ID: 956445182

View in Genome Browser
Species Human (GRCh38)
Location 3:69319098-69319120
Sequence ACCTCTACACAAACCTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 114}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956445181_956445182 25 Left 956445181 3:69319050-69319072 CCGGGCAAAGTGCTTGACATTTA 0: 1
1: 0
2: 5
3: 41
4: 571
Right 956445182 3:69319098-69319120 ACCTCTACACAAACCTATCAAGG 0: 1
1: 0
2: 0
3: 10
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956445182 Original CRISPR ACCTCTACACAAACCTATCA AGG Intronic
900696251 1:4012388-4012410 ATCTCTACAAAAAACTAGCAGGG + Intergenic
904189946 1:28736183-28736205 GCATCTACACAAAACTTTCAAGG - Intergenic
905219749 1:36436868-36436890 ACCAGTACTCAAAACTATCAAGG - Intronic
905537865 1:38737573-38737595 ACCTGTACCAAAACCTATCTTGG + Intergenic
907369380 1:53990683-53990705 ACCTCTAGCCAAACTGATCAGGG + Intergenic
909247774 1:73310412-73310434 AGCACTGCTCAAACCTATCAAGG + Intergenic
911252810 1:95597338-95597360 ACTTCTACAACAACCTATAAGGG - Intergenic
915442134 1:155951833-155951855 TCCTCAACACAAAGCTGTCAGGG - Intronic
916840080 1:168591196-168591218 AGCTCAGCACAAACCTAACATGG - Intergenic
919109404 1:193198902-193198924 ACCTCTAAACAAACTGATTAAGG - Intronic
919363892 1:196632284-196632306 ACCTTTACACAAAGATATCATGG - Intergenic
920067120 1:203276861-203276883 CTCTCTACACAAACCTCTGAAGG + Intergenic
1063469107 10:6270267-6270289 CCCTCTCCACAAATCTCTCACGG + Intergenic
1063634706 10:7770731-7770753 ATATTTACACAAAGCTATCATGG + Intronic
1065396718 10:25247263-25247285 ACTTCTTCAACAACCTATCATGG + Intronic
1066315067 10:34237473-34237495 ATTTCTACAAAAAACTATCATGG - Intronic
1072305630 10:94104227-94104249 TCCTCTTCACAACCCTATGAAGG + Intronic
1080765394 11:35291765-35291787 ACCTCGACACGAACCTCTAATGG - Intronic
1085699499 11:78733582-78733604 ACCTGCAGACAAACCTAGCAAGG + Intronic
1088371221 11:109090445-109090467 ACCTTTATACAAACCTTGCAAGG + Intergenic
1092771888 12:11904277-11904299 ACCTCTACACGTAGCTATAAGGG + Intergenic
1098350955 12:69559537-69559559 ACCTATACACAAAACTACAAAGG - Intronic
1100913116 12:99387967-99387989 ACCTCTATCCAAATATATCATGG - Intronic
1102604947 12:114061142-114061164 ACCTCTATACAATCCTATAATGG + Intergenic
1103335554 12:120186773-120186795 ACATTTACTCCAACCTATCAGGG + Intronic
1103750298 12:123153996-123154018 AGCTCTGCACAACCCTAGCACGG + Intronic
1107566252 13:41608062-41608084 ACATACACACAAACATATCAAGG + Intronic
1112167144 13:96931741-96931763 ACCTCAACACAAACCCCTCAGGG + Intergenic
1122611295 14:102985128-102985150 ACCTCCACACCACCCTGTCACGG - Intronic
1122611344 14:102985332-102985354 ACCTCCACACCACCCTGTCACGG - Intronic
1122611355 14:102985383-102985405 ACCTCCACACCACCCTGTCACGG - Intronic
1124992276 15:34687154-34687176 ACCTCTACTCAGACTTATTAGGG - Intergenic
1127809229 15:62548970-62548992 ACCATTACACACTCCTATCAAGG - Intronic
1128006276 15:64244712-64244734 ACCTCTACAAAAAATTAGCAGGG + Intronic
1134502935 16:14783279-14783301 ACCTGGACACAGGCCTATCATGG - Intronic
1134577629 16:15345617-15345639 ACCTGGACACAGGCCTATCATGG + Intergenic
1135703861 16:24657371-24657393 ACCTCTAGAGAGACTTATCAAGG + Intergenic
1138809308 16:60129951-60129973 ACCTCTACAGAAACCCAAAAGGG + Intergenic
1140951326 16:79820672-79820694 ACCTCAAAACAGACCTATAAGGG + Intergenic
1151409808 17:73914824-73914846 CCCCCTCCACAAGCCTATCAGGG + Intergenic
1152182779 17:78834727-78834749 ATCTCTACAAAAACAAATCAAGG - Intronic
1155456746 18:26024482-26024504 ACCTCTACAAAAAACTAGCCAGG - Intronic
1157313346 18:46568764-46568786 ACCTCTGCACAAACCTAAGTTGG + Intronic
1160103728 18:75948663-75948685 ACCAGTACTCAAAACTATCAAGG + Intergenic
1161759435 19:6160451-6160473 CCCTCTACCCATACCTAGCACGG - Intronic
1162028789 19:7908655-7908677 ACGGCTACACACACCTACCAAGG - Intronic
1167815154 19:51873918-51873940 ACCTCCACAAAAAATTATCATGG - Intronic
1168571094 19:57470651-57470673 ATCTCTACCCAAACCAATCAAGG + Exonic
925999563 2:9319363-9319385 ACCTCTACAGAGGCCTCTCAGGG + Intronic
928282739 2:29963561-29963583 ACCTCTCCACAAACCTTCCCAGG + Intergenic
928421687 2:31141959-31141981 ACCTCAACAGAAACCTGTCTGGG - Intronic
929041731 2:37751005-37751027 ACCTCAACACAGACCCTTCACGG - Intergenic
930022984 2:47012597-47012619 TCCTGTACACAAACAAATCATGG + Intronic
932458117 2:71862569-71862591 ACCTCTACAAAAACTTAGCTGGG - Intergenic
935065083 2:99640425-99640447 ATCTGTACATAAACCTAACAAGG + Intronic
935842120 2:107125080-107125102 ACCCCCACACAAACATAACACGG - Intergenic
939915545 2:148038411-148038433 ATCTCTACAAAAACTTTTCAGGG + Intronic
941181759 2:162267739-162267761 TCTTCTACACATACCTCTCAAGG + Intronic
944586766 2:201179569-201179591 ACCTCCACCCCAACCTATGAGGG - Intergenic
946641423 2:221787501-221787523 ACCTTTAGAAAAACCTATAATGG + Intergenic
1170030763 20:11941607-11941629 ATATCTACACAAACCTATCCTGG - Intergenic
1175523138 20:59615706-59615728 ACCACTACACAAGACTAACATGG - Intronic
1178226373 21:30724050-30724072 TCATCTACACAACACTATCATGG + Intergenic
1178437896 21:32575636-32575658 ACCTCTGCAGGAACCTATCTTGG - Intergenic
1179650000 21:42802155-42802177 ACCTCTATACAGTCCTATAACGG - Intergenic
1180966869 22:19794106-19794128 ATCTCTACAAAAACTTATCCAGG + Intronic
1182927479 22:34139187-34139209 ACCTCTCCAGGAACCTAGCAAGG - Intergenic
949432178 3:3989620-3989642 GCTTTTACACAGACCTATCATGG + Intronic
953607616 3:44421800-44421822 ACCTCTAGACATACCTAAAAGGG + Intergenic
955253739 3:57308262-57308284 ACCTCTATACAGTCCTATAATGG + Intronic
956445182 3:69319098-69319120 ACCTCTACACAAACCTATCAAGG + Intronic
957734499 3:84188727-84188749 ACCTCTATACAATCCGATAATGG - Intergenic
962544915 3:136424184-136424206 ACCTCTGCACAAAGCAATTAAGG + Intronic
964983965 3:162716978-162717000 ACCTCTATACAGACGTATAATGG + Intergenic
966166312 3:177021022-177021044 ACATGTACAAAAACCTGTCATGG + Exonic
966733027 3:183166218-183166240 ACCTCCAGCCAAACTTATCAGGG - Intergenic
967862623 3:194163467-194163489 ACCTCTATACAATCCTTTCATGG - Intergenic
972147424 4:36045145-36045167 AACTATAAACAAAACTATCATGG + Intronic
973694652 4:53478408-53478430 ATCTATACTCAAACCAATCATGG + Intronic
974406541 4:61479119-61479141 AACTCTAGACAAAAGTATCAGGG + Intronic
975590661 4:75996491-75996513 GCCTCTGGACAAATCTATCAGGG + Intergenic
977057041 4:92205312-92205334 ACCTCTCCACAAAGTTATCTTGG + Intergenic
980845926 4:138324967-138324989 ACCTCAACACAACCATATCAGGG - Intergenic
990357178 5:54980348-54980370 ACCTCTGCACAAACCTGTTTGGG - Intronic
991235549 5:64391290-64391312 ACGTCTACAAAAACCTTTCTAGG + Intergenic
991645919 5:68800193-68800215 GCCTCATCACACACCTATCAGGG + Intergenic
995097901 5:108260901-108260923 ACCTCTACACAAGACAATCAGGG - Intronic
999044117 5:148449088-148449110 ACCTCTACAGACACCAATCATGG + Intergenic
1000206646 5:159066786-159066808 TCCTCTACCCACACCTTTCAAGG + Intronic
1001221332 5:169903417-169903439 ACCACCACAGAAACATATCAGGG - Intronic
1001554346 5:172625841-172625863 ACCTCTTCACAAACCTCCCCAGG - Intergenic
1003362047 6:5436339-5436361 GCCTCTACACATACTTAACATGG + Intronic
1008327730 6:50204980-50205002 ACATCTACACAAAGTTAACATGG + Intergenic
1008718578 6:54320421-54320443 ACCTTGACACAAACCTGACATGG + Intronic
1011030515 6:82917794-82917816 ACCTCAACACAGAACTCTCAGGG + Intronic
1011749616 6:90441966-90441988 ATCTCTACAAAAACCTAGCCAGG - Intergenic
1016934551 6:149440012-149440034 ACCTACACACAAACCTGTGAAGG - Intergenic
1017552694 6:155526142-155526164 ACCTCTACTCAAAACTTTCCAGG - Intergenic
1019582256 7:1770638-1770660 ACCTGTCCACAAACCTGCCAGGG - Intergenic
1020483469 7:8691471-8691493 ACCTCTACAAAAACAAATTAAGG + Intronic
1024738832 7:52334258-52334280 ACCTCTATACAGACCAATAATGG - Intergenic
1030480090 7:110092418-110092440 ACTTCTAGAAAAACCTAACAGGG + Intergenic
1030547536 7:110916070-110916092 AACTCTACATAACCATATCAAGG - Intronic
1033979424 7:147145646-147145668 AGCTCTAAACAAACCTAAAAGGG - Intronic
1038443827 8:27589341-27589363 CCTTCTAGACAAACATATCAGGG - Intergenic
1039376426 8:37038835-37038857 ACATATACACACACATATCATGG - Intergenic
1042389005 8:68211489-68211511 TCCTCTACACAGACTTACCATGG + Intronic
1042979455 8:74509076-74509098 CCCTCCCCACAAAACTATCATGG - Intergenic
1047550671 8:125869257-125869279 ACCTTTACAGAACCCTATTAGGG + Intergenic
1048424669 8:134312075-134312097 GCCTCTGCACAAACCCCTCAAGG + Intergenic
1049872689 8:144993376-144993398 GCCTCTATACAAACCTAAGAGGG + Intergenic
1049988069 9:970621-970643 ACATCTGCAAAAACCTGTCAAGG - Intergenic
1050117980 9:2280156-2280178 ACCTCTATACAGTCCTATAAGGG + Intergenic
1058153726 9:101488507-101488529 ACCTCTCAACAAACCTATGAGGG - Intronic
1059737617 9:117118001-117118023 ACCTCTTCACAAACCCAACGAGG + Intronic
1061469678 9:130814408-130814430 ACCTCTACCCAGACTGATCAGGG + Intronic
1062560612 9:137139995-137140017 ACGTCTACACACACCAGTCAGGG - Intronic
1185651063 X:1648506-1648528 ACCTCCCCACAAGTCTATCATGG - Intergenic
1186169536 X:6862117-6862139 ACCTCTAAATAAATATATCAAGG - Intergenic
1188332612 X:28893400-28893422 ACCTCTATACAGTCCTATAATGG - Intronic
1190708792 X:53050568-53050590 ATCCCTACACACACCCATCAGGG - Intronic
1192281192 X:69688053-69688075 CCCTCTTCACAGACTTATCAAGG + Intronic
1195800727 X:108706370-108706392 ACCTCTACAAAAACTTAGCCAGG - Intergenic
1196614565 X:117753234-117753256 ACATCTATACAAAGCTATGATGG + Intergenic
1199648995 X:149936093-149936115 TCCTCTACTGAAACCTTTCAAGG + Intronic