ID: 956445154

View in Genome Browser
Species Human (GRCh38)
Location 3:69318847-69318869
Sequence TTCCATGGCAATATTTGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956445151_956445154 1 Left 956445151 3:69318823-69318845 CCTGGAAATTCTGGGCTTGATTT 0: 1
1: 0
2: 1
3: 23
4: 227
Right 956445154 3:69318847-69318869 TTCCATGGCAATATTTGGCAAGG 0: 1
1: 0
2: 0
3: 15
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956445154 Original CRISPR TTCCATGGCAATATTTGGCA AGG Intronic
902974188 1:20076988-20077010 TTCCATGGCTACCCTTGGCAGGG + Intronic
904534638 1:31190986-31191008 TTAGGTGGAAATATTTGGCAGGG - Intronic
908229497 1:62089684-62089706 TTCCATGTCAAAATTTGGAAGGG - Intronic
909025547 1:70477717-70477739 TCCCTTGTCAACATTTGGCATGG + Intergenic
911448971 1:98040058-98040080 TTCAATTACAATATTTGGAACGG - Intergenic
913338493 1:117733236-117733258 TTCCATGGCACTAGTTTTCATGG + Intergenic
914233456 1:145786927-145786949 TTCTGGGGCAATATGTGGCATGG - Intronic
914973409 1:152332727-152332749 TTCTATGGCAATACTTGAGAAGG + Intergenic
916919932 1:169454263-169454285 TTCCATGGCATAATAAGGCAAGG - Intronic
917486914 1:175463691-175463713 TTCCATGACAATTATTTGCAAGG + Intronic
918835410 1:189457577-189457599 TTCCATGGCAATTCATGGCTTGG + Intergenic
919056399 1:192575138-192575160 TTCCATGTTAATATTTTCCAAGG - Intergenic
919844726 1:201634661-201634683 TTTCAAGACAATATTTGGCTGGG + Intronic
921412130 1:214846794-214846816 TTCTATGGCAATATTGAGAAGGG - Intergenic
924381951 1:243473859-243473881 TTCCATGGCACTTTTTAGGAGGG + Intronic
1064734057 10:18362624-18362646 TTCTATGGCAATATTTGTTATGG - Intronic
1064734238 10:18364266-18364288 TTCTATAGCAATATTTGTTATGG + Intronic
1065728082 10:28685473-28685495 TTCTATGACAATATTAAGCAAGG - Intergenic
1067008815 10:42691079-42691101 TTCCATGGGAATCATGGGCATGG - Intergenic
1068991800 10:63158400-63158422 TTCCATGTCAGTCATTGGCAGGG - Intergenic
1071367017 10:84909706-84909728 TTCTATGGAAACATTTGGCAGGG + Intergenic
1076143856 10:128100836-128100858 TTCCAAGGCATTCTTTGGAAAGG - Intronic
1078302736 11:10149446-10149468 TTCCTTGACTACATTTGGCAAGG + Intronic
1079583487 11:22095707-22095729 TTCCCTGGCTCTATTTGTCAAGG + Intergenic
1081440992 11:43080809-43080831 TTCCCTGGCTGTATTTGTCAGGG + Intergenic
1082759574 11:57114308-57114330 TTCTATGGCAACAATTGGCTAGG - Intergenic
1083514606 11:63245014-63245036 TTCCCTAGCAATAGATGGCATGG + Intronic
1085511528 11:77090708-77090730 TTCCATGGCATGATGTGGCTGGG + Intronic
1085867748 11:80315038-80315060 TTCGATGGCAATCTTTGCCCTGG + Intergenic
1086387480 11:86324393-86324415 TTTCAGGGCAATATTTGTGATGG + Intronic
1087007308 11:93482703-93482725 TTCCTCGGGAATATTTGGCCAGG + Intronic
1087458534 11:98418372-98418394 TTCCCTGGCTTTATTTGTCAGGG - Intergenic
1088170810 11:106994329-106994351 TTCAATGGCTATTTTTGGAAAGG - Intronic
1092566549 12:9672133-9672155 TCCCATGGCAAAATTTGGAAGGG + Intronic
1093650198 12:21634401-21634423 TTCCCAGGGGATATTTGGCAAGG + Intergenic
1095169687 12:39019725-39019747 TGCCAAGGCAGTATTTGCCATGG + Intergenic
1101799343 12:108007059-108007081 TGCCATGGCAATGTCAGGCATGG - Intergenic
1102694084 12:114784568-114784590 TTCCCTGGCTCTATTTGTCAGGG - Intergenic
1103747244 12:123133620-123133642 TTCCATGATAATGTTTGGAAAGG + Intronic
1105970264 13:25422992-25423014 TTCCTTGGCTCTATTTGTCAGGG + Intronic
1106354881 13:28971876-28971898 TTACAAGGCAAGCTTTGGCATGG - Intronic
1106758229 13:32843519-32843541 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
1110587171 13:77207234-77207256 ATCCATAGCAAAAATTGGCAAGG + Intronic
1115349466 14:32378133-32378155 TAAAATGGCAATATTTTGCATGG + Intronic
1115423095 14:33220942-33220964 TTCTCTGGCAATAGTTGACAAGG - Intronic
1116742644 14:48776435-48776457 AGCCATGGCCATAGTTGGCATGG - Intergenic
1117327630 14:54683923-54683945 TTCTATGGCAATATTTTGCTGGG - Intronic
1118543212 14:66854581-66854603 TTTCATGGCAATTTTTTGAAAGG + Intronic
1118770133 14:68937327-68937349 TTCTCTGGGATTATTTGGCAAGG + Intronic
1119145729 14:72312263-72312285 TTACAGAGCAATATTTGCCAGGG - Intronic
1120079729 14:80202273-80202295 TGCCTTGGCTCTATTTGGCATGG - Intronic
1123955006 15:25326038-25326060 TTCCAAGCCAATCTGTGGCATGG + Intergenic
1126402729 15:48290264-48290286 TTCCAGGGCAATAACAGGCATGG + Intronic
1127991641 15:64123157-64123179 TACCATGCCAATATTTGGGCTGG - Intronic
1130862957 15:87907846-87907868 TTCTATGGTAATTTCTGGCAGGG - Intronic
1131445236 15:92493379-92493401 TTCCAGTGCAACATGTGGCATGG - Intronic
1131524532 15:93142424-93142446 CTCCATGGCAGTATTTGGTTTGG + Intergenic
1131832560 15:96363069-96363091 GTCCCTGGAATTATTTGGCATGG + Intergenic
1139203434 16:65002850-65002872 TTACATGGTAATATTTGGGAGGG - Intronic
1143039624 17:4024166-4024188 AACCTGGGCAATATTTGGCATGG - Intronic
1144270583 17:13611664-13611686 TTCAATGGCAATACTTGGAGTGG - Intergenic
1146848143 17:36197978-36198000 TTCCATGCCTAGAGTTGGCATGG - Intronic
1150844706 17:68643539-68643561 TCCCATTGCAATAATTGGGAAGG - Intergenic
1155622298 18:27793638-27793660 TTCCTAGGCAATATTTAGAATGG - Intergenic
1158302456 18:56066840-56066862 TTTCATTGAAACATTTGGCATGG + Intergenic
1159379236 18:67634870-67634892 TTCCATGGGAATAGAAGGCAGGG - Intergenic
1159584167 18:70267307-70267329 TTCCATGTCCATATTTTGTAGGG - Intergenic
1160194731 18:76743296-76743318 TTCCTTGGCTGTATTTGTCAAGG + Intergenic
1161352856 19:3803489-3803511 TTCCCTGGCAGTGTTTGGGACGG - Intergenic
1165880574 19:39039761-39039783 TTCCCTGGCTCTATTTGTCAAGG - Intergenic
1168592033 19:57644517-57644539 ATCCTTGCCAATACTTGGCATGG + Intergenic
928869799 2:35962798-35962820 TACCATGGCAATATTTTTGAAGG - Intergenic
931784278 2:65605275-65605297 CCCCATGGCAATATTTGGCTGGG - Intergenic
932891859 2:75604475-75604497 TTAAATGTCAATATTTGGTAAGG + Intergenic
933061099 2:77737579-77737601 TTCCTTGGCAACATTTGTCAGGG - Intergenic
935199220 2:100841481-100841503 TTTCATAGGTATATTTGGCATGG - Intronic
936559360 2:113523293-113523315 TTCCCTGGCTCTATTTGTCAGGG - Intergenic
940748588 2:157597934-157597956 TTCACTGGCAATATTTGGATAGG - Intronic
941287048 2:163627743-163627765 TTTCATGGAAATATGTGGAAGGG - Intronic
942439572 2:176018975-176018997 TTTCATGGCCACACTTGGCAAGG + Intergenic
942737967 2:179138529-179138551 TTCTCTGGCACTATTTGTCAGGG - Intronic
944177690 2:196851187-196851209 TTCCCTGGCTCTATTTGTCAGGG - Intronic
948067920 2:235095702-235095724 ATCCTTGTCAACATTTGGCATGG - Intergenic
948514669 2:238496664-238496686 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
948965475 2:241376409-241376431 TACACTGGCAATATTTGTCAGGG - Intronic
1172969904 20:38865707-38865729 TCCCATGGCAGTAGGTGGCAGGG + Intronic
1175634607 20:60569928-60569950 ATCCATGGAAATAATTTGCAGGG + Intergenic
1177884693 21:26733561-26733583 TTCCATGGCAGTGTTTGTCATGG + Intergenic
1180892173 22:19297166-19297188 TTCCATGTCAACATTAGGCTGGG + Intergenic
1181626638 22:24126646-24126668 TTTCAGGGCAAGTTTTGGCAGGG + Intronic
1184896381 22:47409531-47409553 TCCCATGGCCAGATGTGGCAAGG + Intergenic
1184912524 22:47545945-47545967 TCCCATGGCAATCTCTGGGATGG - Intergenic
949139027 3:609447-609469 TTCCAAAGAGATATTTGGCAAGG + Intergenic
949862074 3:8515181-8515203 TTCAATGGCAAGATTTGAAAGGG - Intronic
950859264 3:16133130-16133152 TTCCAGGGCCATATGTGGCCAGG - Intergenic
951527716 3:23669825-23669847 TGCCATGGTAATACTGGGCATGG - Intergenic
951943181 3:28104701-28104723 TTCCTTGGCACTATTTGTAAAGG + Intergenic
952645533 3:35653422-35653444 TTCCATGGCCTTCTTTGTCATGG - Intronic
953052283 3:39355700-39355722 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
953995569 3:47516887-47516909 TTCCTTGGCAATAGGTGGTATGG + Intergenic
954933216 3:54302448-54302470 TTCCAGGGAAAAATTCGGCAAGG + Intronic
955689685 3:61578855-61578877 TTCCCAGGGAATGTTTGGCAGGG + Intronic
956445154 3:69318847-69318869 TTCCATGGCAATATTTGGCAAGG + Intronic
956864326 3:73354199-73354221 TTCTATGCCAGTCTTTGGCATGG + Intergenic
958243772 3:91119672-91119694 TTCCAAGTGAATATTTGGAACGG + Intergenic
958248132 3:91192738-91192760 TTCCAAGTGAATATTTGGAACGG + Intergenic
959439826 3:106361480-106361502 TTCCATAGCAATAGTTTCCAGGG + Intergenic
959857859 3:111181010-111181032 ATCCATGTACATATTTGGCAAGG - Intronic
960931993 3:122861576-122861598 TTCCATGGGAATCTTTGAGAAGG + Intronic
961536346 3:127573247-127573269 TTCCAGGGCCATGCTTGGCAAGG - Exonic
962126275 3:132622396-132622418 TTCCAAGGCAATATGAGGGATGG - Intronic
962294083 3:134164881-134164903 ATCCTTGTCAATATTTGGTATGG + Intronic
962539866 3:136370236-136370258 TTCAGTGGCAGTATTTTGCATGG - Intronic
962641127 3:137387577-137387599 TTCCAGATCAAGATTTGGCAGGG + Intergenic
964630117 3:158801452-158801474 TTCCATAGAAATATCTGGAAAGG - Intronic
964896487 3:161602740-161602762 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
965388973 3:168081381-168081403 TTCCATGGACATAGTAGGCAGGG + Intronic
965437312 3:168668004-168668026 TTCTATGGAAAGTTTTGGCATGG + Intergenic
966274818 3:178152757-178152779 ATCTATGGCAATCTATGGCATGG - Intergenic
970300377 4:14675207-14675229 TTCCATGTGAGTATCTGGCATGG + Intergenic
971095626 4:23399126-23399148 TAGCATGGCAATATTGTGCATGG - Intergenic
971528951 4:27660416-27660438 TCCCATGGAAATATGTGCCATGG + Intergenic
978161978 4:105559533-105559555 TTTTATGCCAAAATTTGGCAGGG - Intronic
978469065 4:109041795-109041817 TTCCAAGGCTATCTTGGGCACGG - Intronic
979071710 4:116216042-116216064 TTCTATGTGAATAATTGGCATGG - Intergenic
979080189 4:116329133-116329155 TTACATGTCAGTATTTGACAGGG + Intergenic
979142383 4:117193456-117193478 GTCCATGGCAGGAGTTGGCAGGG + Intergenic
979253736 4:118591104-118591126 TTCCCTGGCTCTATTTGTCAAGG + Intergenic
982224016 4:153149312-153149334 CTCCATGGAAATGTTTGTCATGG + Intergenic
982846283 4:160256669-160256691 TTCCATAGCAATAGTTTTCAGGG + Intergenic
988284527 5:29194184-29194206 TTCCCTGCCTTTATTTGGCAGGG + Intergenic
988696777 5:33629515-33629537 TTCCCTGGCTATATTTATCAGGG - Intronic
990836392 5:60026205-60026227 TCCCATGGAAATATTTAGCAAGG - Intronic
991188912 5:63845538-63845560 TTCCATGGCGATAGAAGGCATGG - Intergenic
993160615 5:84286009-84286031 TTCCATGGGAATTTTTTTCATGG + Intronic
993546405 5:89218320-89218342 TTCCAGGACACTGTTTGGCAGGG + Intergenic
994268139 5:97742275-97742297 TTGCATGGCAATAGGTTGCATGG + Intergenic
1001847109 5:174932120-174932142 TTCCATGGTCATATTTGGAAGGG + Intergenic
1003752745 6:9079373-9079395 GTCCATGGCAATCCTTGTCAGGG + Intergenic
1004984196 6:21061972-21061994 ATGCATGGATATATTTGGCAAGG - Intronic
1007048819 6:38804846-38804868 CCCCAAGGGAATATTTGGCAAGG + Intronic
1010028595 6:71248326-71248348 TTCCATACCCATATTAGGCAAGG + Intergenic
1011334648 6:86246703-86246725 TTACATGGCAAAATATGGCAAGG - Intergenic
1014576306 6:123078173-123078195 TTTCATGTAAATATGTGGCAAGG + Intergenic
1015046740 6:128785378-128785400 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
1015089742 6:129341084-129341106 TTCCATGGCAATATCTGTGGTGG + Intronic
1015206241 6:130642746-130642768 CTCCATAGCCATACTTGGCATGG + Intergenic
1015465723 6:133546383-133546405 TTCTAAGGCAATTTTTGGTAAGG - Intergenic
1016726107 6:147369774-147369796 TACCATGCCAAGTTTTGGCAAGG + Intronic
1018764089 6:166916771-166916793 CTCCATGGCAAAATCTGGTATGG + Intronic
1018914206 6:168122841-168122863 TTCCATGGCCGTGTTTGGGACGG + Intergenic
1019861637 7:3664262-3664284 TTTCATTGCAACATTTGCCATGG - Intronic
1020543055 7:9485984-9486006 TTCAGTGGCAATATATGACAAGG - Intergenic
1021037919 7:15824297-15824319 TTCCTTGGAAATATTTTTCATGG - Intergenic
1021729054 7:23578720-23578742 TTACAAAGGAATATTTGGCAAGG + Intergenic
1022399178 7:30020139-30020161 TTTCATGGAAATATGTGGGATGG - Intronic
1022832419 7:34081453-34081475 TACGATGGGATTATTTGGCAGGG + Intronic
1023233188 7:38055280-38055302 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
1024405705 7:48976883-48976905 TTCCCTGGCTCTATTTGTCAAGG - Intergenic
1026614621 7:71890312-71890334 TTCCAAGGCACCATTTGTCATGG - Intronic
1031338899 7:120574374-120574396 TCCAATGGCAATACTTGACAAGG + Intronic
1032394392 7:131578822-131578844 TTCCATGGGAATAATGGGCTGGG + Intergenic
1032753003 7:134861257-134861279 TTCCAGGTCACTATTTGCCAAGG + Intronic
1040679335 8:49789768-49789790 GTGCATGGCAATACTTTGCAAGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1042918871 8:73902010-73902032 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
1043247384 8:78022045-78022067 TTCCATGGCAATTTGGGGAAGGG + Intergenic
1043758801 8:84038092-84038114 GTCAATGCCAATATTTGGTAAGG - Intergenic
1043831475 8:84994362-84994384 TGGCAGGGCAATTTTTGGCAAGG + Intergenic
1044919872 8:97157715-97157737 TTCCATTGCAATCTCTGGGATGG - Intergenic
1046124150 8:109883075-109883097 TTCAATGGCCACATTGGGCATGG + Intergenic
1048575053 8:135683747-135683769 TTCCATTGCAAAAGTTGGAAAGG - Intergenic
1049893497 9:92904-92926 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
1050023500 9:1309316-1309338 TTTCATGTCATTATTTGGCAGGG + Intergenic
1051734110 9:20180581-20180603 TTCCATGGAGATTATTGGCATGG + Intergenic
1053734715 9:41092972-41092994 TTCCCTGGCTCTATTTGTCAGGG + Intergenic
1054693664 9:68338425-68338447 TTCCCTGGCTCTATTTGTCAGGG - Intronic
1054929213 9:70618785-70618807 TTCCATGGCAGATTTTGGCTGGG + Intronic
1056156864 9:83846541-83846563 TTACATGACAATACTTTGCAGGG + Intronic
1056291586 9:85148965-85148987 TTCCATAGCAAGATTTGGGGAGG + Intergenic
1186095253 X:6094352-6094374 TGCAATAGCAAGATTTGGCAAGG + Intronic
1187955233 X:24511168-24511190 TTCCTTGGCAACACTTGGCAGGG - Intronic
1189918653 X:45881908-45881930 TTCCTTGGCTCTATTTGTCAGGG - Intergenic
1193431480 X:81411723-81411745 TTCAATTTAAATATTTGGCATGG - Intergenic
1194096773 X:89650096-89650118 TTCAATGCCAAATTTTGGCAAGG + Intergenic
1194906167 X:99578247-99578269 TTCCATGACAATAGAAGGCAGGG - Intergenic
1195705372 X:107734450-107734472 TTCCCTGGCAAGATCTAGCAAGG - Intronic
1196224763 X:113153069-113153091 ATCCTTGCCAATATGTGGCATGG - Intergenic
1196395362 X:115255692-115255714 ATCCTTGTCAATATTTGGTAAGG - Intergenic
1198640998 X:138756514-138756536 TTCCATAGCAATTTGTGGCCAGG + Intronic
1199695965 X:150342709-150342731 TTCCAGGGCTAAATTTGGCAGGG - Intergenic
1200449790 Y:3311470-3311492 TTCAATGCCAAATTTTGGCAAGG + Intergenic