ID: 956450499

View in Genome Browser
Species Human (GRCh38)
Location 3:69370305-69370327
Sequence CTGCACCCGGCCCTGTGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 0, 2: 4, 3: 17, 4: 203}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956450499_956450504 3 Left 956450499 3:69370305-69370327 CCCAACCACAGGGCCGGGTGCAG 0: 1
1: 0
2: 4
3: 17
4: 203
Right 956450504 3:69370331-69370353 ATAGCGATCGCTTGACACTCAGG 0: 1
1: 0
2: 0
3: 0
4: 12
956450499_956450505 4 Left 956450499 3:69370305-69370327 CCCAACCACAGGGCCGGGTGCAG 0: 1
1: 0
2: 4
3: 17
4: 203
Right 956450505 3:69370332-69370354 TAGCGATCGCTTGACACTCAGGG 0: 1
1: 0
2: 0
3: 1
4: 18

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956450499 Original CRISPR CTGCACCCGGCCCTGTGGTT GGG (reversed) Intronic
900417042 1:2540123-2540145 CTCCACCAGGACCTGTGGCTGGG + Intergenic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901163556 1:7198778-7198800 CTGACCCTGGCCCTCTGGTTTGG + Intronic
902137920 1:14326675-14326697 CTGCATCCTTCCCTGTGCTTGGG + Intergenic
903919330 1:26788193-26788215 CTGCTTCCGGCCCTGTGGCCTGG + Exonic
904043884 1:27599172-27599194 CTGGCCCTGGCCCTGTGGTAGGG - Intronic
904328060 1:29740196-29740218 CTGCCCCTGGCCCTGGGGCTGGG + Intergenic
904442478 1:30540711-30540733 CTGCACCTGGGCCTGGGGTGTGG - Intergenic
904561217 1:31398509-31398531 CTGCTCCTGGCCCTTTTGTTTGG - Intergenic
904822361 1:33254409-33254431 CTGCACCCGGCCGTGTCTTTAGG + Intergenic
905142901 1:35862725-35862747 CTGCATCCGGCCTTTTTGTTTGG - Intergenic
905335997 1:37244921-37244943 CTGCACCCAGCCCTGTGCCCTGG + Intergenic
907252007 1:53145927-53145949 CTTCACCGGGCCCTCTGCTTGGG + Intergenic
907523720 1:55041225-55041247 CTGCCCCAGGAGCTGTGGTTTGG - Intronic
908028526 1:59975461-59975483 CTTCACACGGCTCTGTGGTGTGG + Intergenic
910047276 1:82932857-82932879 CTTCACCCCTCACTGTGGTTTGG + Intergenic
911156448 1:94642079-94642101 CTGCATCTGCCCCTGTGGGTGGG + Intergenic
912414799 1:109500680-109500702 CTGCAGTCTGCCCTGTGATTTGG - Intronic
914712044 1:150223388-150223410 CCGCGCCCGGCCCTTTAGTTAGG - Intronic
914899435 1:151704023-151704045 CTGCCCCCGGCCCTGACCTTGGG + Intronic
916117061 1:161494572-161494594 CTACATCTGGCCTTGTGGTTAGG - Intergenic
917929540 1:179813934-179813956 CTGCAGCCAGCCCTGTGGGGTGG + Exonic
918851871 1:189702140-189702162 CTGCACCCGACTCTGAGGATGGG + Intergenic
919764336 1:201116422-201116444 CTGCCCCAGTCCCTGTGGTCTGG + Intronic
919837912 1:201589136-201589158 CTGCACCCGGCCCAAAAGTTTGG + Intergenic
919972908 1:202592235-202592257 CTGCACCGGGCCCTGAGGTTTGG + Exonic
920717101 1:208350269-208350291 TTGCACCCTGCCCTGTGGCTTGG + Intergenic
922507809 1:226136584-226136606 CTGCACCCGGCCCTCTTTCTGGG - Intergenic
922618544 1:226977368-226977390 CTGCCCCAGGCCTTGTGGGTGGG + Intronic
923671309 1:236043506-236043528 CCGCGCCCGGCCCTGGAGTTGGG - Intronic
924091804 1:240509243-240509265 CTGCACCGGGCCCAGTGGACAGG + Intronic
924614593 1:245602222-245602244 CTGCACCAGCCCCTATAGTTTGG + Intronic
1062949527 10:1487504-1487526 CTGCTCCCGGCCCTGGGTTGTGG + Intronic
1069883745 10:71610396-71610418 CTGCACCTGGCCCTGTGCTATGG - Intronic
1071717637 10:88113433-88113455 CTCCCCTGGGCCCTGTGGTTGGG + Intergenic
1074379423 10:112966743-112966765 CTGCACCGTGCCAGGTGGTTTGG - Intronic
1074584497 10:114754140-114754162 CTGCGCCCAGCCCTCTGGTCAGG + Intergenic
1078670635 11:13361978-13362000 CTGCACCCTGCCCTGCAGCTAGG - Intronic
1081436598 11:43033999-43034021 CAGCCCCCTGCCCTGTGGTGTGG - Intergenic
1081581134 11:44352923-44352945 TTGAACCCGGCACTGAGGTTAGG + Intergenic
1081904044 11:46655107-46655129 CTGCGCCCGGACCTGTTTTTTGG - Intronic
1083663238 11:64261783-64261805 CTGCACCCTGGCCTGGGGCTTGG + Intronic
1083710652 11:64546366-64546388 CTGCCCCTGGGCCTGGGGTTGGG - Intergenic
1083753763 11:64778270-64778292 CTGCACCCGGGCCTGGGGCGGGG - Exonic
1084442111 11:69180482-69180504 CTGCTCCAGAGCCTGTGGTTGGG - Intergenic
1088775944 11:113083139-113083161 CTGCTCCTGGCCATGTGGTGGGG + Intronic
1091412201 12:250853-250875 CTGCGCCAGGCCCTGTTTTTAGG - Intronic
1091782118 12:3220551-3220573 CTGCACCCGGGCCATTGGCTGGG + Intronic
1094433403 12:30395387-30395409 CTGCATCTGGCCTTGTGGTTGGG - Intergenic
1097176819 12:57147972-57147994 CTGCCGCTGGCCCAGTGGTTTGG + Intronic
1098508572 12:71284321-71284343 CTGCACCCTGCTCTGTGCCTTGG + Intronic
1101878332 12:108609864-108609886 CAGCCCCCGCCCCTGTGGTTTGG - Intergenic
1102085648 12:110137055-110137077 CTGCACCCGGCCATCTGGTTAGG - Intronic
1102087059 12:110150365-110150387 CCGCACCCGGCCATGTTTTTAGG + Intronic
1102474655 12:113180821-113180843 CTGGGCCCAGCACTGTGGTTGGG - Intronic
1103599192 12:122043479-122043501 CTGCACCCGGCCGTGTGGTAGGG - Intronic
1103845537 12:123899511-123899533 TTGCACCCGGCCCTGTGCACAGG + Intronic
1104635727 12:130436989-130437011 GTGCACCTGGCCCTGTGCATGGG - Exonic
1104840070 12:131819551-131819573 CTGCACCCGGCCCTGAACTTAGG - Intergenic
1105883105 13:24620830-24620852 CTGCACAAGGCACTGTGGTGCGG - Intergenic
1107857940 13:44633920-44633942 CCGCGCCCGGCCCTGTTTTTTGG - Intergenic
1109590933 13:64480650-64480672 CTGAACCCAGCCCTGAGGGTGGG + Intergenic
1112755785 13:102631956-102631978 CTGCACCCGGCCCAGACATTTGG - Intronic
1114215961 14:20657991-20658013 CTGCACCAGACTCTGAGGTTGGG - Intergenic
1114220689 14:20693683-20693705 GTCATCCCGGCCCTGTGGTTTGG - Exonic
1118312750 14:64705295-64705317 CTACACCCAGCCCTTTGGTTTGG + Intronic
1118913292 14:70079848-70079870 TTGCACCTGTCCCTGTGGTATGG + Intronic
1119262238 14:73244700-73244722 CTGCAGCCGGACCTGTGGAGGGG + Exonic
1119726594 14:76925138-76925160 CGGCACCCGGAACTGGGGTTGGG + Intergenic
1120985454 14:90330961-90330983 CTGCATCCTGCCCTGGGGTGGGG - Intronic
1121976820 14:98412428-98412450 CTGCACCAAGCCCTGTGGACTGG + Intergenic
1122769357 14:104091153-104091175 CTGCGCCCGGCCCTGGGATGCGG + Intronic
1122812920 14:104297865-104297887 CTTCACCCAGCCCTGTGGGGTGG - Intergenic
1126503096 15:49369245-49369267 CTGCACCCGGCCTGGTGTTTTGG + Intronic
1128528713 15:68430286-68430308 GTGCACCCAGCCCTGTGTTAAGG + Intronic
1128687360 15:69696698-69696720 CTGCATCAGGCACTGTGTTTGGG + Intergenic
1128709304 15:69859916-69859938 CTACACCAGGCCTTGTGGTAGGG - Intergenic
1132930081 16:2454562-2454584 CTCCACCAGGCCCTGGGGTCAGG + Intronic
1132945332 16:2529029-2529051 CTGCACCCCGCCCAGTTGCTGGG + Exonic
1133157497 16:3885359-3885381 CTGCACCCGCCCCTCTCGTGGGG + Intergenic
1134059172 16:11188639-11188661 CTGCACCTGACCCAGGGGTTCGG - Intergenic
1134557356 16:15177014-15177036 CCGTACCCAGCCCTGTGGATGGG - Intergenic
1134751031 16:16625346-16625368 TTGAACCAGTCCCTGTGGTTGGG + Intergenic
1134917928 16:18088723-18088745 CCGTACCCAGCCCTGTGGATGGG - Intergenic
1134994425 16:18728245-18728267 TTGAACCAGTCCCTGTGGTTGGG - Intergenic
1136720165 16:32313708-32313730 CTGCACCCAGCCTTCTAGTTTGG + Intergenic
1136838542 16:33519984-33520006 CTGCACCCAGCCTTCTAGTTTGG + Intergenic
1136843545 16:33558158-33558180 CTGCACCCAGCCTTCTAGTTTGG + Intergenic
1137410604 16:48224730-48224752 CTGCGCCTGGCCCTGTGCTATGG - Intronic
1138582691 16:57951963-57951985 CTGCAAACGCCCCTGGGGTTTGG + Intronic
1139391418 16:66608225-66608247 CTGAGCCAGGCCCTGTGGTCAGG - Intronic
1139526295 16:67518766-67518788 CTGCACCCGGTCTTGGGGTGTGG + Intronic
1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG + Intronic
1142059742 16:88021463-88021485 CTCCACACGGCCCTGTGGACAGG - Intronic
1142121978 16:88390975-88390997 ATTCACCCGGGCCTGTGGTGTGG - Intergenic
1142194109 16:88731705-88731727 ATGCCCCCGGCCCTGTGCATTGG - Exonic
1203006266 16_KI270728v1_random:204061-204083 CTGCACCCAGCCTTCTAGTTTGG - Intergenic
1203148705 16_KI270728v1_random:1820270-1820292 CTGCACCCAGCCTTCTAGTTTGG + Intergenic
1203153710 16_KI270728v1_random:1858456-1858478 CTGCACCCAGCCTTCTAGTTTGG + Intergenic
1143363175 17:6387852-6387874 GTGTATCTGGCCCTGTGGTTGGG - Intergenic
1144707068 17:17376630-17376652 CTGCACCAGGCTCTGTGCTAGGG - Intergenic
1147374000 17:40013436-40013458 CTGCACCTGGCCTTGAGGGTGGG - Intergenic
1147772858 17:42879634-42879656 CTCCACCTTGCCCTGTGGTCTGG + Intergenic
1151272403 17:73007130-73007152 CTGCGCCCGGCCCTGTGTCTTGG - Intronic
1152695526 17:81741940-81741962 CTGCACCCGGCACCGTCGCTGGG + Intergenic
1152816826 17:82412703-82412725 AGGGACCCGCCCCTGTGGTTTGG + Intronic
1152974354 18:199598-199620 CAGCACTCAGCCCTGTGCTTGGG - Intronic
1153010589 18:535391-535413 CTGCACCCAGCCCTGTAACTAGG - Intergenic
1154137864 18:11796285-11796307 CTGCGCCCGGCCCAGTGGAAAGG - Intronic
1155167393 18:23242315-23242337 TTGCAGCTGGCCCGGTGGTTTGG + Intronic
1156807816 18:41208188-41208210 CTGATCCGGGCACTGTGGTTAGG + Intergenic
1159994632 18:74952331-74952353 CAGCACCAGGGGCTGTGGTTGGG - Intronic
1160151223 18:76395814-76395836 CTGCAGCCGGCCGTGAGGGTGGG + Intronic
1160849505 19:1183612-1183634 CTGCCCCCGGCCCTTTGCTCTGG - Intronic
1161843985 19:6701123-6701145 CTACACATGGCCTTGTGGTTGGG + Intronic
1162053796 19:8050886-8050908 ACTCACCCGGCCATGTGGTTTGG + Intronic
1162159715 19:8702702-8702724 CTGCCCCCGGCCCTATGGCATGG + Intergenic
1162921957 19:13908434-13908456 CTGCACCTGGCCCTGTCGTCAGG + Intronic
1163366570 19:16878952-16878974 GTCCACCCGCCCCTGTGGTGGGG - Exonic
1163482434 19:17565455-17565477 CTGCACCCGGCCTGGCTGTTGGG + Intronic
1163927051 19:20355967-20355989 CCGCACCCGGCCCAGTTGTTTGG - Intergenic
1166091604 19:40512932-40512954 CTGCAGCAGGCCCTGCGGTGTGG + Exonic
1166736175 19:45086391-45086413 CTGCACCACTCCCTGTGGCTTGG - Intronic
925356054 2:3242168-3242190 CTGCTGCCGGGCCTGTGGTGTGG - Intronic
926070850 2:9889091-9889113 CTGCACCCAGCCTTCTGCTTGGG + Intronic
927388235 2:22561496-22561518 CTGCACCAGGCACTGTGGTACGG + Intergenic
927698325 2:25252189-25252211 CTGCACCTGGCCTTATGGGTAGG - Intronic
928127239 2:28625299-28625321 CCGCAGCCGGCCCTGGGGTGAGG - Intronic
929606926 2:43240917-43240939 CTGCACCCGGCCCTGGCACTTGG - Intronic
934552328 2:95270052-95270074 CTGCACCCGGCCAGGGGTTTTGG + Intergenic
935064438 2:99635855-99635877 CTGCCCCAGGCCCTGTGCTGGGG - Intronic
936511474 2:113150876-113150898 CTGCACCCGCCCTTGATGTTTGG + Intergenic
936719104 2:115228235-115228257 CTGCACCCGGCCCTATACATGGG + Intronic
937905596 2:127051327-127051349 ATGCCCCCGGCCCTGTCGCTTGG - Intronic
938419494 2:131132975-131132997 CTGCACCGGCCCCTGAGGTAGGG + Exonic
938759563 2:134411819-134411841 CAACACCTGGCCTTGTGGTTGGG + Intronic
940789462 2:158016627-158016649 CTGCACCCAGCCCTGGGTCTAGG + Intronic
944487635 2:200223611-200223633 TGGCACCAGGTCCTGTGGTTTGG - Intergenic
945241227 2:207678861-207678883 CTGCACCAGGCCTTGAGGTCAGG + Intergenic
946397894 2:219452495-219452517 CTGACCCCGGGCCTGGGGTTCGG + Intronic
948856878 2:240734360-240734382 CCACACCCTGCCCTGTGGATGGG - Intronic
1172152597 20:32800969-32800991 CTGCACCTGGGCCAGTGGTCAGG - Intronic
1172809135 20:37634468-37634490 GTGCACACAGCCCTGTGCTTGGG + Intergenic
1173797026 20:45868671-45868693 CTGCACCTGGCCTAGTGTTTGGG + Intronic
1175723577 20:61302199-61302221 CGGAAACCGGCCCTGTGGTGAGG - Intronic
1175923689 20:62461859-62461881 TTGCACCCAGCACTGTGGTCTGG + Intergenic
1179707617 21:43191323-43191345 GTGCACCCTGCCCTGGGGTCTGG - Intergenic
1180710848 22:17838426-17838448 CTGCCCCTGGCCCTGTGGTGAGG + Intronic
1183212119 22:36457653-36457675 CTGCACCAGGCCCTGGGCCTGGG + Intergenic
1183503549 22:38195805-38195827 CTGCGCCCGGCCCAATTGTTTGG + Intronic
1184111594 22:42398701-42398723 CTGCACCCGGCCATGGGTCTTGG + Intronic
1184236969 22:43187593-43187615 CTGCGACCGCGCCTGTGGTTTGG + Intergenic
1184787539 22:46679090-46679112 CTGCAGCCGCCCCTGGGGGTGGG - Exonic
1184806804 22:46800145-46800167 CTGCACCAGCCCCTGCGGTTGGG + Intronic
1185372403 22:50467050-50467072 CTGCTCCCTGCCCTGTGCCTGGG - Intronic
1185375940 22:50482614-50482636 CCGCACCCCGACCTGTGGTCTGG + Exonic
949438166 3:4051293-4051315 CTGCACCAGGCCCTATGCTCAGG - Intronic
951091404 3:18577629-18577651 CTTCAGCCTGCCCTGTGGTTGGG - Intergenic
951819761 3:26795065-26795087 CTGATCCTTGCCCTGTGGTTGGG + Intergenic
952389318 3:32866224-32866246 CTGCACCAGGCCTTTTTGTTTGG + Intronic
952736220 3:36694028-36694050 CTGCTTCTGGCCTTGTGGTTGGG - Intergenic
953435520 3:42874511-42874533 CTACACCATGCCCTGGGGTTCGG - Exonic
953748689 3:45594012-45594034 CTGCACCCGGCAGCGTGGCTGGG - Intronic
954210355 3:49093736-49093758 GCGCACCCCGCCCTGTGGATGGG - Intronic
956374354 3:68598326-68598348 CTGCACCAGTCACTGTGGCTAGG - Intergenic
956450499 3:69370305-69370327 CTGCACCCGGCCCTGTGGTTGGG - Intronic
961318670 3:126057522-126057544 CTGAACCCAGCACTGTGGTCGGG + Intronic
961636937 3:128339208-128339230 CTGCCCCCTGACCTCTGGTTAGG + Intronic
966486067 3:180471381-180471403 CTGCACCTGTCCTTGTGGTGAGG - Intergenic
967963297 3:194941979-194942001 CTCCACCCGCCCCTGGGCTTTGG + Intergenic
968328709 3:197844911-197844933 CTGCACCCGGCCCTGCTGATAGG + Intronic
968483053 4:845308-845330 CTCCACCCAGGCCTGTGGGTGGG + Intergenic
968912622 4:3483855-3483877 CTGCACCAGGCCCTGGGGGCAGG - Intronic
969045470 4:4333460-4333482 CTGGCCCCAGTCCTGTGGTTTGG - Intergenic
972648495 4:40992827-40992849 CTCCATCCGGCCCTGTGGTTTGG - Intronic
974775613 4:66476680-66476702 CTGCACCAGGATCTCTGGTTAGG - Intergenic
975715994 4:77206311-77206333 CTGCATCTCGGCCTGTGGTTAGG + Intronic
983815609 4:172122709-172122731 CTGCACTTGGCCTTGTGGCTGGG - Intronic
985542425 5:493040-493062 CTCTGCCCGGCCCTGTGGGTGGG + Intronic
985585862 5:733703-733725 CTGCACACGGCCCTGTCCTCAGG + Intronic
985666525 5:1184059-1184081 GTGCACACGGCCCTGGGGTGGGG + Intergenic
985835292 5:2266999-2267021 CTTCCGCCTGCCCTGTGGTTGGG - Intergenic
992420328 5:76597428-76597450 CTGCAGCCTGCCCTGAGGATGGG - Exonic
992642235 5:78778153-78778175 CTACACCCAGCCCTGGGATTCGG + Exonic
992828052 5:80569375-80569397 CTGCACCCGGCTCTCTGCTAAGG + Intronic
995859105 5:116623185-116623207 CTGCCCCCTCCCCTGTAGTTTGG + Intergenic
999430533 5:151521692-151521714 CTGCAGCAGGCCATGTGGATGGG - Exonic
1006931225 6:37689749-37689771 CTGCAAACGGCTCTGAGGTTTGG - Intronic
1007421671 6:41723537-41723559 CTGAGCCCGGCCCTGGGGCTGGG - Intronic
1007428181 6:41760526-41760548 CTGCTCCTGTCCCTGTGATTTGG - Intergenic
1008130038 6:47710769-47710791 CTGCAGCCAGCCCTGTGCTAAGG + Exonic
1008932610 6:56955418-56955440 CTGCGCCCCGCCCCGAGGTTGGG + Exonic
1010173186 6:72996560-72996582 TTGCTCCAGGCCCTGTGGTGTGG + Intronic
1011202866 6:84856572-84856594 CTGGACCCTGTCCTCTGGTTAGG + Intergenic
1011264721 6:85503508-85503530 ATACACCGGGGCCTGTGGTTGGG + Intergenic
1015938232 6:138424147-138424169 AGGCCCCCGGCCCTGTGGATGGG - Exonic
1019957027 7:4423776-4423798 CTACTTCCGGCCTTGTGGTTGGG - Intergenic
1027628650 7:80575324-80575346 CTGCATCCTGCCCTTTGGGTAGG - Intronic
1029022981 7:97385055-97385077 CTGCACCCGGCCCTAGGTTGAGG - Intergenic
1029183016 7:98718244-98718266 CTGCACCCGGGCTGGTGTTTTGG + Intergenic
1032172144 7:129593775-129593797 CTGCACCCGGCCCTGAAATGTGG - Intergenic
1032794030 7:135263362-135263384 GTGCACCTGGCTCTGTGGTGTGG - Intergenic
1035300725 7:157895848-157895870 CTGCACACGACCCAGTGGTGCGG + Intronic
1035302173 7:157904674-157904696 CTTCACGCGGCCCTGTGTTCCGG + Intronic
1035729071 8:1842093-1842115 CAGCACCTGGCCTCGTGGTTCGG - Intronic
1037316900 8:17607971-17607993 CTGCAGCCGGCTGTGTGGGTGGG - Intronic
1042566488 8:70117178-70117200 CTGCAACCAGCCCTGTGGTGCGG - Intronic
1045389738 8:101703659-101703681 CTGCTCCTGGCACTGTGGCTTGG - Intronic
1049069558 8:140345979-140346001 CTGGACACAGCCCTGGGGTTGGG + Intronic
1049546559 8:143234440-143234462 CTCCCCCCAGCACTGTGGTTCGG + Intergenic
1050887033 9:10779033-10779055 CAGTACCCGGCCATGTGGTGTGG - Intergenic
1051526508 9:18051009-18051031 CTGCACCCGGCCATATAGTCTGG - Intergenic
1056680446 9:88713239-88713261 TTGTACCCTGCCCAGTGGTTTGG + Intergenic
1056800411 9:89686942-89686964 CTGTACCCTGCCCTGTGCTATGG + Intergenic
1062040353 9:134401700-134401722 CTGCACCCGTCCCTGGGGCCTGG + Exonic
1062627355 9:137449330-137449352 CTGCACCGGGACCTGGGGCTGGG - Exonic
1185499682 X:587332-587354 CTGCACCCGGCCAGGCTGTTTGG - Intergenic
1187057751 X:15757083-15757105 CTGCACCCGGCCATCTACTTTGG - Intronic
1189324771 X:40105724-40105746 CTGCTCCTGGCCCTGAGCTTCGG - Intronic
1192511370 X:71722366-71722388 CGACACCCGTCCCTGTGTTTGGG - Intergenic
1192515327 X:71759139-71759161 CGACACCCGTCCCTGTGTTTGGG + Intergenic
1194223314 X:91223834-91223856 CTGCACCCAGCCCTTCGTTTTGG - Intergenic
1198111843 X:133509078-133509100 TTTGCCCCGGCCCTGTGGTTAGG - Intergenic
1199618892 X:149681562-149681584 CTACAGCTGGCCTTGTGGTTAGG - Intergenic
1201188163 Y:11423562-11423584 CTGCACCCAGCCTTCTAGTTTGG - Intergenic