ID: 956452176

View in Genome Browser
Species Human (GRCh38)
Location 3:69385890-69385912
Sequence CACGCTGCGGAGATGGTACA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956452176_956452181 4 Left 956452176 3:69385890-69385912 CCGTGTACCATCTCCGCAGCGTG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 956452181 3:69385917-69385939 CGGTCAAGTTCCATACGAAGCGG 0: 1
1: 0
2: 0
3: 1
4: 17
956452176_956452183 22 Left 956452176 3:69385890-69385912 CCGTGTACCATCTCCGCAGCGTG 0: 1
1: 0
2: 0
3: 2
4: 49
Right 956452183 3:69385935-69385957 AGCGGCTGCCGCTGAACAGCAGG 0: 1
1: 0
2: 1
3: 10
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956452176 Original CRISPR CACGCTGCGGAGATGGTACA CGG (reversed) Exonic
904180689 1:28664624-28664646 CACGCTGAGGAGCTGGGACCTGG + Intergenic
917186192 1:172358878-172358900 CACACTGTGGAAATGGTGCAAGG + Intronic
917584287 1:176410118-176410140 CTGGCTGTGGAGATGGTGCAAGG + Intergenic
921651907 1:217689850-217689872 CAGGCTTCTGTGATGGTACAGGG - Intronic
1063071901 10:2675240-2675262 CACGCTGCTGAGATTACACAGGG - Intergenic
1064137154 10:12761040-12761062 CATTCTGTGGAGATAGTACACGG - Exonic
1068842165 10:61627504-61627526 CACGTGGCAGAGATGGTAAAAGG + Intergenic
1070594859 10:77825504-77825526 GAAGCTGCAGAGATAGTACAGGG - Intronic
1071524897 10:86352882-86352904 CATGATGCTGAGATGCTACAGGG + Intronic
1081356316 11:42118635-42118657 CACTCTTTGGAGATGCTACAAGG + Intergenic
1082828577 11:57598532-57598554 CACGCTGCGCAGCTCCTACATGG - Intronic
1083243355 11:61406402-61406424 CATGTTGGGAAGATGGTACATGG - Intronic
1091568461 12:1663967-1663989 CAAGCTGCTGAGATGGACCATGG + Intergenic
1092870041 12:12798127-12798149 CATGCTGGGGAGATGGAACATGG - Intronic
1094503107 12:31037683-31037705 CAAGCTGCGGATATAGTCCACGG - Intergenic
1097223356 12:57462847-57462869 GACACTGCAGAGATTGTACACGG + Intronic
1122114678 14:99521826-99521848 CACGGTGGGGAGAGGGTACCCGG - Intronic
1122982738 14:105198940-105198962 CAGGCTTCGGAGAGGGTTCAGGG - Intergenic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1132945044 16:2527887-2527909 CACGATGCGGACATTGTCCAGGG - Exonic
1140789788 16:78380400-78380422 CACCCTGCGAAGATGCTATAGGG + Intronic
1159005437 18:63006114-63006136 CATCATGCAGAGATGGTACAAGG - Intergenic
1162894874 19:13759251-13759273 CATGCTGCGGAGAAGGTTCCGGG + Exonic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
931759564 2:65404808-65404830 CATGCTGGGGAGGTAGTACATGG - Intronic
932611516 2:73203262-73203284 CACGCTGCTGAGGTGGGAGAGGG + Intronic
934172536 2:89552866-89552888 CACGCTTGAGAGATGGTACCTGG + Intergenic
934282849 2:91627218-91627240 CACGCTTGAGAGATGGTACCTGG + Intergenic
946573189 2:221046505-221046527 CACTCTGCTGAAATGATACAAGG - Intergenic
1170994804 20:21342670-21342692 CATGCTGCCTACATGGTACATGG - Intronic
1172322378 20:34006076-34006098 CACGCTGCTGATATGATAGATGG + Intronic
1177207178 21:18023404-18023426 CACCCTGCAGAGATGGTAGCAGG + Intronic
951604602 3:24419221-24419243 CAAGCTGCAGAGATAGTACAGGG - Intronic
952304866 3:32136777-32136799 AAGGCTTAGGAGATGGTACAGGG - Intronic
956452176 3:69385890-69385912 CACGCTGCGGAGATGGTACACGG - Exonic
956525685 3:70157399-70157421 TACGCTGAGGAGAAGGTAAATGG + Intergenic
978603215 4:110450170-110450192 CTAGCGGCAGAGATGGTACAAGG + Intronic
982579246 4:157157147-157157169 CACGCTGAGGTGATGTCACAGGG - Intronic
994188504 5:96841479-96841501 CAAGCTGCTGAGATGGAGCAGGG + Intronic
998110194 5:139495497-139495519 CACTCTGCAGAGCTTGTACAGGG - Intergenic
1001677691 5:173532078-173532100 CATGCTTCGGAGATGGCACTTGG - Intergenic
1003114201 6:3272666-3272688 CCCTCTGGGGAGATGGGACACGG - Exonic
1010082212 6:71877060-71877082 CTCTCTGTGGAGATGGTAGATGG + Intergenic
1023095032 7:36651445-36651467 CCGGCTGTGGGGATGGTACATGG + Intronic
1025623169 7:63193029-63193051 CTAGCAGCAGAGATGGTACAAGG + Intergenic
1027042490 7:74970031-74970053 CACGCAGCGGAGACGGGACCTGG - Intronic
1027420408 7:78012839-78012861 CACACTGGGGAGATGGGTCAGGG - Intergenic
1035746223 8:1963576-1963598 CACCCTGTGTAGATGGCACATGG + Intergenic
1041212651 8:55568639-55568661 CACACTGCCGTGATGGTCCAGGG + Intergenic
1185643245 X:1599886-1599908 CACGCTGCGGAGGAGGGACCCGG - Intronic
1186196311 X:7113170-7113192 CTGGCTGGGGAAATGGTACAGGG + Intronic
1194811240 X:98389624-98389646 GACGCTGCTGAGATGGGAAAGGG + Intergenic