096560900 12:52435036-52435058 GTTGTGAGAGGAGAAAGACTCGG + Intergenic
1099525784 12:83718180-83718202 GGTCTGATAGTTTAAAAAATAGG + Intergenic
1102602761 12:114044989-114045011 GGTATGAGTGGATAGAAACCAGG + Intergenic
1102857783 12:116309507-116309529 GGTCTGAAAGGATACACACCAGG + Intergenic
1111046999 13:82827079-82827101 GATATGAGAGGTTAAAAAATTGG - Intergenic
1113628101 13:111861401-111861423 GGAGTTAGAGGAGAAAAACTAGG + Intergenic
1114455848 14:22853108-22853130 GTTCTGAGAGGAGGAAAGCTGGG + Intergenic
1115129613 14:30038899-30038921 GGTGGGAGAGAATAAAAACATGG + Intronic
1117495310 14:56296524-56296546 GTTCTGAGAGGAAAGAATCTTGG + Intronic
1120003474 14:79330239-79330261 GGTATGAGATGATAACAACTTGG + Intronic
1120411587 14:84163955-84163977 GGTCTGAGATGATAAATTGTTGG + Intergenic
1120484349 14:85092266-85092288 GGTCTGAATGGAAAAAAAGTTGG + Intergenic
1120924000 14:89780078-89780100 GCTCTGTGAGGACAGAAACTGGG + Intergenic
1120982039 14:90298759-90298781 GGCCTGGCAGGATAAGAACTAGG - Intronic
1122225377 14:100273702-100273724 GGTGTGAGAGGGGTAAAACTAGG + Intronic
1126801083 15:52297024-52297046 GATGTGAGAAAATAAAAACTTGG + Intergenic
1127368626 15:58314487-58314509 GTTCTGAGGTGATAAAAACCTGG + Intronic
1129874713 15:78966156-78966178 GCTCTTAGAGGATAAACACATGG - Intronic
1131403237 15:92143222-92143244 GGTCTGTGAGGAAAAAGATTTGG - Intronic
1131621062 15:94068575-94068597 GTTCTGAGAGAATAAAAAGAGGG - Intergenic
1132491505 16:234448-234470 GGTCAAAGAGGAGAAACACTGGG + Intergenic
1139747231 16:69084331-69084353 GGCCTGGGAGGATAAATACAGGG - Exonic
1140424572 16:74850140-74850162 TGGCTGAGTAGATAAAAACTGGG + Intergenic
1140842048 16:78848883-78848905 TATCTGCAAGGATAAAAACTGGG - Intronic
1141329140 16:83092408-83092430 GGTCTTAGATGATTAAAACAAGG + Intronic
1141355699 16:83344714-83344736 GGTCTCAGAGGATAGTCACTGGG - Intronic
1141829973 16:86504920-86504942 GCTCTGTGAGCATAAAACCTGGG - Intergenic
1143583712 17:7840947-7840969 GGCCTGTGAGGATAAAACCAAGG + Intronic
1146830991 17:36069623-36069645 GGTATTAGAAGATATAAACTTGG - Intronic
1147857808 17:43495745-43495767 GGTCAGAGGAGAAAAAAACTGGG + Intronic
1148565973 17:48633306-48633328 GGACTGAGAGGCTAAGGACTGGG + Intronic
1152272025 17:79330378-79330400 GGTCTGAGTGGGAGAAAACTGGG - Intronic
1152491751 17:80639633-80639655 GGACTGAGAAGAGAAAGACTAGG + Intronic
1153520980 18:5953703-5953725 GATCTGAGGGGACAAAGACTGGG - Intergenic
1156158291 18:34329808-34329830 GGTCTGAGACTATAAATATTCGG - Intergenic
1157685481 18:49639651-49639673 GATCTGAGGGGATAAGAACTGGG - Intergenic
1158971149 18:62667847-62667869 GGCCTGAGAAGATTAAGACTTGG - Intergenic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1164176301 19:22778200-22778222 GGTGAGAGAGGATAAAAAAGAGG - Intronic
1164247783 19:23448686-23448708 GCTTTCAGAGGACAAAAACTTGG - Intergenic
1164391949 19:27831640-27831662 TGTGTGGGAGGATTAAAACTAGG + Intergenic
1165691830 19:37869554-37869576 GGTGTGAAAGGAAAAAATCTTGG - Intergenic
1168488936 19:56791112-56791134 TGTCCCAGAGGCTAAAAACTTGG - Intronic
925387403 2:3471831-3471853 GGTCTGAGAGGATCCTCACTTGG + Intronic
928549940 2:32360140-32360162 TGTCTGAGGGGATAAAGACTAGG + Intronic
929126325 2:38525374-38525396 TGTCTGAGAGGATATAATGTAGG - Intergenic
930855198 2:56008762-56008784 GGGCTGAGAGGACAAAACCCTGG - Intergenic
931128317 2:59302461-59302483 GGAATGAGAGGATATAAAATTGG + Intergenic
931420454 2:62122318-62122340 GGTTTGAAAGTATCAAAACTCGG + Intronic
932080127 2:68706709-68706731 TGACTGAGAGGATGAAGACTGGG - Intronic
932681073 2:73826192-73826214 GGTCAGGGAGGGTAAAAACAAGG - Intergenic
933637049 2:84720025-84720047 GGTCTGAGAGGAGAAGGGCTAGG + Intronic
937145916 2:119644290-119644312 GGTCTCAGAATTTAAAAACTGGG + Intronic
937160100 2:119752404-119752426 GTTCTGAGAAGATCAAAATTTGG + Intergenic
938678798 2:133667485-133667507 GGTCTGAGTGGAAAACAACCTGG - Intergenic
939953905 2:148508939-148508961 GGTGTGTGAGGAAAAAACCTAGG + Intronic
941956256 2:171207818-171207840 GGTCTGAGAAGAGAATCACTTGG - Intronic
942023087 2:171885967-171885989 GTTATGAAAGGATAAATACTAGG - Intronic
943746471 2:191467449-191467471 GGTCTGAGAGGGTGAGAACCAGG - Intergenic
944880417 2:204007446-204007468 GGTCTGAGAGGATAGTTACAGGG + Intergenic
944982802 2:205141184-205141206 GTTTTGAAAGGACAAAAACTGGG + Intronic
946320325 2:218950254-218950276 GGTTTGAGAGGATCAGAACCCGG + Intergenic
1168850227 20:971588-971610 GGGCTGAGAGGAAAAAAGCAAGG + Intronic
1169185463 20:3612936-3612958 GAACTGGGAGGAAAAAAACTCGG - Intronic
1175087817 20:56475250-56475272 GGTCAGTGGGGAAAAAAACTTGG + Intronic
1175134268 20:56811129-56811151 TGTATGAGAAGATAATAACTGGG + Intergenic
1175353072 20:58340047-58340069 TTTCTGAGAGGTTAAAATCTTGG - Intronic
1175524708 20:59625663-59625685 GGGGTGAGAGGAGGAAAACTGGG - Intronic
1175670347 20:60897206-60897228 GGTCTCATAGGATAAGAGCTCGG - Intergenic
1179029317 21:37706206-37706228 TGTCTGAAAGGATGAAAGCTGGG + Intronic
1179427263 21:41291600-41291622 GGTGGGAGAGGATAAAGGCTGGG - Intergenic
1179535709 21:42050119-42050141 GGTCTTAGAAGAGAGAAACTGGG + Intergenic
1182678834 22:32062428-32062450 GGTCTGAGAGCATGAGAATTGGG - Intronic
1183421001 22:37711099-37711121 GGTCTGAGAGTCTAGAAACCTGG + Intronic
1184104891 22:42361797-42361819 GGTCTGAGAGGGAACAAGCTGGG + Intergenic
949758194 3:7438244-7438266 GGTGAGATAGGATAATAACTTGG + Intronic
949809111 3:7986954-7986976 TGTCTGAGATGATAAAGACCTGG + Intergenic
950428375 3:12936912-12936934 GGTCTGAGAGAGGAAAAACATGG - Intronic
954358081 3:50099398-50099420 GGTGATAGAAGATAAAAACTTGG + Intronic
955816116 3:62845211-62845233 AGTCTGAGAGAACAAGAACTTGG + Intronic
956444974 3:69317350-69317372 GGTCTGAGAGGATAAAAACTTGG + Intronic
959427437 3:106208356-106208378 AATCTGAGAGTAAAAAAACTAGG - Intergenic
959500651 3:107102647-107102669 GGTGAGTGAGGATACAAACTGGG - Intergenic
960528043 3:118732826-118732848 GGTCTGAGAGGAAAACAAAGAGG + Intergenic
960746037 3:120890060-120890082 GGTCTGAGAGTTTTAAAAATGGG - Intergenic
961062952 3:123847916-123847938 TGTCTAAGAGGATAGAAACTGGG - Intronic
961939591 3:130623478-130623500 AGTCTGAGAGAATGAAAGCTAGG + Intronic
962166984 3:133059567-133059589 GGTCTGAAAGAAGAAAACCTAGG - Intronic
962778043 3:138682439-138682461 GGTCCGAGAGGATAACACATGGG + Intronic
962778221 3:138684629-138684651 GTTCTGAGAGGATAACACATGGG + Exonic
967276652 3:187782560-187782582 GGTCTCTGAGGATAAGACCTGGG + Intergenic
972823985 4:42735279-42735301 GTTCTGAGAGGAAAAACAATAGG - Intergenic
973298773 4:48556628-48556650 GTTCTGAGAGTAAAAAACCTAGG - Intronic
986370231 5:7072951-7072973 GATCTGAGAGGAAAAACGCTGGG - Intergenic
987989610 5:25193403-25193425 AGTCTGAAAGCCTAAAAACTAGG - Intergenic
989280020 5:39630217-39630239 GGTCTGAAACGATGCAAACTGGG + Intergenic
989654239 5:43727964-43727986 GATCTCAGAGGATAGAAAATGGG - Intergenic
993105664 5:83597481-83597503 GCTCTGAGAAAATAAAAACATGG + Intergenic
994331487 5:98511752-98511774 GGTCTGAGAGCATGACAAGTGGG - Intergenic
995687160 5:114783502-114783524 GGTCTGTGAGGAGAAAAGATGGG - Intergenic
997206250 5:132051913-132051935 GGTTTTAGAGTATAGAAACTGGG + Intergenic
997726729 5:136127092-136127114 GGGGAGAGAGGATAAAAATTAGG + Intergenic
1001222103 5:169909820-169909842 GGTCTGAGTAGATAAACAGTGGG + Intronic
1001427796 5:171635463-171635485 GCTCTGAAAGGAAAGAAACTGGG - Intergenic
1001880738 5:175241986-175242008 GGTATCAGAGGATATACACTGGG - Intergenic
1002405626 5:179027908-179027930 GTTCTGAGAGGCTTCAAACTGGG - Intronic
1002663284 5:180805026-180805048 GGTCTGAGAGGCAAGAAACCAGG + Intronic
1002844522 6:935117-935139 GGCCTGAAAGGATGAGAACTTGG + Intergenic
1004678388 6:17866776-17866798 GATTTGATAGGATAAAAAATAGG + Intronic
1006127269 6:31847403-31847425 GGCCTGAGATGCTAAAAACCAGG - Intergenic
1008762075 6:54863151-54863173 GGTCCTATAGGATAACAACTTGG - Intronic
1010391525 6:75343513-75343535 TCTCTGAGAGGATAGAAACAAGG - Intronic
1010559278 6:77327988-77328010 AGTTGGAGAGGATACAAACTAGG - Intergenic
1011097981 6:83687742-83687764 GGTAAGAGATGATGAAAACTGGG + Intronic
1011335851 6:86259094-86259116 GGTCTGAGAAGAAAATAACAGGG - Intergenic
1012512221 6:100015094-100015116 AGTGTGAAAGGAAAAAAACTTGG - Intergenic
1013691588 6:112651261-112651283 GTTCTGGGATGGTAAAAACTAGG - Intergenic
1015214437 6:130733782-130733804 GGTCTGAGAGGAGAGAAGATTGG - Intergenic
1015807969 6:137131655-137131677 GGTCTGAGAAGATGAGAGCTGGG - Intergenic
1017778068 6:157695165-157695187 TGCCTGGGAGGACAAAAACTTGG - Intergenic
1018726911 6:166619846-166619868 GGGCTGAGAGCATTAAAATTGGG + Intronic
1023150614 7:37198259-37198281 GGTCTGAGAGTAGAAATACATGG - Intronic
1030214425 7:107029480-107029502 GGTCTGAGAGACTATAAACTGGG - Intergenic
1034076027 7:148231930-148231952 GGTAGGAGAGGAGAAAAACCTGG + Intronic
1038454790 8:27666159-27666181 GGGCTGAGAGAACAAAAACTGGG - Intronic
1038491225 8:27973173-27973195 GGTCTGAAAAAATAAAAGCTGGG + Intronic
1038712894 8:29964661-29964683 GGTCTAAGAAGATAAAGCCTGGG + Intergenic
1039305057 8:36252313-36252335 GCTCTGAGAAGATAAAATGTTGG + Intergenic
1043722264 8:83559539-83559561 GTTCTGAGATGCTTAAAACTTGG - Intergenic
1043887274 8:85615842-85615864 GGTGTGAGCAGATACAAACTGGG + Intergenic
1043952050 8:86320242-86320264 TGTTTGAGTGAATAAAAACTTGG - Intronic
1045165304 8:99597852-99597874 AGTCTGAGATGATAAAACCCAGG + Intronic
1045910552 8:107402945-107402967 TGTTTGAGAGGATGAAAAATTGG + Intronic
1048705784 8:137151819-137151841 GGACTTGGAGAATAAAAACTTGG + Intergenic
1048826213 8:138429891-138429913 GGCCTGAGAAGATAAATTCTAGG + Intronic
1050364306 9:4860027-4860049 GGTCTGGGAGATTAAAACCTTGG + Intronic
1057858128 9:98617984-98618006 TCTCTGTGAGGATAAAAAATGGG + Intronic
1058844753 9:108945850-108945872 GGTCAGATAGGATATACACTTGG - Intronic
1061091797 9:128430702-128430724 GTTCTGAGAGGATAACTATTAGG - Intronic
1061448939 9:130658541-130658563 GGTCTGAGAAGGCAAGAACTGGG + Intergenic
1185833269 X:3321404-3321426 TGTCAAAGAGGACAAAAACTCGG + Exonic
1186791463 X:13003731-13003753 AGTTTGAGAGGATAGAAATTAGG + Intergenic
1187266460 X:17738048-17738070 GGTCTGACAGGAAATCAACTCGG - Intronic
1191736261 X:64391411-64391433 GGTCTAAGAGGCTGTAAACTTGG + Intronic
1193442745 X:81563606-81563628 GATCTGAGAGGAAAAATATTTGG - Intergenic
1193524726 X:82575273-82575295 CTTCTGAGAGAATAAAACCTTGG + Intergenic
1197187704 X:123606685-123606707 GGATTTAGAGGATAAAAATTAGG + Intronic