ID: 956453110

View in Genome Browser
Species Human (GRCh38)
Location 3:69393376-69393398
Sequence GTTGATTAACTAGTAAAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 203}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956453110_956453112 -9 Left 956453110 3:69393376-69393398 CCCATTTTTACTAGTTAATCAAC 0: 1
1: 0
2: 2
3: 22
4: 203
Right 956453112 3:69393390-69393412 TTAATCAACTGAGCAGACATTGG 0: 1
1: 0
2: 0
3: 12
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956453110 Original CRISPR GTTGATTAACTAGTAAAAAT GGG (reversed) Intronic
900892545 1:5459897-5459919 GTTTCTTCACCAGTAAAAATGGG + Intergenic
903411108 1:23143679-23143701 GTTGAGTTTCTAGTTAAAATTGG - Intronic
906492020 1:46276087-46276109 GTAGATTAAGTGGTAGAAATAGG - Intronic
910853041 1:91667243-91667265 GTTTAAAAACTAATAAAAATAGG - Intergenic
910872588 1:91848605-91848627 GTAGTTTAACTTATAAAAATAGG + Intronic
911520232 1:98920746-98920768 GATTATTAACTAGTAAAATGAGG + Intronic
911752393 1:101511051-101511073 GTTGATTTACTATTTAATATTGG + Intergenic
912663221 1:111553780-111553802 GTTGACTAAATAGGAAAAAAGGG - Intronic
912983461 1:114401577-114401599 GTTGAGTATCTAGTAAACAGGGG - Intronic
914874701 1:151504218-151504240 GTTTTTTAAATAGTAGAAATGGG - Intergenic
919158664 1:193801019-193801041 GTAGAAAAACTAGAAAAAATGGG - Intergenic
919311344 1:195913991-195914013 GTTTATTTACTTTTAAAAATAGG + Intergenic
920597099 1:207282969-207282991 GTTGAATATCTACTAAAACTTGG - Intergenic
922680861 1:227594179-227594201 GTTTAAAAACTAATAAAAATAGG - Intronic
924762766 1:247004541-247004563 GTTGAGTAACTGGTGAAAGTTGG - Intronic
924859156 1:247903113-247903135 GTTTAAAAACTAATAAAAATAGG - Intergenic
1063895265 10:10674254-10674276 GGACATTAACTAATAAAAATGGG - Intergenic
1065709697 10:28503811-28503833 TTTGATTAATTAGGAAATATTGG - Intergenic
1065930922 10:30478400-30478422 GTTTAAAAACTAATAAAAATAGG + Intergenic
1066024152 10:31336332-31336354 GTTAATTAAATGGAAAAAATTGG + Intronic
1066134289 10:32427631-32427653 GTTGAATAAACTGTAAAAATGGG + Intergenic
1068675879 10:59768806-59768828 GTTTAAAAACTAATAAAAATAGG - Intergenic
1069149853 10:64946639-64946661 GTAGATTAACAATTATAAATAGG + Intergenic
1070473000 10:76802304-76802326 ATAGATAAACAAGTAAAAATAGG - Intergenic
1071519983 10:86324195-86324217 TTTTATTAACTATTAAAATTTGG + Intronic
1071984019 10:91032693-91032715 CTTAAAGAACTAGTAAAAATAGG + Intergenic
1072689166 10:97559486-97559508 GTCTAAAAACTAGTAAAAATTGG - Intronic
1073885503 10:108035245-108035267 GATGATGATCTAGTAATAATGGG + Intergenic
1074127771 10:110543344-110543366 GTTGATTACTTAGAATAAATTGG - Intergenic
1076473715 10:130737922-130737944 GTTAATTAATTAGTAAACTTTGG - Intergenic
1079398136 11:20083755-20083777 GTTTCCTCACTAGTAAAAATAGG + Intronic
1079728921 11:23915960-23915982 GTCGAATAACTGGTAAAAGTAGG + Intergenic
1079949719 11:26785813-26785835 GTTTTTTAAAAAGTAAAAATTGG - Intergenic
1080101863 11:28468450-28468472 GTTGATAAACCAGTTAAATTAGG - Intergenic
1080108041 11:28532632-28532654 CATGTTTAAATAGTAAAAATGGG - Intergenic
1080336186 11:31199115-31199137 ATTGATTAAGTAATTAAAATTGG - Intronic
1080354220 11:31422993-31423015 GGTGATTAACTTGGGAAAATTGG - Intronic
1082649043 11:55764294-55764316 GTTGACTAAAGAGTAAAATTGGG + Intergenic
1085543259 11:77292608-77292630 GATAATTAAATAGAAAAAATAGG + Intronic
1086482223 11:87254568-87254590 GTTGAATAACTTTTAAAGATGGG - Intronic
1087222469 11:95561242-95561264 GTTTCTTAACCTGTAAAAATGGG - Intergenic
1088072295 11:105803664-105803686 GTTGCTTAACTAATTAAAAATGG - Intronic
1089205651 11:116760166-116760188 AGTGATTTACTAGTATAAATTGG - Intronic
1090917607 11:131179764-131179786 GTTTTTTCACTTGTAAAAATAGG + Intergenic
1091871856 12:3898542-3898564 GTTGTATAACTATTAAAACTGGG - Intergenic
1094347485 12:29486674-29486696 GAAGATGAACTAGAAAAAATAGG + Intronic
1095851655 12:46815379-46815401 GTTGAATAACGAGCAAAAAGTGG - Intronic
1096207634 12:49736733-49736755 GTTTAAAAACTAATAAAAATAGG + Intronic
1096467385 12:51854484-51854506 GTTTTTTAAATAGTAGAAATGGG - Intergenic
1100726138 12:97410840-97410862 GGTAATTAACCAGGAAAAATGGG - Intergenic
1101162179 12:101989595-101989617 GCTGAATAACTGGTAAAAGTGGG + Intronic
1104561039 12:129844787-129844809 CTTAATGAACTAGTAACAATAGG + Intronic
1106632063 13:31484869-31484891 GTTGACCAACTAGTAAAAATGGG + Intergenic
1106794945 13:33195803-33195825 GTTTATTAACTTGTACAAGTTGG - Intronic
1107285446 13:38785230-38785252 AATGAATAACTAGTAAACATAGG + Intronic
1108486141 13:50927789-50927811 GTTGAATAACTAAGAAAAGTTGG - Intronic
1108784054 13:53872928-53872950 GTTTATTCACTAGTAAAGCTAGG + Intergenic
1108871590 13:54993519-54993541 GTTGATTAGGTAGTCATAATGGG - Intergenic
1109015010 13:56998530-56998552 GCTGATAAAGTAGTATAAATAGG + Intergenic
1110077058 13:71259188-71259210 GTTCATTAAATAGTAAAGTTTGG - Intergenic
1110094775 13:71503572-71503594 GTTTATTATTTAGTAAATATTGG - Intronic
1111037654 13:82699759-82699781 TTTGATTAAATAGTAAAGGTGGG - Intergenic
1111351933 13:87042256-87042278 GTTGATTAATTACTTTAAATAGG + Intergenic
1112850858 13:103705055-103705077 GTACATTAACTATTAAGAATTGG - Intergenic
1114300735 14:21374939-21374961 GTTGGTTAACGTGGAAAAATTGG - Intronic
1114518271 14:23315836-23315858 GAGAATTAAGTAGTAAAAATGGG - Intronic
1116547999 14:46195638-46195660 GATAATTAACTATTAACAATGGG + Intergenic
1116558768 14:46348780-46348802 GTTTATTCCCTAGTAAATATAGG + Intergenic
1117830200 14:59742486-59742508 GTATATTATGTAGTAAAAATAGG + Intronic
1119186681 14:72648014-72648036 GTTGAGTAAGTAGGAAAAAGGGG - Intronic
1120162814 14:81163587-81163609 GTTGATTTACTAATAAAATCAGG - Intergenic
1123916898 15:25040309-25040331 CTTCTTTAAATAGTAAAAATCGG - Intergenic
1125207490 15:37170831-37170853 TTTGAAGAACTAGTAAAATTTGG + Intergenic
1126403958 15:48303865-48303887 GTTGAAAAACTTGTAAAATTTGG + Exonic
1127544538 15:59979072-59979094 GATAATTAACAAGCAAAAATAGG + Intergenic
1127544816 15:59982069-59982091 GATGATTAACTAGTATACATGGG + Intergenic
1129557049 15:76521485-76521507 GTTTATTAACTAATGAAAATTGG - Intronic
1130085496 15:80775445-80775467 GTTGTTTTACTATTAAAAATAGG + Intergenic
1132774551 16:1585716-1585738 GTTGAATAACTGATAAAAATAGG + Intronic
1138757291 16:59503948-59503970 TTTGATTGACAAGTAAAAATTGG + Intergenic
1139085661 16:63582290-63582312 GTTTATTAAGTTGTTAAAATGGG + Intergenic
1140563484 16:76011484-76011506 CTTGATAAAGAAGTAAAAATAGG + Intergenic
1141961178 16:87410502-87410524 TTTGATAAACTTGTAAAATTAGG - Intronic
1144082456 17:11776541-11776563 TTTAATTAACTTGTTAAAATGGG - Intronic
1144469852 17:15528927-15528949 GATGATTAACTAGGAAAAAGAGG - Intronic
1146972685 17:37085518-37085540 TTTGCTTACCTAGTAAGAATTGG - Exonic
1147810387 17:43164982-43165004 GTTTAAAAACTAATAAAAATAGG - Intergenic
1150037378 17:61818453-61818475 GTTGATTAATTACAGAAAATAGG + Intronic
1150536370 17:66046391-66046413 TGTGTTTAACTACTAAAAATGGG + Intronic
1154014227 18:10602189-10602211 GTTTAAAAACTAATAAAAATAGG - Intergenic
1159311018 18:66709086-66709108 GTTGATTATTTAGGAAACATTGG + Intergenic
1160616665 18:80135943-80135965 GTTAATTAAGTAGTGAAAATGGG - Exonic
929413945 2:41728430-41728452 GTTGAAGAACTAATAAAAATTGG + Intergenic
929955038 2:46451425-46451447 GTTGCTTCACTGGTAAAACTAGG - Intronic
930363959 2:50415926-50415948 GTTGAATAACTACTAACAGTTGG - Intronic
932017423 2:68045631-68045653 GTTGATTTACTAGCAAAGACGGG - Intronic
932054982 2:68434039-68434061 GTTTATTAAATAGTTAATATAGG + Intergenic
932133267 2:69206411-69206433 GTGGTATAACTAGTAAAAGTGGG + Intronic
933946742 2:87293140-87293162 GTTGAATAACTAGGAACAACAGG + Intergenic
935970500 2:108526656-108526678 GTTTAAAAACTAATAAAAATAGG + Intergenic
936333448 2:111568396-111568418 GTTGAATAACTAGGAACAACAGG - Intergenic
936597138 2:113858862-113858884 GTTGAAAAATTAGTAGAAATGGG + Intergenic
936958978 2:118053560-118053582 GTTGATTAACTATGACAGATTGG + Intergenic
938713575 2:133997736-133997758 GTTGATTTTCTAGTAGAAAGGGG - Intergenic
939221065 2:139302056-139302078 GTTGATTAACTAGTACATTGAGG + Intergenic
939231828 2:139437022-139437044 TTTGCTTAACTAGTCAAAATGGG + Intergenic
940077630 2:149760875-149760897 GTTGAATAAGTGGTAAAAATGGG + Intergenic
942536622 2:176971358-176971380 TTTGATAAACTCATAAAAATGGG - Intergenic
943932398 2:193870125-193870147 GATGATTAGCTACTAAAAAAGGG - Intergenic
944334247 2:198510747-198510769 CTTGATTAGCTAGTGAAAAATGG + Intronic
948450831 2:238070192-238070214 GATCATTAACTTGTAAAAATGGG + Intronic
949047470 2:241878374-241878396 TTACATTCACTAGTAAAAATGGG + Intergenic
1168822941 20:788204-788226 GTTTAAAAACTAATAAAAATAGG - Intergenic
1170184225 20:13569806-13569828 AATAACTAACTAGTAAAAATTGG + Intronic
1172388373 20:34549420-34549442 GGTGATGAACTCGTAAAAATGGG - Intronic
1175637486 20:60598034-60598056 ATTGATCATCTAGTATAAATTGG - Intergenic
1177312013 21:19409966-19409988 GTTAATTAACTACGAGAAATGGG - Intergenic
1179670970 21:42947546-42947568 GTTTAAAAACTAATAAAAATAGG - Intergenic
1183804657 22:40197910-40197932 GTTGCTTAAAAAGAAAAAATGGG - Intronic
949091579 3:35273-35295 CTTGGTTAACTAATAATAATGGG + Intergenic
950846307 3:16019159-16019181 GTAGAGAAACTAATAAAAATAGG - Intergenic
951248638 3:20368781-20368803 GTTTAAAAACTAATAAAAATAGG - Intergenic
951926130 3:27910501-27910523 GTTGATTAACTACAAAAAGAAGG + Intergenic
952539221 3:34349591-34349613 GTTGCTTAACTAGTAAGATAAGG - Intergenic
955719660 3:61867529-61867551 ATTTATTAACTTGAAAAAATAGG + Intronic
955915242 3:63901126-63901148 CTTAATTAACAAGTAAAAATTGG + Intronic
956306149 3:67828683-67828705 GTTGATTAATTGGTAGAAATGGG - Intergenic
956430920 3:69185578-69185600 GTTCATCAACTAGTAAACATGGG - Intronic
956453110 3:69393376-69393398 GTTGATTAACTAGTAAAAATGGG - Intronic
957031893 3:75251496-75251518 CTTGGTTAACTAATAATAATGGG + Intergenic
957551014 3:81704700-81704722 GTGGAATAACTGGAAAAAATAGG - Intronic
960184291 3:114619436-114619458 GTTGATTGACAATTGAAAATGGG + Intronic
962096829 3:132300858-132300880 GTTTAAAAACTAATAAAAATAGG - Intergenic
962276988 3:134022800-134022822 GTTTAAAAACTAATAAAAATAGG + Intronic
962285597 3:134083697-134083719 GTTGATTCACTTGAAAAGATTGG + Intronic
963660123 3:148114731-148114753 TTTGAGGAACTAGTAAAAATAGG + Intergenic
965849568 3:173007624-173007646 ATAGATTAAATAATAAAAATAGG - Intronic
966718964 3:183042390-183042412 TTCAATTAACTAGTATAAATTGG + Intronic
968035656 3:195545265-195545287 GTTAATTAACTAACAAACATTGG + Intergenic
970649629 4:18161894-18161916 GTCAATTAACTACTTAAAATAGG + Intergenic
972784898 4:42317701-42317723 GTCTAAAAACTAGTAAAAATAGG + Intergenic
973579474 4:52327465-52327487 GTTGACTAGGTAGTAAAAGTTGG + Intergenic
975179611 4:71329850-71329872 GTTGAATAACTGGTGAAAGTGGG + Intronic
978177210 4:105746855-105746877 GATGTATAACTAATAAAAATTGG + Intronic
979282379 4:118881946-118881968 GTTGCGTAACTATTAAATATAGG + Intronic
979443918 4:120788002-120788024 GTTGACTAAAGAGTAAAAACAGG + Intronic
980520662 4:133929170-133929192 GTTCAGTAACTATTAGAAATGGG - Intergenic
980735332 4:136878528-136878550 TTTGATTTTCTATTAAAAATGGG - Intergenic
981214195 4:142144584-142144606 ATTCATTAACTAATAAAAACTGG + Intronic
983897890 4:173101429-173101451 GTTTAAAAACTAATAAAAATAGG + Intergenic
984149209 4:176105784-176105806 GTTCCTTAAGTTGTAAAAATAGG - Intronic
985360031 4:189164226-189164248 ATTAATAAACTACTAAAAATGGG - Intergenic
987930619 5:24395631-24395653 GTTTAAAAACTAATAAAAATAGG - Intergenic
988007153 5:25430585-25430607 GATGATGATGTAGTAAAAATTGG + Intergenic
989042661 5:37245431-37245453 TTGGTTTAACTAGGAAAAATAGG - Intronic
989801540 5:45547893-45547915 GTGTATTTACTAGTAAATATTGG - Intronic
991163852 5:63538698-63538720 GATGTTTAATTAGGAAAAATTGG + Intergenic
992666553 5:79015167-79015189 GTGGATTAACTAGGAAACACAGG - Intronic
993205826 5:84877117-84877139 GTTGAATAACTGGTGAAAGTGGG - Intergenic
994127243 5:96181911-96181933 GTTGATTAAAAAGTAATAAATGG - Intergenic
994793646 5:104265191-104265213 CTGTATTAACAAGTAAAAATAGG + Intergenic
996431041 5:123377286-123377308 GTTCACTAACTACTAAAAAGTGG - Intronic
997011723 5:129886110-129886132 ATTTATTCACCAGTAAAAATAGG - Intergenic
999560368 5:152794885-152794907 ATTGAATAACTGGTAAAAGTGGG - Intergenic
1000075394 5:157779889-157779911 GTTGATTAACTGTTCTAAATGGG - Intergenic
1005143018 6:22655780-22655802 GGTGATTAATTAGTAAAAATGGG + Intergenic
1008817467 6:55586140-55586162 GTTGCTTAACTAACTAAAATAGG + Intergenic
1009679926 6:66879407-66879429 GTAGATTATATATTAAAAATAGG + Intergenic
1009871732 6:69460980-69461002 GTTAATTAAATATTAGAAATGGG - Intergenic
1010875345 6:81097640-81097662 GTTCATTAAGTTGTAAAATTAGG + Intergenic
1012367669 6:98462046-98462068 ATTGAATAACTAGAATAAATTGG + Intergenic
1012845975 6:104389153-104389175 ATTGATAAACTAGAAGAAATGGG + Intergenic
1013547176 6:111169616-111169638 TTTGATTACCTAGTGAATATTGG + Intronic
1014474135 6:121852052-121852074 CTTAATAAACTAGCAAAAATTGG - Intergenic
1014937196 6:127398715-127398737 GTTGAATAAATAATAAAAAAAGG + Intergenic
1015221154 6:130804802-130804824 GTTCCTTAACTTGTAAAATTAGG + Intergenic
1015330119 6:131968005-131968027 GTTGATGAACGGGTAAAAGTTGG - Intergenic
1015359123 6:132316208-132316230 GTTAATTATCTACTAAAATTTGG + Intronic
1015665895 6:135628369-135628391 GTACATTAACTAGAAAAAATTGG + Intergenic
1015814967 6:137199830-137199852 GTTCCATAGCTAGTAAAAATTGG - Intronic
1016189422 6:141244674-141244696 GTTGAATAGCTAGTAACAGTTGG - Intergenic
1017294322 6:152776643-152776665 GGGGATTAACTACTAAAAAGGGG + Intergenic
1017578328 6:155831489-155831511 GTTGATTAATTTGTCAAAATGGG + Intergenic
1021328906 7:19310204-19310226 TTTGTTTAACTATTACAAATAGG + Intergenic
1022015810 7:26347367-26347389 GTTTTTTAACTTTTAAAAATTGG + Intronic
1024697729 7:51873515-51873537 TTTGATTCACTACTAAAAGTTGG + Intergenic
1024756771 7:52542371-52542393 GTTCATTAACTAGTAAATCCTGG - Intergenic
1027242023 7:76337040-76337062 GTTGATTACTTAGTAAACATAGG - Intronic
1027940903 7:84677797-84677819 GTTCTTTAACCAGTAAAAATTGG - Intergenic
1028254221 7:88572730-88572752 GTTGATCATCTTTTAAAAATAGG + Intergenic
1028914842 7:96246897-96246919 TTTAATTAACATGTAAAAATTGG - Intronic
1029034660 7:97506220-97506242 GTTGAGTTAATAGTGAAAATGGG - Intergenic
1029486023 7:100841799-100841821 GTTTAAAAACTAATAAAAATAGG + Intronic
1029821943 7:103155133-103155155 GTTTAAAAACTAATAAAAATAGG + Intergenic
1030151825 7:106414155-106414177 GATGATTAACTACTAATAAAGGG + Intergenic
1030463661 7:109873085-109873107 GTTTGTTAACTACTAAAAAGTGG + Intergenic
1030463736 7:109873757-109873779 GTTTGTTAACTACTAAAAAGTGG - Intergenic
1032354692 7:131199636-131199658 GAGGTATAACTAGTAAAAATGGG - Intronic
1032978908 7:137258690-137258712 CTTGAGTAACTAGTATACATAGG + Intronic
1034890282 7:154833352-154833374 GTTTGGTAACTGGTAAAAATGGG + Intronic
1037003024 8:13744340-13744362 GATGATAAACTAATAAAACTGGG - Intergenic
1038502199 8:28054544-28054566 AGTGATAAAATAGTAAAAATAGG + Intronic
1040993474 8:53376855-53376877 GTTTAAAAACTAATAAAAATAGG - Intergenic
1041227017 8:55710932-55710954 GTCGAAAAACTAATAAAAATAGG + Intronic
1042083595 8:65084732-65084754 GTTAATCAACTAGTAGAAAAAGG + Intergenic
1042352673 8:67793623-67793645 GTTAGTTAACTAAGAAAAATGGG + Intergenic
1042782904 8:72511285-72511307 GTTGATTAAGTTTTAAAATTTGG - Intergenic
1045908488 8:107377041-107377063 CTTCATTACCTACTAAAAATGGG - Intronic
1046152158 8:110241585-110241607 GTTGATGAACTAAGAAAAATAGG + Intergenic
1046384955 8:113497157-113497179 CTTGATTATCAAGGAAAAATTGG + Intergenic
1046409827 8:113827140-113827162 ATTGATTAATTATTAAATATTGG + Intergenic
1046674489 8:117093566-117093588 GTTGAGTGAATAATAAAAATAGG - Intronic
1048192527 8:132302778-132302800 GTGGATTTCCTAGTAAAATTAGG - Intronic
1048227999 8:132609033-132609055 GTAGATAAACCAGTCAAAATTGG - Intronic
1055357478 9:75452210-75452232 TTTTATTAATTAGTAAAACTGGG - Intergenic
1058014689 9:100017287-100017309 GTTTCTTAATTAGTAAAAACGGG - Intronic
1058031788 9:100207793-100207815 TTTGAAAAACTATTAAAAATTGG - Intronic
1186983309 X:14982592-14982614 GTTGAATAACTGGTGAAAATGGG - Intergenic
1187774011 X:22734623-22734645 GGTGATTAATTAATAAACATAGG - Intergenic
1191639156 X:63411895-63411917 GTTTAAAAACTAATAAAAATAGG + Intergenic
1192276477 X:69636400-69636422 GGTGATTTACTAATAAAAAGAGG - Intronic
1192845526 X:74903174-74903196 GTTGATTAACGTTTAGAAATAGG - Intronic
1194599865 X:95906938-95906960 GTTGATAGACTAGTAAATAGAGG - Intergenic
1197012168 X:121579074-121579096 GTTGGTTAACTCCTAATAATCGG - Intergenic
1197250633 X:124212909-124212931 GTTGATGAATTAGTATGAATTGG + Intronic
1198412488 X:136385609-136385631 ATTGATTATCTTTTAAAAATGGG + Intronic
1200319372 X:155170583-155170605 CTTGATTGACTAGTAAACCTAGG + Intergenic
1201922738 Y:19252440-19252462 GTTGCTTATCTAGGAAAAACAGG + Intergenic