ID: 956449352

View in Genome Browser
Species Human (GRCh38)
Location 3:69358067-69358089
Sequence CATAGTCAACTCTGCAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 147}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956449349_956449352 30 Left 956449349 3:69358014-69358036 CCTGGACCTGGCATCTCTCAAAA 0: 1
1: 0
2: 1
3: 5
4: 157
Right 956449352 3:69358067-69358089 CATAGTCAACTCTGCAATTGAGG 0: 1
1: 0
2: 2
3: 10
4: 147
956449350_956449352 24 Left 956449350 3:69358020-69358042 CCTGGCATCTCTCAAAAAGAGAA 0: 1
1: 0
2: 1
3: 23
4: 259
Right 956449352 3:69358067-69358089 CATAGTCAACTCTGCAATTGAGG 0: 1
1: 0
2: 2
3: 10
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956449352 Original CRISPR CATAGTCAACTCTGCAATTG AGG Intronic
908089401 1:60670533-60670555 CATAATCAACTCAGTCATTGTGG + Intergenic
909184699 1:72471532-72471554 ACTATTCAACTCTGCCATTGTGG + Intergenic
909225472 1:73015167-73015189 CATAGGCAAATCTGCAAATATGG - Intergenic
910456461 1:87402727-87402749 CCCAGTAAACTGTGCAATTGGGG + Intergenic
913076901 1:115347875-115347897 CAAAGTCATCTCTGCACATGGGG - Intergenic
913368553 1:118070324-118070346 ACTAGTCACCTCTGCAAGTGGGG + Intronic
916388406 1:164303665-164303687 ACTACTCAACTCTGCCATTGTGG - Intergenic
924505799 1:244682663-244682685 CACACTCAACTCTGCCATTGTGG + Intronic
1066323660 10:34331253-34331275 CAAAGTCACCTCGGCAACTGCGG + Exonic
1068112411 10:52695298-52695320 CCAAGTCAACTCTGCTTTTGAGG - Intergenic
1069918511 10:71801921-71801943 CATTGTCAAATCTGCAAAGGAGG + Intronic
1071949010 10:90681706-90681728 CTAACTGAACTCTGCAATTGTGG + Intergenic
1072449047 10:95524643-95524665 ACTATTCAACTCTGCCATTGTGG - Intronic
1074316397 10:112365282-112365304 CAGAGTCAACTCTGCCATGTGGG + Intergenic
1074642237 10:115399336-115399358 AATAATCAGCTCTGAAATTGAGG - Intronic
1075936027 10:126342097-126342119 CACAGTCATCCCTGCAAGTGGGG - Intronic
1078074736 11:8148050-8148072 CAAAGTCAACTCTGCTCCTGAGG + Intronic
1078465591 11:11547719-11547741 CATCCTCTACGCTGCAATTGGGG + Intronic
1086745811 11:90425513-90425535 CATGCCCAAATCTGCAATTGTGG - Intergenic
1088378350 11:109166572-109166594 CATAGTCAGCTCAGCTACTGCGG - Intergenic
1090507064 11:127327440-127327462 AATATTCAACTCTGCCATGGTGG - Intergenic
1091129582 11:133134272-133134294 CCTAGTTAAGTCTGCAAGTGGGG - Intronic
1091528965 12:1335928-1335950 CATAATGAACTCTGAAATTGAGG - Intronic
1094106492 12:26817378-26817400 GATAGTCACCACTGCTATTGAGG - Intronic
1094347799 12:29489975-29489997 CATAGGCAATTGTACAATTGTGG + Intronic
1097851160 12:64411753-64411775 GATAGACAACTGAGCAATTGGGG - Intronic
1100135517 12:91548529-91548551 AATAATCAGCTCTGAAATTGAGG + Intergenic
1106095262 13:26637806-26637828 CACAGACCACTCTGCAGTTGAGG - Intronic
1110243265 13:73292212-73292234 CATACTCAACTCAGCTAATGAGG + Intergenic
1110302600 13:73946793-73946815 CATATTCAACTCTGCATTCACGG + Intronic
1110471074 13:75861109-75861131 CCTACTCAACACTGCTATTGAGG - Intergenic
1115731724 14:36276416-36276438 CATAGTCAAATCTCAAATTTGGG + Intergenic
1117513043 14:56471936-56471958 CACAGTGAACTCTGCAATCCTGG - Intergenic
1125843533 15:42828879-42828901 CATACTCATCTTTGCATTTGTGG - Intronic
1127113160 15:55696306-55696328 AATACTGAACTCTGAAATTGTGG - Intronic
1127597036 15:60495615-60495637 AATAGTCTCCTCTGCCATTGGGG - Intronic
1127670294 15:61188263-61188285 ACTACTCAACTCTGCCATTGTGG + Intronic
1128929019 15:71687118-71687140 CATAGTCAACTCTGAGCATGAGG + Intronic
1132113389 15:99118422-99118444 GACAGTCAACTCAGCAATTCTGG - Intronic
1133079088 16:3304520-3304542 CTTACTCAACTCTGCAATATTGG + Intronic
1135579114 16:23610172-23610194 CATACTCAACTCTGCCATTGTGG - Intronic
1136664819 16:31800911-31800933 CATAGTTAACTCTGTTATTTGGG - Intergenic
1142933903 17:3311256-3311278 CATAGGGAACTCTGCACTGGTGG - Intergenic
1143995351 17:11001976-11001998 ACTACTCAACTCTGCAATTGTGG - Intergenic
1144333791 17:14250253-14250275 CAGACTCAAATCTGCTATTGAGG + Intergenic
1144744885 17:17607444-17607466 CAGAATCAACTCTGCATTGGGGG - Intergenic
1145930754 17:28683508-28683530 CCTGCTCAACTCTGAAATTGTGG - Intronic
1146553872 17:33806218-33806240 AATACTCAACTCTGCCTTTGTGG + Intronic
1149096332 17:52845313-52845335 CATAGTTAACACTCCAATAGGGG - Intergenic
1149355829 17:55838313-55838335 CACAGTGAAATCTGCAATAGAGG + Intronic
1150056876 17:62025200-62025222 ACTATTCAACTCTGCCATTGTGG + Intronic
1150175010 17:63045193-63045215 ACTACTCAACTCTGCCATTGTGG - Intronic
1150412644 17:64959555-64959577 TCTAGTCAACTCTGCCATTGAGG + Intergenic
1150799242 17:68265907-68265929 TCTAGTCAACTCTGCCATTGAGG - Intronic
1152843947 17:82587828-82587850 CCGAGTCAACTCTGGCATTGGGG + Intronic
1156031075 18:32713121-32713143 ACTATTCAACTCTGCAGTTGTGG - Intronic
1156654125 18:39263269-39263291 AATAATAAATTCTGCAATTGAGG + Intergenic
1159083846 18:63765109-63765131 CATAGTTGAATCTACAATTGTGG - Intronic
1159845034 18:73448940-73448962 AAAAGTCAAATCTGCAATTTTGG - Intergenic
1163353515 19:16794728-16794750 AAGACTCAACTCTGCAGTTGTGG + Intronic
1163363531 19:16863094-16863116 AATACTCAACTCTGCCTTTGTGG - Intronic
1164399627 19:27893678-27893700 CATAGTCCACTCTGTGATGGAGG - Intergenic
1168028866 19:53663994-53664016 CATAATAAGCTCTGGAATTGGGG + Intergenic
925786616 2:7437289-7437311 ACTACTCAACTCTGCCATTGAGG + Intergenic
926505930 2:13715878-13715900 ACTACTCAACTCTGCCATTGTGG + Intergenic
929058201 2:37897019-37897041 CATTGTGAACTGTGCATTTGAGG - Intergenic
931016305 2:57984110-57984132 ACTACTCAACTCTACAATTGTGG + Intronic
931811683 2:65860313-65860335 CATTGTCAAATCTGCAGGTGGGG - Intergenic
933316598 2:80722939-80722961 ACTACTCAACTCTGCCATTGTGG + Intergenic
935423222 2:102892729-102892751 CAGACTCAACTCGGCAAATGGGG - Intergenic
940105160 2:150091348-150091370 TATAGTCATCTCTGCAAATTAGG - Intergenic
944184974 2:196937788-196937810 GCTAATCAACTCTGCCATTGAGG + Intergenic
945692424 2:213054592-213054614 CTTTGTCAACTTTGAAATTGTGG - Intronic
1174784026 20:53416044-53416066 CGCAGTCAGCTCTGCAATTTAGG + Intronic
1175451017 20:59068217-59068239 GTTAGTCAACTTTGCCATTGGGG - Intergenic
1175612852 20:60365734-60365756 CATTATCAACTCTGCATTTTGGG - Intergenic
1181914195 22:26266182-26266204 AGCAGTCAACTCTGCCATTGAGG - Intronic
949697330 3:6714208-6714230 CATAGTCAACTCAGAGATTTTGG + Intergenic
951480672 3:23159203-23159225 CATTGTGAACTGTGCATTTGAGG - Intergenic
951864360 3:27291300-27291322 TATAGGCAACTATGCAATTTTGG - Exonic
952993454 3:38854233-38854255 AGTACTCAACTCTGCCATTGTGG - Intronic
953141874 3:40236774-40236796 CAGAGTCAACTGTGCTTTTGAGG + Intronic
954839094 3:53495423-53495445 CAGAGTTAATTCTGCATTTGTGG + Intronic
955152874 3:56385901-56385923 CATACTCTACTCTGCAATTCAGG - Intronic
956449352 3:69358067-69358089 CATAGTCAACTCTGCAATTGAGG + Intronic
959194582 3:103163676-103163698 TTTACTCAACTCTGCAGTTGGGG - Intergenic
959536109 3:107486788-107486810 CCTTCTCAACTCTGCCATTGTGG - Intergenic
960101156 3:113745531-113745553 CAGACTCAACTCTGGAACTGCGG - Intronic
960443811 3:117722524-117722546 CATCCCCATCTCTGCAATTGAGG - Intergenic
961466927 3:127087724-127087746 CATCGTCCCCTCTGCAACTGAGG - Intergenic
962399274 3:135043374-135043396 CTTAATCAACGCTGGAATTGGGG + Intronic
962444211 3:135450405-135450427 CAGAATGATCTCTGCAATTGGGG - Intergenic
966337489 3:178885490-178885512 AATAATGAACTCTGAAATTGAGG + Intergenic
969243884 4:5919816-5919838 CAGAATCAACTCTGAAATAGGGG + Intronic
970220923 4:13809980-13810002 CATAGACAAGTTTGCAATTTAGG + Intergenic
971728993 4:30351888-30351910 CTTAGTCAACTGTGTAATTGGGG + Intergenic
975089066 4:70378995-70379017 CAAAGTCAATTCTGGAACTGAGG + Intronic
976273529 4:83253064-83253086 CATTATCTACTCTGCAATAGTGG - Intergenic
977245636 4:94627651-94627673 AATATTCAACTCTGCCATTGTGG - Intronic
977717949 4:100204468-100204490 CATATTCAACACTGTACTTGAGG - Intergenic
977781920 4:100991033-100991055 CATAGCCAAACCTGCAAATGTGG - Intergenic
978346275 4:107773489-107773511 TATAGTCAAGACTGCAATTTTGG - Intergenic
979897915 4:126183908-126183930 CATAGTCATGTTTGCAATTTAGG + Intergenic
980737835 4:136914071-136914093 ACTATTCAACTCTGCCATTGTGG - Intergenic
981598594 4:146457045-146457067 AATTCTCAACTCTGCTATTGTGG + Intronic
984734314 4:183097159-183097181 CATAGCCAACACTTGAATTGCGG - Intergenic
985828854 5:2213259-2213281 CATAGGCAGCTCTGCAGTTGGGG + Intergenic
986498267 5:8369928-8369950 AATAGATAAATCTGCAATTGTGG + Intergenic
987115636 5:14724635-14724657 CATGGCCCACTCTGCAAGTGAGG - Intronic
991227189 5:64286563-64286585 AAGAGTCAACTCAGCAATTCAGG - Intronic
993150552 5:84156147-84156169 CCTAGTAAACTCTGAAATTTTGG + Intronic
994864192 5:105244205-105244227 CCTTGGCAACTCTGCAACTGTGG + Intergenic
996679159 5:126211704-126211726 CATACTCAACTCTGCTATTGTGG + Intergenic
998516604 5:142761076-142761098 CCTACTCAACTCTGCTGTTGAGG - Intergenic
999436340 5:151566400-151566422 GGTTGTCAGCTCTGCAATTGTGG + Exonic
999713593 5:154340764-154340786 CATAATTAACTCTGGAGTTGTGG - Intronic
1000156493 5:158557431-158557453 ACTACTCAACTCTGCCATTGTGG - Intergenic
1000392571 5:160740439-160740461 AATTGTCAACTCTCCAAATGTGG + Intronic
1004116227 6:12770687-12770709 CAAAGACATCTCTGCCATTGAGG + Intronic
1004844905 6:19630174-19630196 AAGAGTTAACTCTGCAATTTTGG + Intergenic
1006595494 6:35190288-35190310 GATAGTCAACTCTACAATGCAGG + Intergenic
1008206211 6:48661325-48661347 TGTACTCAACTCTGCCATTGAGG + Intergenic
1011829936 6:91359356-91359378 CAGCTTCAACTCTGCAAATGAGG + Intergenic
1014727460 6:124989481-124989503 CATAGTGAACTGAGCAATGGTGG + Intronic
1016271929 6:142300484-142300506 CTTAGTCACCACTCCAATTGTGG + Intergenic
1021889507 7:25173440-25173462 ACTATTCAACTCTGCCATTGTGG - Intronic
1027633348 7:80636795-80636817 CTGAGTCAAATCTGCAACTGTGG - Intronic
1027762960 7:82302757-82302779 CATAGTCATTTCTGAAATTCAGG - Intronic
1028111961 7:86951210-86951232 GCTATTCAACTCTGCCATTGTGG - Intronic
1030376576 7:108759472-108759494 AATAATGAACTCTGAAATTGAGG + Intergenic
1031222886 7:118994397-118994419 CATATTCAACTGTGCAACTATGG + Intergenic
1031275178 7:119712394-119712416 CTTAGGCAGCTCTGCACTTGTGG + Intergenic
1032574561 7:133039601-133039623 CATAGTCAAGACTTCAAGTGCGG - Intronic
1035931478 8:3785061-3785083 CAAAGTCCACTATGCTATTGAGG - Intronic
1036505805 8:9354673-9354695 AATACCCAACTCTGCCATTGAGG - Intergenic
1036800639 8:11788523-11788545 CATCGTCTATTCTGGAATTGAGG - Intergenic
1037209796 8:16372859-16372881 TATAATCACCTTTGCAATTGTGG - Intronic
1037811702 8:22090240-22090262 GATACTCAACTCATCAATTGGGG - Intronic
1038253995 8:25933684-25933706 CATAGTCAATTATCCATTTGGGG - Intronic
1041575794 8:59393442-59393464 TAAAGTCAATTCTGCAATTAAGG - Intergenic
1043882315 8:85558631-85558653 ACTATTCAACTCTGCCATTGTGG - Intergenic
1046966727 8:120175667-120175689 AATACTCAACTCTGATATTGTGG - Intronic
1050289553 9:4139766-4139788 CATAGTGAACTGTGCAAGTGAGG - Intronic
1051583619 9:18704223-18704245 GCTACTCAACTCTGCCATTGTGG - Intronic
1052704908 9:31982809-31982831 CTTGGTCAAATCTGCAAATGTGG - Intergenic
1059623862 9:116039798-116039820 CTTAGTCTACTATGCAATTCTGG + Intergenic
1060418688 9:123451864-123451886 CTGAGTCATCTCTGCAATAGAGG + Intronic
1186623273 X:11264006-11264028 ACAACTCAACTCTGCAATTGTGG - Intronic
1186833397 X:13413456-13413478 ACTATTCAACTCTGCCATTGTGG + Intergenic
1189115169 X:38334930-38334952 CATAGTGAACTGTGCATGTGAGG + Intronic
1189524419 X:41804406-41804428 CATATTGAGCTCTGAAATTGGGG + Intronic
1189994037 X:46621909-46621931 GAGAGGCAACTCTGCAAGTGAGG + Intronic
1190171255 X:48114063-48114085 CAGAGTTGAATCTGCAATTGTGG - Intergenic
1192349312 X:70343397-70343419 CATAGAGAACTTTGCAACTGAGG - Intronic
1196488559 X:116243125-116243147 CATTGTGAACTGTGCAAGTGAGG - Intergenic
1196499312 X:116360737-116360759 CTTATTCAAATCTGAAATTGAGG + Intergenic
1196524063 X:116710420-116710442 AATAATGAACTCTGAAATTGAGG - Intergenic
1196670817 X:118365911-118365933 AATAGTCAACTCTGCAAAGCAGG - Intronic
1197520196 X:127488181-127488203 AATAGTCAACACCGTAATTGTGG - Intergenic
1197727537 X:129786276-129786298 CAAAGCCAAGTCAGCAATTGGGG - Intronic