ID: 956454859

View in Genome Browser
Species Human (GRCh38)
Location 3:69410396-69410418
Sequence GTGTGTGAGTATGAGTATGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1972
Summary {0: 1, 1: 1, 2: 13, 3: 162, 4: 1795}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956454859 Original CRISPR GTGTGTGAGTATGAGTATGA GGG Intronic
900005866 1:50498-50520 GTGTGTGTGTGTGTGTAAGAGGG + Intergenic
900371752 1:2335344-2335366 GAGTGTGAGTGTGAGTGTGCCGG - Intronic
900648540 1:3719918-3719940 GTGTGTGTGTGTGTGTGTGACGG + Intronic
900703962 1:4064233-4064255 GTGTGTGAGTGTGAGTGGGGAGG - Intergenic
901003188 1:6159224-6159246 GTGTGTGTGTGTGTGTGTGATGG - Intronic
901147200 1:7073252-7073274 GGGTGTGAGTGTGGGTGTGATGG + Intronic
902538370 1:17135055-17135077 GTGTGTGTGTATGTGCATGTGGG - Intergenic
902547605 1:17199703-17199725 GTGTGTGTGTATGTGTGTTAGGG + Intergenic
902690672 1:18108504-18108526 GTGTGTGCGTGTGTGTGTGATGG + Intronic
902742312 1:18447318-18447340 GTGTGTGTGTGTGTGTATGGTGG + Intergenic
902816542 1:18919540-18919562 GTGTTTGACCATGAGGATGACGG - Intronic
902983447 1:20141490-20141512 GTGTGTGAGTGTGTGTGAGATGG + Intronic
903319482 1:22533717-22533739 GTGTGCACGTATGAGTATGTGGG + Intergenic
903752791 1:25638171-25638193 CTGTGTGTGTATGCGTATAACGG - Intronic
904123598 1:28220146-28220168 GTGTGTTTGTATGTGTATGTAGG - Intronic
904192765 1:28760297-28760319 GTGTGTGTGTGTGTGTGTGACGG + Intronic
904205143 1:28849475-28849497 GTGTATGTGTATCAGTGTGAGGG - Intronic
904259592 1:29280665-29280687 GTGTGTGTGTGTGTGTATGTGGG + Intronic
904409537 1:30317120-30317142 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
904554583 1:31351065-31351087 GTGTGTGTGTATGTTTAGGAAGG - Intronic
904682569 1:32239788-32239810 GTGTGTGAGTATGTGTTGGCGGG - Intergenic
904687694 1:32272806-32272828 GTGTGTGAGTGTGGGTGTGTGGG + Intronic
904867299 1:33590592-33590614 GTGTGTGTGTGTGTGTGTGATGG - Intronic
904969681 1:34409445-34409467 GTGTGTGTGTGTGTGTAGGAGGG + Intergenic
905007721 1:34723775-34723797 GTGTGTGAGTGTGTGTGTGGGGG + Intronic
905032492 1:34896582-34896604 GTGTGTGTGTGTGTGTGTGATGG - Intronic
905127923 1:35728915-35728937 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
905246103 1:36614948-36614970 GTGTGTGTGTATATGTATGTAGG + Intergenic
905459872 1:38115628-38115650 GTGTGTGAGTGTGTGTGTTAGGG + Intergenic
905516254 1:38564200-38564222 GTGGGTGAGTATGAGCTTGCTGG + Intergenic
905892541 1:41526355-41526377 GCGTGTGAGGGTGAGTGTGAGGG - Intronic
905892557 1:41526443-41526465 GGGTGTGAGCATGTGTGTGAGGG - Intronic
905892615 1:41526708-41526730 GTGTGTGAGGGTGTGTGTGAGGG - Intronic
905892624 1:41526764-41526786 GTGTGTTAGGGTGAGTGTGAGGG - Intronic
905892777 1:41527681-41527703 GTGTGTGAGGGTGAGCATGAGGG - Intronic
905892816 1:41527895-41527917 GTGTGTGAGGGTGAGCATGAGGG - Intronic
905892983 1:41528625-41528647 GTGTGTGAAGGTGAGTGTGAGGG - Intronic
905893002 1:41528717-41528739 GTGTGTGAGGATGAGTGTGAGGG - Intronic
905893066 1:41529058-41529080 GTGTGTGAGTGTGAGGGTGAGGG - Intronic
905893173 1:41529585-41529607 GAGTGTATGTATGTGTATGAAGG - Intronic
905925886 1:41749414-41749436 GTGTGTGTGTGTGTGTGTGATGG + Intronic
905971640 1:42146277-42146299 GTGTGGGAGTATGTGTATATGGG - Intergenic
906223536 1:44102547-44102569 GTGTATGTGTATGTGTGTGATGG - Intergenic
906398389 1:45486776-45486798 GTGTGTGTGTGTGTGTATGCTGG - Intronic
906607114 1:47180332-47180354 ATGTGTCACTCTGAGTATGACGG + Intergenic
906869760 1:49465204-49465226 GTGTGTGTGTGTGTGTATGTAGG - Intronic
907257751 1:53192679-53192701 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
907311051 1:53539277-53539299 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
907313972 1:53556041-53556063 GTGTGTGTGTGTGTGTATGCAGG + Intronic
907472209 1:54681153-54681175 TTGTGTGAGCCTGAGAATGAGGG + Intronic
907634510 1:56120041-56120063 GTGTGTGTGTGTGTGCATGAAGG - Intergenic
907636353 1:56138713-56138735 GTGTGTGTGTATGTGTATTATGG + Intergenic
907657824 1:56362335-56362357 GTGTGTGTGTGTGTGTATTAGGG - Intergenic
907711043 1:56881762-56881784 ATGTGTGGGGATGGGTATGAAGG - Intronic
907720271 1:56965409-56965431 GTGTGTGTGTGTGTGTAAGAAGG + Intronic
907849931 1:58246824-58246846 GTGTGTGACTCTGTGTGTGAAGG + Intronic
908030629 1:59995525-59995547 GAAGGTGAGAATGAGTATGATGG - Intronic
908641939 1:66233698-66233720 GTGTGTGTGTGTGTGTATAAAGG + Intronic
908718892 1:67101470-67101492 GTGTGTGTGTGTGTGTGTGATGG + Intronic
909000184 1:70208336-70208358 GTGTGTGTGTGTGAGTGAGATGG + Intronic
909003996 1:70254539-70254561 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
909091866 1:71235916-71235938 GTGTGTGTGTGTGTGTAAGAGGG - Intergenic
909153557 1:72040665-72040687 TTGTGTGTGTATGTGTATGCAGG + Intronic
909497414 1:76293854-76293876 GTGTGTGTGTATGTGTGTGAGGG + Intronic
909877868 1:80833045-80833067 GTGTGTGTGTGTGTGTATTAGGG + Intergenic
909910481 1:81251607-81251629 GTGTGTATGTATGTGTGTGAGGG + Intergenic
910498011 1:87854500-87854522 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
910523513 1:88151311-88151333 GTCTTTGAGGATGAGTATGAAGG - Intergenic
910589438 1:88913954-88913976 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
910631963 1:89364637-89364659 GTGTGTGTGTATGTGTGTGTGGG + Intronic
910721579 1:90292564-90292586 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
910730421 1:90389814-90389836 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
910762507 1:90747820-90747842 GTGTGTGTGTAAGAGGATGGGGG + Intergenic
910859381 1:91729027-91729049 GTGTGTGTGTGTGTGTATGCTGG - Intronic
910859392 1:91729144-91729166 GTGTGTGTGTGTGTGTATGCTGG - Intronic
910881681 1:91927262-91927284 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
911048583 1:93650098-93650120 GTGTGCGAGTAAGGGTGTGATGG + Intronic
911550393 1:99271926-99271948 GTGTGTGTGTGTGTGTGTGATGG + Intronic
911694253 1:100870676-100870698 GTGATGGAGGATGAGTATGAAGG - Intergenic
911710406 1:101064954-101064976 GTGTGTGTACATGAATATGAGGG + Intergenic
912047383 1:105476114-105476136 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
912181417 1:107223264-107223286 GTGTGTGCGCATGTGTGTGAAGG + Intronic
912344842 1:108954834-108954856 GTGTGTGTGTGTGTGTGTGACGG + Intronic
912544807 1:110443035-110443057 GTGTGTGAGGGTGGGAATGATGG + Intergenic
912727692 1:112074124-112074146 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
912744242 1:112231932-112231954 GTGAGTGTGAATGACTATGAAGG + Intergenic
914046899 1:144101273-144101295 GTGTGTGTGTGTGAGTGTGCTGG + Intergenic
914131210 1:144859413-144859435 GTGTGTGTGTGTGAGTGTGCTGG - Intergenic
914395658 1:147265178-147265200 TTGGGTAAGTATGAGTTTGAGGG + Intronic
914673715 1:149891627-149891649 GTGTGTGTGTGTGTGTGTGATGG + Intronic
914686720 1:149986234-149986256 GTGTGTGTGTGTGTGTGTGATGG - Intronic
914955398 1:152157587-152157609 GTGTGTGTGTGTGTGTATGCTGG + Intronic
914972334 1:152319326-152319348 GTGTGTGTGTGTGTGTTTGAAGG + Intronic
915044924 1:153004250-153004272 GTGTGTGTGTATGTGTGTGGTGG - Intergenic
915062416 1:153197164-153197186 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
915069665 1:153255724-153255746 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
915138772 1:153753036-153753058 GTGTGTGTGTGTGTGTAGGAGGG - Intronic
915307001 1:154986039-154986061 GTGTGTGTGTGTGTGTGTGACGG + Intronic
915409630 1:155689904-155689926 GTGTGTGTGTGTGTGTGTGACGG - Intronic
915480831 1:156183727-156183749 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
915537318 1:156544705-156544727 GTGTGTGGGTGTGGGTATGTGGG - Intronic
915788879 1:158646110-158646132 CTGTGTGTGTATGTGTATGTTGG - Intronic
915979412 1:160410669-160410691 GTGTGTGTGTGTGTGTATAAGGG - Intronic
916045345 1:160995744-160995766 GTGTGTGTGTGTGTGTGTGAGGG - Exonic
916897559 1:169181352-169181374 GTGTGTGTGTAGGAATTTGAGGG - Intronic
917420743 1:174860919-174860941 GTGTGTGTGTATGTGTGTGGTGG + Intronic
917606743 1:176638962-176638984 GTGTGTGTGTATGTGTTTGTAGG + Intronic
917867335 1:179209739-179209761 GAGAGTGAGTATTTGTATGAGGG - Intronic
917875746 1:179285395-179285417 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
918016305 1:180636473-180636495 GTGTGTCAGCGTGAGTATGCTGG + Intronic
918083238 1:181223419-181223441 GTGTGTGTGTATGTGTATGTGGG + Intergenic
918093359 1:181315974-181315996 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
918117266 1:181508157-181508179 GTGTGTGTGTGTGTGTGTGATGG + Intronic
918433341 1:184484904-184484926 GTGTGTGTGTGTGTGTGTGATGG + Intronic
918452063 1:184668642-184668664 GTGTGTGTGTAAGATTGTGATGG - Intergenic
918537878 1:185594456-185594478 GTGTGTGTGTATGTGTTTTAAGG - Intergenic
919249285 1:195031192-195031214 GTGTGTGTGTGTGTGTATAAAGG + Intergenic
919263821 1:195236431-195236453 GTGTGTGTGTGTGTGTATGCAGG - Intergenic
919773127 1:201175787-201175809 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
919813200 1:201421838-201421860 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
920027656 1:203012145-203012167 GTGTGTGTGTGTGTGTGTGATGG - Intronic
920027664 1:203012232-203012254 GTGTGTGTGTGTGTGTGTGATGG - Intronic
920032059 1:203043534-203043556 GTGTGTGTGTGTGTGTATGGGGG + Intronic
920247485 1:204599497-204599519 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
920256626 1:204659622-204659644 GTGTGTGTGTGTGTGTGTGATGG + Intronic
920321390 1:205125870-205125892 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
920532359 1:206712959-206712981 GTGTGTGTGTGTGTGTGTGATGG - Intronic
920656538 1:207879927-207879949 GTATGTGTGTATGAATATGATGG + Intergenic
920669999 1:207996313-207996335 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
920892267 1:210000451-210000473 GTGTGTGCGTATGAGGACAAAGG - Intronic
920947157 1:210540438-210540460 GTGTGTGTGTGTGTGTAAGAGGG - Intronic
921020589 1:211231538-211231560 GTGTGTGTGTGTGTGTATCATGG - Intergenic
921046363 1:211480645-211480667 GTGTGTGTGTGTGTGTAGGAAGG - Intronic
921567825 1:216741453-216741475 GTGTGTGTGTATGTGTAGGGGGG - Intronic
921754443 1:218837510-218837532 GTGTGTGTGTGTGTGTAGGAGGG + Intergenic
921780929 1:219162796-219162818 GTGTGTGTCTGTGTGTATGATGG + Intergenic
921794271 1:219324707-219324729 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
921796019 1:219345875-219345897 GTGTGTGAGTATCACATTGAGGG - Intergenic
922127055 1:222738026-222738048 ATGTGTGAGTATGTGTGTGTTGG + Intronic
922173736 1:223178696-223178718 GTGTGTGAGTGTGTGCATGGTGG + Intergenic
922222081 1:223616322-223616344 GTGTGTGTGGATGTGTAGGAAGG - Intronic
922613176 1:226944791-226944813 GTGTGTGTGTATGTGTAGAAGGG + Intronic
922881888 1:228987230-228987252 GTGTGTGTGTATGCGTGTGGGGG - Intergenic
923015144 1:230120732-230120754 GTGTGTGCGGAGGAGGATGAGGG - Intronic
923016179 1:230128265-230128287 GTGTGTGTGTGTGGTTATGAAGG + Intronic
923030714 1:230247210-230247232 GTGTGTGTGTATGAATAAGCAGG - Intronic
923292901 1:232563979-232564001 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
923292921 1:232564266-232564288 GTGTGTGTGTGTGTGTATGATGG + Intergenic
923353391 1:233130487-233130509 GTGTGTGTGTGTGTGTGTGATGG + Intronic
923812875 1:237339886-237339908 GTGTGTGACAATGGGTATGAGGG - Intronic
924096920 1:240561687-240561709 GTGTGTGTGTGTGTGTATGCAGG - Intronic
924112454 1:240713545-240713567 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
924168139 1:241306704-241306726 GTGTGAGGGTATGTGTATAAGGG - Intronic
924291506 1:242541564-242541586 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
924378643 1:243439619-243439641 GTGTGTGTGTGTGTGTGTGATGG - Intronic
924398319 1:243649343-243649365 GTGTGTGTGTGTGTGTATGTTGG + Intronic
924852328 1:247842882-247842904 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1063051041 10:2447807-2447829 GTGTGTGTGTGTGTGTATGCAGG - Intergenic
1063184852 10:3641425-3641447 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1063257242 10:4341749-4341771 GTGTGTGAGTATGTGTGTATGGG - Intergenic
1063539618 10:6919047-6919069 GTGTTTCAGTTTGAGTCTGAAGG + Intergenic
1063545351 10:6975929-6975951 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
1063958218 10:11284668-11284690 ATGTGTGAGTGTGTGGATGATGG + Intronic
1064273032 10:13882021-13882043 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1064297925 10:14095036-14095058 ATGTGTGTGTATGAACATGAAGG + Intronic
1064862072 10:19837436-19837458 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1064969797 10:21053372-21053394 GTGAGTGTGGATGAGTATGCAGG - Intronic
1065021891 10:21508556-21508578 GTGTGTGTGTGTGTGTAAGAGGG + Intergenic
1065052448 10:21809942-21809964 GTGTGTGTGTATGTGTGTGGCGG + Intronic
1065188383 10:23190556-23190578 GTGTGTGTGTGTGTGTATCAAGG - Intergenic
1065196920 10:23275576-23275598 GTGTGTGTGTATGTGTGTGTAGG - Intronic
1065213689 10:23429577-23429599 GTGTGTGTGTGTGTGTATCAGGG + Intergenic
1065265197 10:23967921-23967943 GTGTGTGTGTGTGTGTATGGAGG + Intronic
1065285383 10:24182435-24182457 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1065315202 10:24457354-24457376 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1065412452 10:25444238-25444260 GTGTGTGAGTGTGTGTTTGTGGG + Intronic
1065545562 10:26817002-26817024 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1065983057 10:30921675-30921697 GTCTATGATTATGCGTATGATGG + Intronic
1066192561 10:33069396-33069418 GTGTGTGAGTATCAAAATGAGGG - Intergenic
1066374240 10:34843223-34843245 GTGTGTGTGTATGTGTGTGATGG + Intergenic
1066424125 10:35290219-35290241 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1066492117 10:35903869-35903891 GCATGTTAGTCTGAGTATGATGG - Intergenic
1066496743 10:35949431-35949453 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
1066543888 10:36478393-36478415 GTGTGTGTGTATGTGTGAGATGG + Intergenic
1066977402 10:42381699-42381721 GTGTGTGTGTTTGTGTGTGATGG - Intergenic
1067386418 10:45821111-45821133 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1067726123 10:48772438-48772460 GTGTGTGTGTATGTGTATTTGGG + Intronic
1068004025 10:51371414-51371436 CTGTGTGTGTGTGAGTCTGAGGG + Intronic
1068315080 10:55330866-55330888 GTGTATGTGTATGTGTATGAGGG + Intronic
1068558059 10:58481079-58481101 GTGTGTGTGTGTGCGCATGAGGG - Intergenic
1068604332 10:58988945-58988967 GTGTGTGTGTATGTGTAAGCTGG + Intergenic
1068684806 10:59859222-59859244 GTGTGTGTGTGTGTGTATGAAGG + Intronic
1069083593 10:64114489-64114511 GTGTGTGTGTATAAGTAAGTGGG + Intergenic
1069613918 10:69794177-69794199 GTGTGTGTGTGTGTGTATGGTGG + Intergenic
1069744194 10:70704466-70704488 GTGTGTGAGCATGAGTGTATGGG - Intronic
1069854500 10:71432504-71432526 GTGGGTGAGTGTGAGTGTGTGGG + Intronic
1070123539 10:73601453-73601475 GTGTGTGAGTATCAGGTTGAAGG - Intronic
1070214052 10:74357228-74357250 GTGTGTGCATATGTGTATGCAGG + Intronic
1070337443 10:75467953-75467975 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1070361331 10:75692597-75692619 GTGTGTGTGTATGTGTATGTAGG + Intronic
1070638567 10:78148975-78148997 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1070638570 10:78149010-78149032 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1070677042 10:78419156-78419178 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1070776794 10:79114523-79114545 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1070816334 10:79326830-79326852 GTGTGTGTGTCTGTGTATGTGGG + Intergenic
1070864376 10:79698095-79698117 GTTTGTGAGTGTGTATATGAGGG - Intergenic
1071020806 10:81053124-81053146 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1071192417 10:83116961-83116983 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1071250493 10:83813932-83813954 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1071403261 10:85299694-85299716 GTGTGTGTGTTTGTGTGTGATGG + Intergenic
1071423474 10:85525460-85525482 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1071433839 10:85628211-85628233 GTGTGTGAGTGTGTGCATGTTGG + Intronic
1071562338 10:86654121-86654143 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1071631275 10:87220320-87220342 GTTTGTGAGTGTGTATATGAGGG - Intergenic
1072107623 10:92289908-92289930 GTGTGTGTGTATGTGTGTGGTGG + Intronic
1072168567 10:92838174-92838196 ATGTGTGGGAATGAGTATGCGGG - Intronic
1072347906 10:94527088-94527110 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1073152539 10:101321770-101321792 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1073401440 10:103260666-103260688 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1073482473 10:103795333-103795355 GCGTGTGAGTCTGGGTCTGAAGG + Intronic
1073488404 10:103836535-103836557 GTGTCTGTATATGAGTTTGAAGG - Intronic
1073584810 10:104699597-104699619 GTGTGGAAGTAGGAATATGATGG + Intronic
1073588547 10:104734084-104734106 GTGTGTGAGTAGATGTATGTTGG + Intronic
1073683981 10:105732776-105732798 GTGAGTGAGATTGAGTGTGATGG - Intergenic
1073686596 10:105761166-105761188 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1073854677 10:107660838-107660860 GTGTGTGTGTATGTGTATAAAGG - Intergenic
1073858734 10:107710877-107710899 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1074185504 10:111097018-111097040 GTGTGTGTGTGTGTGTATGAGGG + Intergenic
1074190468 10:111130848-111130870 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1074309014 10:112305939-112305961 GTGTGTGTGTATATATATGAGGG + Intergenic
1074320382 10:112396683-112396705 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1074585082 10:114760401-114760423 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1074921730 10:118021071-118021093 GTGTGTGTGTATGTGTAGGCAGG - Intronic
1074964096 10:118473494-118473516 GTGTGTGTGTTTGTGTATGTGGG - Intergenic
1075284859 10:121174707-121174729 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1075600065 10:123761234-123761256 GGCTGTGGGTATGAGTGTGACGG + Intronic
1075650467 10:124125063-124125085 GTGTGTGTGCATGTGTATGTTGG - Intergenic
1075829501 10:125394113-125394135 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
1076054721 10:127362962-127362984 GTGTATGTGTATGTGTATGTGGG - Intronic
1076189335 10:128472001-128472023 GTGTGTGAGCATGTGTTTGTGGG - Intergenic
1076482104 10:130791698-130791720 GTGTGTGAGTGTGACTGTGTGGG - Intergenic
1076486048 10:130818035-130818057 GTGTGTGTGTATGAGTGTCTAGG + Intergenic
1076499504 10:130925652-130925674 GAGTGTGAGCATGTGTGTGAGGG + Intergenic
1076755109 10:132565783-132565805 GCGTGTGAGTATGTGTGTGTGGG + Intronic
1077258686 11:1603737-1603759 GTGTGTATGTGTGTGTATGAGGG - Intergenic
1077258688 11:1603769-1603791 GTATGTATGTATGTGTATGAGGG - Intergenic
1077784046 11:5363234-5363256 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1078024782 11:7684528-7684550 GTGTGTGTGTGTGTGTATTACGG + Intergenic
1078218582 11:9332832-9332854 GTGTGTGTGTATGTGTGTGCAGG + Intergenic
1078330106 11:10412337-10412359 GTGTATGAGCATGACTTTGATGG - Intronic
1078396310 11:10984952-10984974 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1078531148 11:12137605-12137627 GTGTGTGAGTGTGTGTGTGGGGG + Intronic
1078541221 11:12214820-12214842 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1078738055 11:14039420-14039442 GTGTGTGTGTATGTGTGTGTAGG + Intronic
1079394102 11:20046593-20046615 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1079428107 11:20363343-20363365 GTGTGTGTGTATGTTTATGTAGG + Intergenic
1079506701 11:21160994-21161016 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1080242146 11:30138777-30138799 GTGTGTGAGTATGGGTGGGGTGG - Intergenic
1080438638 11:32269828-32269850 GTGTGTGTGTCTGTGTGTGAAGG + Intergenic
1080981617 11:37414126-37414148 GTGTGTGTGTGTAAGTATGTTGG + Intergenic
1080989181 11:37509127-37509149 GTGTGTGTGTGTGTGTATTAGGG - Intergenic
1081023762 11:37982497-37982519 GTGTGTGTGTGTGTGTATGGTGG + Intergenic
1081107522 11:39088969-39088991 GTGTGTGTGTATAAGAAAGAGGG - Intergenic
1081130090 11:39369062-39369084 GTGTGTGTGTGTGTGTATGCAGG + Intergenic
1081240852 11:40705021-40705043 GTGTGTGTGTATGTGTGTAAAGG - Intronic
1081453450 11:43196456-43196478 GTGTGTGTGTGTGAGTGTGCTGG - Intergenic
1081467258 11:43332679-43332701 GTGTGTGTATATGAGAGTGAGGG - Intronic
1081585171 11:44379307-44379329 TTGTGTGTGTCTGAGTATGCAGG - Intergenic
1081628945 11:44674404-44674426 GTGTGTGAGTGGGGGTGTGAGGG + Intergenic
1081632702 11:44700693-44700715 GTGTGTGTGTGTGTGTATGCTGG + Intergenic
1081706944 11:45187824-45187846 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1081755598 11:45542130-45542152 GTGGGGGAGGATGAGGATGATGG - Intergenic
1081831543 11:46120120-46120142 GTGTGTGAGTGTGAGTGTGTTGG - Intronic
1081997751 11:47376090-47376112 GTGTGGGATTATGAGTGTGAGGG - Intronic
1082099342 11:48159100-48159122 GTGTGTGTGTGTGTGTATGTGGG + Intronic
1082108279 11:48243896-48243918 GTGTGTGTGTGTGTGTATGGGGG + Intergenic
1082220953 11:49636059-49636081 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1083072389 11:59998859-59998881 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1083273164 11:61582079-61582101 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1083309155 11:61775672-61775694 GTGTGTGGGTATGGACATGAGGG + Intronic
1083401511 11:62426448-62426470 GTGTGTGAGTGTGTGTTTGGGGG - Intergenic
1083552271 11:63598854-63598876 TTGAGTGAGTATGTGTGTGAGGG + Intronic
1083640698 11:64143741-64143763 GTGTGTGTGTATGTGTGTGTCGG - Intronic
1083830230 11:65226899-65226921 GTGTGTGTGTGTAAGTATGTGGG - Intergenic
1084609180 11:70191334-70191356 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
1084702712 11:70797820-70797842 GTGTGTGTGTATGAGAGTGGAGG - Intronic
1085166733 11:74407889-74407911 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1085329988 11:75640192-75640214 GTGTGTGAGTGTGTGTGTGGGGG - Intronic
1085761024 11:79241724-79241746 GTGTGTGTGCATGTGTATGGTGG + Intronic
1085825669 11:79844510-79844532 GTGTGTAAGTGTGTGTGTGATGG - Intergenic
1086025565 11:82286454-82286476 GTGCGTAGGTATGTGTATGAGGG - Intergenic
1086273209 11:85093393-85093415 GTGTGTGAGTCTGAGTGTACTGG - Intronic
1086493769 11:87381794-87381816 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1086662972 11:89444512-89444534 GTGTGTGTGTATGTGTGTTAGGG - Intronic
1087134971 11:94707266-94707288 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1087420174 11:97912969-97912991 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1087429919 11:98040577-98040599 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1087538135 11:99478532-99478554 GGGTGTGAGTATCAGGAGGAGGG + Intronic
1087618353 11:100514702-100514724 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1087844673 11:102959676-102959698 GTGTGTGTGTGTGTGTATGGAGG - Intergenic
1087899238 11:103621990-103622012 GTGTGTGATTATGCCTCTGAGGG + Intergenic
1087964029 11:104390347-104390369 GTGTGTGAGTGTGTGTATGTAGG + Intergenic
1088254956 11:107894703-107894725 GTGTGTGTGTGTGATTATTATGG - Intronic
1088557052 11:111072580-111072602 GTGTGTGTGTGTGTGTCTGAGGG - Intergenic
1088580516 11:111311184-111311206 GTGTGTGTGTGTGTGTATGATGG + Intergenic
1088585708 11:111358391-111358413 GTGAGAGAGTATGTGTGTGAGGG - Intronic
1088681389 11:112245788-112245810 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1088727221 11:112649991-112650013 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1088847502 11:113680745-113680767 GTATGTAAGCATGTGTATGAGGG + Intergenic
1089238106 11:117050283-117050305 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1089420000 11:118324725-118324747 GTGTGTGTGTATACATATGATGG + Intergenic
1089598337 11:119597125-119597147 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1089640113 11:119842487-119842509 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1089797326 11:120992063-120992085 GTGTGAGTGTATGAGTGTCAGGG + Intergenic
1089873487 11:121697311-121697333 GTGTGTGTGTGTGTGTATGGGGG + Intergenic
1089965234 11:122650238-122650260 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1090096810 11:123750362-123750384 GTGTGTGGGTATTAGTCTGCAGG - Intergenic
1090413001 11:126521716-126521738 GTGTGTGTGTGTGTGTATAAGGG + Intronic
1090476353 11:127025043-127025065 GTGTGTGTGTGTGTGTAAGAGGG + Intergenic
1090573395 11:128072420-128072442 GTGTGTGAGTGTGTGTATTTGGG - Intergenic
1090743252 11:129685962-129685984 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1090757816 11:129809492-129809514 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1090797687 11:130149206-130149228 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1091061708 11:132469626-132469648 GTGTGTGTGTATGTGTGTGGGGG + Intronic
1091136100 11:133191519-133191541 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1091150762 11:133326464-133326486 GTGTGTGTGTATGTGTATGAGGG + Intronic
1091189711 11:133680931-133680953 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
1091196832 11:133738735-133738757 GTGTGTGGGTGTGTGTATGTGGG + Intergenic
1091196865 11:133738897-133738919 GTGTGTGGGTGTGTGTATGTGGG + Intergenic
1091196903 11:133739072-133739094 GTGTGTGGGTGTGTGTATGTGGG + Intergenic
1091196939 11:133739186-133739208 GTGTGTGGGTGTGTGTATGTGGG + Intergenic
1091248829 11:134124347-134124369 GAGTGTGCGTGTGAGTGTGATGG + Intronic
1091428967 12:416313-416335 GTGTGTGTGTGTGAGTCTGTGGG + Intronic
1091538865 12:1440650-1440672 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1091710925 12:2739784-2739806 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1091963775 12:4721116-4721138 GTGTGTGTGTATGCGTGTGTGGG + Intronic
1092119301 12:6032863-6032885 GTGTGTGTGTATGAGTACATGGG - Intronic
1092229261 12:6767578-6767600 TTGTGTGTGTATGTGTATGGCGG + Intronic
1092754344 12:11749282-11749304 GTGTGTGTGTGTGTGTATGGGGG - Intronic
1092983813 12:13825518-13825540 GTGTGTGTGTGTGTGTATGATGG + Intronic
1093458277 12:19385716-19385738 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1093800568 12:23367076-23367098 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1093808099 12:23459790-23459812 GTGTGTGTGTGTGTGTATCAGGG + Intergenic
1093993121 12:25612287-25612309 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1094016882 12:25874353-25874375 GTGTGTGAGGCTGGGGATGAAGG - Intergenic
1094180203 12:27584474-27584496 GTGTCTGTGAATGAGTGTGAAGG + Intronic
1094260465 12:28491879-28491901 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1096160492 12:49372974-49372996 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1096258090 12:50074892-50074914 GTGTGTGTGTGTGTGTCTGAGGG + Intronic
1096321765 12:50620377-50620399 ATGTGTGAGGCTGAGTATAAAGG - Intronic
1097089083 12:56491212-56491234 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1097171175 12:57113924-57113946 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1097242405 12:57584588-57584610 GTGCGTGCGTGTGTGTATGAAGG - Exonic
1097364008 12:58691131-58691153 GTGTATGAGTGTGAGTGAGATGG + Intronic
1097460988 12:59861646-59861668 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1097475654 12:60052624-60052646 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1097593764 12:61602852-61602874 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1097636087 12:62123769-62123791 GTGTGTGTGTATGTGTGTGGTGG - Intronic
1097673446 12:62569569-62569591 GTGTGTGAATGTGTGTATGCAGG - Intronic
1097906867 12:64929863-64929885 GTGTGTGTGTGTGTGTTTGATGG + Intergenic
1097975891 12:65685384-65685406 GTGTGTGTGTGTGTATATGATGG - Intergenic
1097995927 12:65888007-65888029 GTGTGTGTGTATGAGAGAGATGG - Intronic
1098314551 12:69179577-69179599 GTGTGTGTGTGTGTGTTTGAAGG - Intergenic
1098405101 12:70116683-70116705 GTGTGTGTGTATGTGTGAGACGG - Intergenic
1098463655 12:70762282-70762304 GTGTGTGTGTATGTGTGTGTAGG - Intronic
1098568105 12:71957719-71957741 GTGTGTGGGTGTGTGTGTGAGGG + Intronic
1098590701 12:72208183-72208205 GTGTGTGAGTGTGTGTATAAAGG - Intronic
1098690005 12:73475033-73475055 GTTGGTAAGTATGAGAATGAAGG + Intergenic
1098922443 12:76314846-76314868 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1099254328 12:80297278-80297300 GTATGTGAGGATGAATAAGAGGG - Intronic
1099320199 12:81137318-81137340 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1099360852 12:81698757-81698779 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1099417416 12:82408608-82408630 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1099439062 12:82679432-82679454 GTATGTGATTATGTGTATGTAGG - Intergenic
1099444518 12:82735966-82735988 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1099470798 12:83045704-83045726 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1099566617 12:84256768-84256790 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1099692574 12:85977777-85977799 GTGTGTGTGTGTGTGTGTGAAGG - Exonic
1099724036 12:86401266-86401288 GTGTGTGTGTGTGTGTATGTGGG + Intronic
1099867551 12:88302811-88302833 GTGTGTTTGCATGAGTATGGGGG - Intergenic
1100004558 12:89878853-89878875 GTGTGTGTGTAAGTGTGTGAGGG - Intergenic
1100004951 12:89883799-89883821 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
1100453460 12:94729899-94729921 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1100872791 12:98929035-98929057 GTGTGTGTGTGTGTGTATTAGGG - Intronic
1100942697 12:99741200-99741222 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1101076165 12:101131816-101131838 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1101085827 12:101234824-101234846 GTGTGTGTATATGTGTGTGAAGG - Intergenic
1101158332 12:101948756-101948778 GTGTGTGTGTGTGTGTATAATGG - Intronic
1101197449 12:102399137-102399159 GTGTGTGTGTCTGTGTATGTAGG + Intronic
1101211195 12:102536395-102536417 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1101264596 12:103070503-103070525 GTGTGTGTGTATGTGTATGTAGG - Intergenic
1101535202 12:105610139-105610161 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1101608745 12:106270805-106270827 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1101812059 12:108115926-108115948 GTGTGTGTGTGTGTGTATAAAGG + Intergenic
1101915857 12:108895343-108895365 GTGTGTGTGCATGTGTGTGAGGG + Intronic
1101915862 12:108895403-108895425 GTGTGTGTGCATGTGTGTGAGGG + Intronic
1101915874 12:108895542-108895564 GTGTGTGTGCATGTGTGTGAAGG + Intronic
1101915889 12:108895737-108895759 GTGTGTGTGCATGTGTGTGAGGG + Intronic
1102010402 12:109614961-109614983 GTGTGTGTGTATGTGTGAGACGG + Intergenic
1102547180 12:113665603-113665625 GTGTGTGTGTGTGAATAGGATGG - Intergenic
1102572717 12:113836914-113836936 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1102572744 12:113837234-113837256 GTGTGTGTGTATTAGGAGGATGG - Intronic
1102576924 12:113861496-113861518 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1102675181 12:114653146-114653168 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1102679039 12:114678017-114678039 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1102842165 12:116136444-116136466 GTGTGTGTGTATGAGAGAGAGGG + Intronic
1102977135 12:117214830-117214852 GTGTGTGTGTGTGTGTGTGATGG - Exonic
1103007351 12:117431938-117431960 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1103007571 12:117434196-117434218 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1103007629 12:117434846-117434868 GTGTGTGAGGTTGTGTGTGAAGG - Intronic
1103737094 12:123067450-123067472 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1104220588 12:126780741-126780763 GTGTGTGTGTTGGAATATGATGG - Intergenic
1104225713 12:126830997-126831019 GTGTGTGTGTGTGTGTATGGTGG - Intergenic
1104367214 12:128188720-128188742 GAGTGTGAGAATGTGTGTGAGGG + Intergenic
1104389865 12:128382922-128382944 GTGTGTGAATCTGTGTATGTGGG + Intronic
1104470366 12:129025148-129025170 GTGTGTGGGTGTGAGCATGTGGG - Intergenic
1104470400 12:129025322-129025344 GGGTGTGAGTGTGAGTATATGGG - Intergenic
1105209321 13:18248416-18248438 GTGTGTGAGTGTGAGTATGGGGG - Intergenic
1105209329 13:18248510-18248532 GAGTGTGAGTGTGAGTGTGTGGG - Intergenic
1105219070 13:18308748-18308770 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1105408384 13:20150383-20150405 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1105543890 13:21338006-21338028 CTGTGTAAGTAGAAGTATGAAGG + Intergenic
1105577966 13:21670554-21670576 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1105800948 13:23903136-23903158 GTGTGTGATTGTGAGTGAGAGGG - Intergenic
1106084237 13:26526064-26526086 GTGTGTGTGTGTGTGTAAGAGGG - Intergenic
1106487696 13:30187070-30187092 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1106900972 13:34354875-34354897 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1107064580 13:36199308-36199330 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1107194008 13:37625158-37625180 GTGGGTGAGTAAAAATATGAAGG + Intergenic
1107376186 13:39807219-39807241 GTGTGTGTGTGTGTGTATGATGG + Intergenic
1107387511 13:39927978-39928000 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1107669341 13:42727990-42728012 GAATGTGAGTATAGGTATGAAGG + Intergenic
1107796260 13:44055187-44055209 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1107811382 13:44203141-44203163 GTGTGTGTGTGTGTGTATGATGG + Intergenic
1107821560 13:44290312-44290334 GTGTGTGTGTCTGTGTGTGAAGG + Intergenic
1108228633 13:48316716-48316738 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1108243642 13:48493222-48493244 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1108260292 13:48649036-48649058 GTGTGTATGTATGTGTATGTGGG + Intergenic
1108283725 13:48884975-48884997 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1108532579 13:51341414-51341436 GAGTGTGAGTGTGAGCAGGAGGG - Intronic
1108532583 13:51341452-51341474 GAGTGTGAGTATGAGCAGCAGGG - Intronic
1108784748 13:53883143-53883165 GTGTGTGTGTTTGAGAAAGAGGG - Intergenic
1109052212 13:57497697-57497719 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1109060409 13:57610919-57610941 GTGAGTGAGAAAGAGCATGAAGG + Intergenic
1109628608 13:65013333-65013355 GTGTGTGCGTGTGTGTATGGAGG + Intergenic
1109686140 13:65822191-65822213 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1109720271 13:66267281-66267303 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1109762754 13:66851572-66851594 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1109768649 13:66939440-66939462 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1109777411 13:67059987-67060009 GTATGGGGGTATGAGTATGAGGG + Intronic
1109882468 13:68498208-68498230 TGGTGTGAGTGTGAGTTTGATGG + Intergenic
1109988836 13:70026728-70026750 GTGTGTGTGTGTGTGTAAGAGGG + Intronic
1110196113 13:72790418-72790440 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1110462242 13:75757826-75757848 GTGTGTGTGTGTGTGTATGTTGG + Intronic
1110700069 13:78536606-78536628 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1110820849 13:79914386-79914408 GTGTATGTGTATGTGTATGTGGG + Intergenic
1110849814 13:80232319-80232341 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
1111110474 13:83702036-83702058 GTGTGTGTGTGTGTGTATTAAGG - Intergenic
1111173851 13:84566368-84566390 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1111191059 13:84806674-84806696 GTGTGTGTGTATGAGTGACAGGG - Intergenic
1111377071 13:87394336-87394358 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1111592022 13:90360675-90360697 GTGTGTGAATATGTGTATTTTGG - Intergenic
1111691362 13:91567272-91567294 GCCTGTGCGTATGAGTATGCAGG + Intronic
1111827455 13:93285654-93285676 GTGTGTGTGTATGTGTTTGGTGG + Intronic
1111862463 13:93726097-93726119 GTGTGTGTGTGTGTGTATGAAGG - Intronic
1111947503 13:94681322-94681344 GTGTGTGTGTGTGTGTATGATGG + Intergenic
1112109098 13:96274836-96274858 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1112144375 13:96680866-96680888 GTGGGTGAGAAAGAGCATGAAGG + Intronic
1112265084 13:97916254-97916276 GTGTTTTATTATGAGCATGATGG + Intergenic
1112717761 13:102206122-102206144 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1112730204 13:102352236-102352258 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1112763693 13:102718533-102718555 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1112841881 13:103589953-103589975 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1112959170 13:105101746-105101768 CCTTGTGCGTATGAGTATGATGG - Intergenic
1112999517 13:105618104-105618126 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1113017038 13:105839115-105839137 GTGTGTGTGTGTGTGTATAATGG - Intergenic
1113225663 13:108157082-108157104 GTGTGTGAGTATGTGTGAGTAGG - Intergenic
1113920263 13:113904033-113904055 GTGCGTGAGGATGAGAGTGAGGG + Intergenic
1113963951 13:114141393-114141415 GTGTGTGCGTGTGTGTGTGAGGG - Intergenic
1114027871 14:18545060-18545082 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1114119807 14:19658792-19658814 GTGGGTGAGTATGGGTGTGCGGG - Intergenic
1114142432 14:19929393-19929415 GTGTGTGTGTGTGCGTATGGGGG + Intergenic
1114244338 14:20898927-20898949 AAGTGTGAGTGTGAGTATGGAGG - Intergenic
1114247328 14:20927079-20927101 AAGTGTGAGTGTGAGTATGGAGG - Intergenic
1114683247 14:24505203-24505225 GTGTGTGTGTGTGTGTATGGGGG - Intronic
1114753558 14:25232616-25232638 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1114825672 14:26075283-26075305 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1114928878 14:27442317-27442339 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1115157254 14:30355521-30355543 ATGTGTGAGTGTGAGTGTGTGGG - Intergenic
1115346828 14:32352117-32352139 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1115402707 14:32980932-32980954 GTGTGTGTGTATGCGTGTGTGGG - Intronic
1115473703 14:33794393-33794415 GTGTGTGAGTGTGTGTGTGCTGG - Intronic
1115658250 14:35464963-35464985 GTGTGTGTGTATGTGTGTGTTGG - Intergenic
1115747094 14:36449151-36449173 GTGTGTGTGTGTGTGTATTAGGG - Intergenic
1116212137 14:41961950-41961972 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1116278438 14:42868845-42868867 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1116361037 14:43998476-43998498 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
1116673888 14:47879984-47880006 GTGTGTGAGTGTGTGTGTGGTGG + Intergenic
1116735244 14:48681680-48681702 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1116882857 14:50189058-50189080 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1116980843 14:51168580-51168602 GTATGTGAGGATGTGTGTGAGGG - Intergenic
1117028329 14:51644350-51644372 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1117180953 14:53191181-53191203 GTGTGTGTGTGTGTGTATGATGG + Intergenic
1117267671 14:54107016-54107038 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1117701599 14:58419448-58419470 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1117964008 14:61188721-61188743 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1117992152 14:61444613-61444635 GTGTGAGAGAGAGAGTATGAGGG - Intronic
1118030919 14:61817004-61817026 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1118207759 14:63739055-63739077 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1118271822 14:64350591-64350613 GTGTGTGTGTGTGTGTATAAAGG + Intergenic
1118323377 14:64766174-64766196 GTGTGTGTGTATGTGTATGTGGG + Intronic
1118493054 14:66280367-66280389 GTGTGTGCGTATGTGTGTAAGGG - Intergenic
1118853816 14:69605934-69605956 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1118906404 14:70026929-70026951 ATGTGTGTGTATGAGTGTGATGG + Intronic
1118973395 14:70656204-70656226 GTGTGTGTGTGTGTGTATCAGGG - Intronic
1118996876 14:70844530-70844552 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1119314219 14:73677898-73677920 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1119580255 14:75772585-75772607 GTGTGTGTGAATCAGAATGATGG + Intronic
1119913755 14:78375997-78376019 GTGTGTGTGTGTGTGTATCAAGG - Intronic
1119970954 14:78969841-78969863 GTGTGTGTGTGTGTGTATAAAGG + Intronic
1119996710 14:79261625-79261647 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1120004187 14:79338233-79338255 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1120313514 14:82861777-82861799 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1120328198 14:83055154-83055176 GTGTGTAAGTTTGAGTAGTAGGG - Intergenic
1120651863 14:87143869-87143891 GTGTGTGTGTGTGTGCATGAGGG - Intergenic
1120862572 14:89268004-89268026 GTGTGTATGTATTATTATGAAGG - Intronic
1120898471 14:89555861-89555883 GTGTGTGTGTGTGTGTATGTGGG + Intronic
1121410921 14:93747548-93747570 GTGTGAGAGTGTGAGTGTGGGGG + Intronic
1121416902 14:93785897-93785919 GTGTGTGTGTGTGTGTATGCAGG - Intronic
1121674177 14:95739194-95739216 GTGTGTGAGTGTGTGGTTGAGGG + Intergenic
1121922502 14:97895645-97895667 GTGTGTGAGTGTGAGTCTGGGGG - Intergenic
1122082856 14:99278545-99278567 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1122140057 14:99657960-99657982 GTGTGTATGTATGTGTGTGAAGG - Intronic
1122237323 14:100339100-100339122 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1122280806 14:100621272-100621294 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1122280809 14:100621345-100621367 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1122419467 14:101566280-101566302 GTGTGTGCATATGTGTATGTGGG + Intergenic
1122671012 14:103372101-103372123 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1122674610 14:103400967-103400989 GTGTGTGTGTGTGTGTATGCAGG + Intronic
1122796039 14:104206767-104206789 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1122979932 14:105186819-105186841 GTGTGTGTGTGTGAGTGTGGGGG + Intergenic
1122979979 14:105187028-105187050 GTGTGTGGGTATGTGTGTGGGGG + Intergenic
1123054515 14:105562679-105562701 GTGAGTGAGTGTGTGTGTGAGGG + Intergenic
1123054592 14:105563136-105563158 GTGTGTGAGGGTGTGTATGAGGG + Intergenic
1123054652 14:105563519-105563541 GTGTGTGGGTGTGTGTATGAGGG + Intergenic
1123457777 15:20441493-20441515 GAGTGTGAGGATGCATATGAGGG - Intergenic
1123457825 15:20442065-20442087 GTGTGTGAGGGTGAGCACGAGGG - Intergenic
1123660244 15:22558344-22558366 GTGTGTGAGGGTGAGCACGAGGG + Intergenic
1123660292 15:22558922-22558944 GAGTGTGAGGATGCATATGAGGG + Intergenic
1123687272 15:22807786-22807808 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1123989043 15:25669702-25669724 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1124157652 15:27241244-27241266 TTGTGTCAGTGTGAGTGTGAGGG + Intronic
1124263924 15:28216645-28216667 GAGTGTGAGGATGCATATGAGGG - Intronic
1124263971 15:28217232-28217254 GTGTGTGAGGGTGAGCATGAGGG - Intronic
1124314102 15:28652835-28652857 GTGTGTGAGGGTGAGCACGAGGG + Intergenic
1124314150 15:28653413-28653435 GAGTGTGAGGATGCATATGAGGG + Intergenic
1124342987 15:28901926-28901948 GTGTGTGTGTGTGTGTATGTTGG + Intronic
1124361403 15:29039141-29039163 GTGTGTGTGTGTGTGTATCAGGG + Intronic
1124630703 15:31335461-31335483 GTGTGTGTGTGTGTGTATGGTGG + Intronic
1124807613 15:32901740-32901762 GTGTGTGTGTATGAGAGAGAGGG - Intronic
1124824674 15:33082039-33082061 GTGTGTGTGTGTGTGTAAGACGG + Intronic
1124928131 15:34092258-34092280 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1124968735 15:34462996-34463018 TTGTGTGTGTATGTGTGTGACGG - Intergenic
1125029602 15:35063083-35063105 GTGTGTGTGTATGTGTGTGACGG + Intergenic
1125383095 15:39108317-39108339 GTGTGTGTGTGTGTGTATGCAGG + Intergenic
1125429212 15:39579606-39579628 GTGTGTGTGTGTGTGTATTACGG - Intergenic
1125521590 15:40350839-40350861 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1125916888 15:43495492-43495514 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1125968064 15:43890139-43890161 CTGTGTGTGTATGAGATTGATGG - Intronic
1126061669 15:44788853-44788875 GTGTGTGTGTCTGATTGTGATGG - Intergenic
1126107054 15:45153532-45153554 GTGTGTGTGTGTGTGTATAATGG + Intronic
1126125384 15:45290838-45290860 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1126338312 15:47611142-47611164 GTGTGTGTGTGTGTGTATGTAGG - Intronic
1126455665 15:48859325-48859347 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1126536796 15:49775078-49775100 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1126897168 15:53271577-53271599 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
1127230259 15:56984276-56984298 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1127453771 15:59140072-59140094 GTGTGTGTGTGTGTGTATGGGGG + Intronic
1127498804 15:59537134-59537156 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1127568746 15:60219710-60219732 GTGTGTGTGTGTGTGTATGCAGG - Intergenic
1127615736 15:60683635-60683657 GTGTGTGTGTATGTGTATCTGGG - Intronic
1127633975 15:60851734-60851756 GTGTGTGTGTATGAGTGAGTGGG + Intronic
1127761945 15:62148121-62148143 GTGTGTGTGTATGTGTGTGGAGG + Intergenic
1127810722 15:62562903-62562925 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1127829962 15:62742057-62742079 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1128078472 15:64842440-64842462 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1128078481 15:64842499-64842521 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1128086293 15:64888872-64888894 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1128406676 15:67348352-67348374 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1128556200 15:68633508-68633530 GTGTGTGTGTGTGTGTATGTTGG - Intronic
1128585259 15:68843877-68843899 GTGTGTGTGTATGTGTGTGGGGG - Intronic
1128912893 15:71532314-71532336 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1128949916 15:71867795-71867817 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1129222828 15:74143011-74143033 GTGTGTGAGTATGTGTGTGATGG + Intergenic
1129235936 15:74223717-74223739 GTGTGTGTGTGTGTGTATGCTGG - Intergenic
1129245054 15:74274247-74274269 GTGTTTGAGTATGAGGTTGGGGG + Intronic
1129270375 15:74416344-74416366 GCGTGTGAGCGTGTGTATGATGG - Intronic
1129595184 15:76958244-76958266 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1129747368 15:78033253-78033275 GTGTGTGCGTATAAGTAAGGTGG - Intronic
1129856010 15:78825785-78825807 GTGTGTGTGTGTGTGTTTGATGG - Intronic
1129941551 15:79501408-79501430 GTGTTTCAGTCTGAGTCTGAAGG - Intergenic
1129998146 15:80024585-80024607 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1130185358 15:81675779-81675801 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
1130501578 15:84503294-84503316 GTGTGTGAGTGTGTGCATGTGGG + Intergenic
1130664098 15:85854637-85854659 GTGTGTGTTTGTGTGTATGAAGG + Intergenic
1130681760 15:86003064-86003086 GTGTGTGTGTATGTGTGTGGGGG + Intergenic
1130710606 15:86277324-86277346 GTGTGTGTGTGTGTGTATGTTGG + Intronic
1130758330 15:86790337-86790359 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1131599246 15:93829962-93829984 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1131775276 15:95788792-95788814 GTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1131784843 15:95901313-95901335 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1131817920 15:96242010-96242032 GTGTGTGTGTGTGTGTATCAAGG - Intergenic
1131943118 15:97589125-97589147 GAGTGTGATTATGAGGAAGAGGG + Intergenic
1132060506 15:98688434-98688456 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1132092879 15:98959994-98960016 GTGTGTGTGTGTGAGAGTGATGG + Exonic
1132302722 15:100786466-100786488 GTGTGGGTGTGTGAGTATGCAGG + Intergenic
1132302723 15:100786490-100786512 GTGTGTGTGTGTGAGCATGCAGG + Intergenic
1132306821 15:100821035-100821057 GTGTGTGAGTGTGTGTGTGTGGG - Intergenic
1132447648 15:101940425-101940447 GTGTGTGTGTGTGTGTAAGAGGG - Intergenic
1132938521 16:2494999-2495021 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1133039222 16:3051203-3051225 GTGTGTGTGTATGTGTGTGGGGG + Intronic
1133535053 16:6693725-6693747 GTGGATGAGGATGAGGATGATGG - Intronic
1133562784 16:6965345-6965367 GTGTGTGTGTGTGTGTATGATGG + Intronic
1133569704 16:7028581-7028603 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1133638923 16:7698200-7698222 GTGTGTGTGTGTGTGTATAAAGG + Intronic
1133850111 16:9495522-9495544 TGGTGTGAGTCTGAGTCTGAAGG - Intergenic
1133908192 16:10040563-10040585 GTGTGTGTGTGTGAATATGTGGG - Intronic
1134395334 16:13857484-13857506 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
1134832200 16:17332555-17332577 GTGTGTGTGTATGTGTGTGATGG - Intronic
1135534046 16:23279079-23279101 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1135781849 16:25310049-25310071 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1135845415 16:25914091-25914113 ATGTGTGTGTATGTGTATGTAGG + Intronic
1135990089 16:27213247-27213269 GTGTGTGTGTGTGTGTAAGATGG + Intronic
1136026477 16:27472074-27472096 GTGTGTGAGTGTGTGTATCAGGG + Intronic
1136114955 16:28088785-28088807 GTGTGTGAGTGTGTGTGTGTGGG - Intergenic
1136381497 16:29898151-29898173 GTGTGGGAGTGGGAGTATGAGGG - Intronic
1136532824 16:30881389-30881411 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1136702299 16:32155443-32155465 GTGTGTGAGGGTGAGCACGAGGG - Intergenic
1136706319 16:32190724-32190746 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1136761590 16:32738687-32738709 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1136765367 16:32772045-32772067 GTGTGTGAGGGTGAGCACGAGGG + Intergenic
1136802732 16:33098339-33098361 GTGTGTGAGGGTGAGCACGAGGG - Intergenic
1136806512 16:33131703-33131725 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1137490847 16:48931359-48931381 GTGTGTGAGTGTGGGTGTGTGGG - Intergenic
1137561620 16:49506058-49506080 GTGTGTGTGTATGTGTGTGTAGG + Intronic
1137811937 16:51360620-51360642 GTGTGTGTGTGTGTGTCTGAAGG - Intergenic
1138009121 16:53361615-53361637 GTGTGTGTGTGTGTGTATTATGG - Intergenic
1138218767 16:55231170-55231192 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1138492173 16:57383082-57383104 GGGGGTGGGTATGAGGATGAGGG - Exonic
1138587067 16:57977577-57977599 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1138602164 16:58062423-58062445 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1138936334 16:61729298-61729320 GTGTGTGTATGTGTGTATGAAGG + Intronic
1138969594 16:62128783-62128805 GTGTGTGTGTATGTGTAGGGAGG - Intergenic
1139060580 16:63245690-63245712 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1139067688 16:63338381-63338403 TTGTTTGAGTATGTTTATGAAGG - Intergenic
1139331766 16:66197892-66197914 GTGTTTGAATGTGTGTATGATGG + Intergenic
1139350671 16:66333101-66333123 GAGTGTGAGCATGTGTGTGAGGG - Intergenic
1139404057 16:66704386-66704408 GTGTGTGTGTGTGTGTAGGAGGG - Intergenic
1140242487 16:73215889-73215911 GTGCGTGTGTATGTGTATGCTGG + Intergenic
1140249865 16:73286685-73286707 GTGTGTGAGTGTGAGTGTGTGGG + Intergenic
1140268891 16:73445306-73445328 GTGTGTGTGTATATGTATGGGGG + Intergenic
1140357291 16:74317318-74317340 CTGTGTAAGTATGATTGTGATGG + Intergenic
1140803211 16:78508010-78508032 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1140895247 16:79318944-79318966 GTGTGTGTGTGTGAGTTTCATGG - Intergenic
1140967604 16:79982361-79982383 GTGTGTGAGCATGCATGTGAAGG + Intergenic
1141233053 16:82188679-82188701 GTGTGTGTGTGTGTGTCTGAGGG + Intergenic
1141492502 16:84383741-84383763 GTGTGTGTGTATGTGTGTGTTGG + Intronic
1141618996 16:85226799-85226821 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1141783348 16:86180288-86180310 GTGTGTGAATGTGTGTATGCAGG - Intergenic
1141791840 16:86242387-86242409 GTGAGTGAGTCTGAGCATGGGGG - Intergenic
1141940228 16:87271093-87271115 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1142106371 16:88305215-88305237 GTGTGTGTGCATGTGTGTGAGGG - Intergenic
1142106392 16:88305507-88305529 GTGTGTGTGCATGTGTGTGAGGG - Intergenic
1203063745 16_KI270728v1_random:999000-999022 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1203067755 16_KI270728v1_random:1034274-1034296 GTGTGTGAGGGTGAGCACGAGGG + Intergenic
1142535173 17:610124-610146 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1142639140 17:1275490-1275512 GTGTGTGAGTGTGTGTGTGAGGG + Intergenic
1142738081 17:1914229-1914251 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1142844494 17:2662406-2662428 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1143255547 17:5555014-5555036 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1143315997 17:6033922-6033944 GTGTGTGTGTGTGTGTATGGTGG + Intronic
1143319368 17:6058104-6058126 GTGTGTGTGTATGTGTGTGCAGG + Intronic
1143442344 17:6984949-6984971 GTGTGTGTGTATGATTTTGATGG - Intronic
1143470931 17:7174606-7174628 GTGTGTGTGTGTGTGTATGGGGG - Intronic
1143471067 17:7176325-7176347 GTGTGAGAGTGTGAGAATGAGGG - Intronic
1143471073 17:7176424-7176446 GTGTGAGAGTGTGAGAATGACGG - Intronic
1143848616 17:9792427-9792449 GTGTGTGTGTGTGCGTATGTGGG + Intronic
1144307472 17:13982299-13982321 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1144310939 17:14013837-14013859 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1145026584 17:19472237-19472259 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1145197141 17:20903905-20903927 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1145273998 17:21419314-21419336 GTGTGTGTGTGTGTGTATGCAGG + Exonic
1145293688 17:21571757-21571779 GTGTGTGTGTCTGTGTATAAAGG - Intronic
1145953029 17:28835048-28835070 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1146049127 17:29534949-29534971 GTGTGTGTGTGTGTGTATTAGGG + Intronic
1146449714 17:32963110-32963132 GTGTGTGTGTGTGTGTATGGAGG + Intergenic
1146519654 17:33516414-33516436 GTGTGTGTGTGTGTGTATGGAGG + Intronic
1146560801 17:33868201-33868223 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1146669931 17:34730147-34730169 GTGTGTGTGTGTGTGTATGGAGG - Intergenic
1146680929 17:34807638-34807660 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1146710948 17:35040876-35040898 GTGTGTGTGTGTGTGTGTGAGGG + Intronic
1147173021 17:38632477-38632499 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1147405073 17:40205611-40205633 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1147490783 17:40863947-40863969 GTGTGTGTGTGTGTGTAGGAAGG - Intronic
1147582180 17:41633706-41633728 GTTTGTGTGTATGTGTGTGATGG + Intergenic
1147650160 17:42057522-42057544 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1147920404 17:43913275-43913297 GTCTATGAGTGTGTGTATGAGGG - Intergenic
1148029168 17:44608196-44608218 GTGTGTGGGGATGAGTGTGGAGG - Intergenic
1148253342 17:46105862-46105884 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1148325140 17:46779050-46779072 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1148388054 17:47250385-47250407 GTGTGTATGTGTGTGTATGACGG + Intergenic
1148445486 17:47734601-47734623 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1148485580 17:47988680-47988702 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
1148624715 17:49060429-49060451 GTGTGTGAGTGTGCTGATGATGG + Intergenic
1148750586 17:49943650-49943672 GTGTGTGGGTATGTGTGTGTAGG + Intergenic
1148789785 17:50166724-50166746 GTGTGTGAGGGTGTGTGTGAGGG - Intronic
1148789838 17:50166982-50167004 GTCTGTGAGGATGTGTGTGAGGG - Intronic
1149137477 17:53386288-53386310 GTGTGTGTGTATATATATGATGG - Intergenic
1149287283 17:55178710-55178732 TAGTGTCAGTATGAGTCTGAAGG + Intergenic
1149316150 17:55440616-55440638 GTGTCTGAGCATGATTCTGAGGG - Intergenic
1149458700 17:56810188-56810210 GTGTGAGAGTGTGTGTGTGAAGG - Intronic
1149458703 17:56810223-56810245 GTGTGTGAGGATGTATGTGAGGG - Intronic
1149458737 17:56810456-56810478 GTGTGTGTGAATGTGTGTGAGGG - Intronic
1149571618 17:57676209-57676231 GCGTGTGAGTGTGTGTATGAGGG - Intronic
1149574086 17:57698923-57698945 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1149574095 17:57699057-57699079 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1149574104 17:57699185-57699207 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1149866795 17:60155492-60155514 GTGTGTGTGTGTGTGTATGCTGG - Intronic
1150469897 17:65428240-65428262 GTGTGTGTGTATATATATGATGG - Intergenic
1150996749 17:70327142-70327164 GTGTGTGTGTATGAGTTTCTGGG + Intergenic
1151174323 17:72274657-72274679 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1151243126 17:72773638-72773660 GTGTGTGTGTGTGTGTAAGATGG - Intronic
1151388712 17:73771263-73771285 GTGTGTGTGTATGTGTTTGTAGG + Intergenic
1151414703 17:73953527-73953549 GTGTGTGAATGTGAGTGTGTGGG - Intergenic
1151591180 17:75046085-75046107 GTGTGTGTGTGTGAGTGAGACGG + Intronic
1151613994 17:75196173-75196195 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1152371775 17:79892813-79892835 GTGTGTGAGTGTGTGTTTGGGGG + Intergenic
1152657115 17:81524890-81524912 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1153378491 18:4408954-4408976 GTGTGTGTGTGTGTGTATAATGG - Intronic
1153525447 18:5990787-5990809 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1153579601 18:6558959-6558981 GTGTGCGTGTATGTGTATGTGGG + Intronic
1153649389 18:7226230-7226252 GTGTGTGTGTATGTGTGTAATGG + Intergenic
1154024348 18:10693370-10693392 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1154035134 18:10793626-10793648 GTGTGTGAATATGTGTGTGTGGG + Intronic
1154069478 18:11140459-11140481 GTGTGTGGGAATGGGTATTAGGG - Intronic
1154070031 18:11145994-11146016 GAGTGTGAGTATGAGTGTGTAGG - Intronic
1154090461 18:11354881-11354903 GTGTATGTGTATGTGTATAATGG + Intergenic
1154333072 18:13445812-13445834 GTGTGTGTGTCTGTGTGTGAGGG + Intronic
1154351908 18:13590310-13590332 GTGTGTTGGTATGTGTATGTGGG + Intronic
1154367961 18:13728338-13728360 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1154928630 18:20967714-20967736 GTGTATGGATATGAGTGTGAAGG - Intronic
1155150550 18:23119363-23119385 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1155387635 18:25297118-25297140 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1155393013 18:25356072-25356094 GAGTGTGGTTATGAGTATGCAGG - Intergenic
1155501036 18:26487080-26487102 GTGTGTGTGTCTGAGTATGGAGG - Intronic
1155511204 18:26579262-26579284 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1155701880 18:28755165-28755187 GTGTGTGTGTGTGTGTAAGATGG + Intergenic
1155708465 18:28846263-28846285 GTGTGTGTGTGTGTGTCTGAAGG - Intergenic
1156035036 18:32756400-32756422 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1156194722 18:34761123-34761145 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1156299169 18:35820579-35820601 GTGTGTGTGCATGAGCATGTTGG + Intergenic
1156499446 18:37548069-37548091 GTATGTGCGTATCTGTATGAGGG + Intronic
1156523666 18:37745391-37745413 GTGTGTGAGTGTGTGTATTTAGG + Intergenic
1156691336 18:39710489-39710511 GTGTGTGTGTGTGTGTACGAAGG + Intergenic
1156718911 18:40046124-40046146 GTGTTTCAGTATGTGTATGTAGG + Intergenic
1156902311 18:42314333-42314355 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1156913281 18:42436666-42436688 GTGTGTGTGTATGGGTGTGTTGG + Intergenic
1157105939 18:44774385-44774407 GTGTGTGGGTGTGAGTGTGGGGG + Intronic
1157121100 18:44911926-44911948 GTGTGTGGGTGTGTGTATGCAGG - Intronic
1157311551 18:46556964-46556986 GTGGGTGAGTATGAGGGTGAGGG - Intronic
1157419840 18:47537711-47537733 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1157574579 18:48735099-48735121 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1157700918 18:49761278-49761300 GTGTGTGTGTGTGAGTGTGTGGG - Intergenic
1158082828 18:53614480-53614502 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1158123552 18:54077543-54077565 ATGTGTGAGTGTGTGTATGAGGG - Intergenic
1158185951 18:54771620-54771642 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1158331967 18:56372530-56372552 GTGTGTGTGTATGAGAGAGAGGG - Intergenic
1158864603 18:61626049-61626071 GTGTGTGTGTGTGTGTATGGAGG + Intergenic
1159067844 18:63589448-63589470 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1159166443 18:64707247-64707269 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1159516065 18:69459215-69459237 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1159556376 18:69949576-69949598 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1159903875 18:74073135-74073157 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
1160219805 18:76966330-76966352 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1160322206 18:77906175-77906197 GTGTGTGTGTGTGTGTATGCGGG - Intergenic
1160365504 18:78322150-78322172 GTGTGTGTGTTTGTGTATGTTGG - Intergenic
1160637623 19:92104-92126 GTGTGTGTGTGTGTGTAAGAGGG + Intergenic
1161181051 19:2882558-2882580 GTGTGTGTGAATGTGTGTGACGG + Exonic
1161202376 19:3022772-3022794 GTGTGTGGGTGTGTGTAGGATGG + Intronic
1161202539 19:3023885-3023907 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1161241655 19:3226437-3226459 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1161394163 19:4035973-4035995 ATGTGTGTGTGTGTGTATGACGG - Intronic
1161422387 19:4182981-4183003 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1161460284 19:4392515-4392537 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1161929110 19:7324199-7324221 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1162569736 19:11464580-11464602 GTGTGTGTGTATGTGTGTGTGGG - Intronic
1162617736 19:11815281-11815303 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1162718022 19:12646145-12646167 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1162776737 19:12984387-12984409 TGGTGTGTGTATGTGTATGATGG + Intergenic
1162777451 19:12988292-12988314 GTGTGTGTGTGTGTGTAGGAGGG + Intergenic
1162777997 19:12991272-12991294 GTGTGTGTGTCTGTGTATGAGGG - Intergenic
1162858241 19:13486230-13486252 GTGATTGAGGATGAGCATGAGGG + Intronic
1163246586 19:16099082-16099104 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1163406064 19:17123442-17123464 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1163477944 19:17537940-17537962 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1163637375 19:18443577-18443599 GTGTGTGAGTGTGCGTATGTGGG - Exonic
1163669631 19:18619970-18619992 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1163702220 19:18791583-18791605 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1164591899 19:29512016-29512038 GAGAGTGAGGATGAGGATGAAGG + Intergenic
1164859472 19:31551374-31551396 GTGTGTGTGTGTGTGTATGAAGG - Intergenic
1165744862 19:38224510-38224532 GTGTGTGAGTAGGAGTGTGTGGG - Intronic
1166214582 19:41326923-41326945 GTGTGTGTATATGTGTAAGACGG - Intronic
1166416475 19:42598195-42598217 GTGTGTGTGTGTGTGTATGATGG - Intronic
1166744156 19:45132190-45132212 GTGTGTGAGTGTGGGTCTCAAGG - Intronic
1167116127 19:47490007-47490029 GTGTGTGTGTGTGGGTATGGGGG + Intronic
1167203460 19:48084062-48084084 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1167277027 19:48545043-48545065 GAGTGTGAGTGTGAGTGTGCGGG + Intergenic
1167345311 19:48942010-48942032 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1167675914 19:50885392-50885414 GTGTGTGACTTTGACTTTGAAGG + Intergenic
1167681608 19:50926321-50926343 GTGTGTGTGTATGTGTGTGCTGG - Intergenic
1167716434 19:51145141-51145163 GTGTGTGTGCAAGAGTCTGAGGG - Intronic
1167907425 19:52673497-52673519 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1168050476 19:53826032-53826054 GTGTGTGTGTGTGTGTCTGAGGG - Intergenic
1168231419 19:55034706-55034728 GTGTGTGTGTGTAAGAATGAGGG - Intronic
1168249059 19:55130888-55130910 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1168328074 19:55548386-55548408 GTGTGTGTGTGTGTGTATGGGGG + Intergenic
1168566947 19:57433136-57433158 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1202686454 1_KI270712v1_random:54691-54713 GTGTGTGTGTGTGAGTGTGCTGG + Intergenic
925055181 2:851794-851816 GTGTGTGAGTGTGTGTGTGTAGG + Intergenic
925264418 2:2556528-2556550 GTGTGTGTGTATGTGTATTGAGG + Intergenic
925325780 2:3020877-3020899 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
925376983 2:3393498-3393520 GTGTGTGTGTATATGTGTGAGGG - Intronic
925530808 2:4860282-4860304 GTGTGTGAGTGTGGGTGTGGAGG - Intergenic
925825858 2:7847954-7847976 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
925855424 2:8124673-8124695 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
925914739 2:8596569-8596591 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
926147124 2:10403486-10403508 GTGTGTGTGTGTGTGTGTGACGG + Intronic
926271177 2:11367396-11367418 GTGTGTGGGTGTGAGTGTGGGGG - Intergenic
926591693 2:14746761-14746783 GTGTGTGTGTATGAGAGTGTAGG - Intergenic
926685371 2:15693973-15693995 GGTTGTGAGTATGAATATGTGGG + Intronic
926741300 2:16113845-16113867 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
926863237 2:17331228-17331250 GTGTATGTGTATGTGTATGGTGG - Intergenic
927011228 2:18906629-18906651 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
927011769 2:18911626-18911648 GTGTGTGAGTGTGTGTGTGTTGG + Intergenic
927011779 2:18911699-18911721 GTGTGTGAGTGTGTGTGTGTTGG + Intergenic
927029697 2:19107832-19107854 GTGTGTGTGTATGTGTGTCATGG - Intergenic
927100454 2:19783883-19783905 GTGTGTGTGTGTGTGTTTGAAGG - Intergenic
927198059 2:20561548-20561570 GTGTGTGTGTATGTGTGTGCAGG - Intronic
927735170 2:25514239-25514261 CCATGTGAGTATGAGGATGAGGG + Intronic
928254507 2:29710518-29710540 GTGTGTGTGTGTGTGTATGATGG + Intronic
928392294 2:30918927-30918949 GTGTGTGAGCCTGAGTCTGCCGG - Intronic
928395170 2:30938044-30938066 GTGTGTAAGTATGTGTGTGGTGG - Intronic
928937676 2:36696736-36696758 GTGTGTGTGTATGTGTGTGGGGG + Exonic
929010664 2:37440799-37440821 GTGTGTGTGTGTGTGTATGCCGG + Intergenic
929142068 2:38675571-38675593 GTGTGTGTGTGTGTGTGTGATGG + Intronic
929394648 2:41508727-41508749 GTGTGTGTGTATGATTCTAAAGG - Intergenic
929528048 2:42724633-42724655 GTGTGTGTGTGTGTGTGTGATGG - Intronic
929627589 2:43425470-43425492 GTGTGTGTGTGTGTGTGTGATGG + Intronic
929647939 2:43648583-43648605 GTGTGTGTGTGTGTGTGTGACGG + Intronic
929851657 2:45596985-45597007 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
929948031 2:46384958-46384980 GTGTGTGAGAAGGAGAAGGAGGG - Exonic
930153600 2:48082474-48082496 GTATGTGTGTGTGTGTATGATGG - Intergenic
930589600 2:53311775-53311797 GTGTGTGTGTATGAGAGAGAAGG - Intergenic
930656907 2:54015642-54015664 GTGTGTGTGTGTGTGTGTGACGG - Intronic
930880921 2:56269347-56269369 GTGTGTGTGTGTGTGTTTGAAGG + Intronic
931078669 2:58744534-58744556 GTGTGTGTGTATGTGTGTAAAGG + Intergenic
931093378 2:58911878-58911900 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
931168382 2:59775987-59776009 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
931500743 2:62863278-62863300 GTGTGTGTGTGTGTGTGTGACGG - Intronic
931586361 2:63833968-63833990 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
931648451 2:64447064-64447086 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
931706339 2:64949608-64949630 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
931901546 2:66794717-66794739 GTGTGTGTGTATGTGCTTGAGGG + Intergenic
931991668 2:67796683-67796705 GTGTGTGTGTATGTGCGTGATGG - Intergenic
931992589 2:67805690-67805712 GTGTGTGTGTTTGTGCATGAGGG - Intergenic
932129628 2:69176082-69176104 GTGTGTGTGTATGTGTGTGTGGG - Intronic
932163869 2:69488164-69488186 GTGTGTGTGTGTGTGTTTGAGGG + Intronic
932513095 2:72315343-72315365 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
932782093 2:74565822-74565844 GTGTGTGTGTGTGTGTGTGACGG - Intronic
932974976 2:76589036-76589058 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
933008722 2:77029028-77029050 GTGTGTGTGTGTGTGTGTGATGG - Intronic
933150689 2:78911318-78911340 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
933378323 2:81510281-81510303 GTGTGTGTTTGTGAGTCTGATGG - Intergenic
933429532 2:82157872-82157894 GTGTGTGTGTATGTGTCTGAAGG - Intergenic
933784919 2:85830999-85831021 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
933897355 2:86823993-86824015 GTGTGTGTGTGTGTGTATGCTGG + Intronic
934032529 2:88061197-88061219 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
934184986 2:89663773-89663795 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
934295255 2:91737886-91737908 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
934604231 2:95682142-95682164 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
934607200 2:95705276-95705298 GTGTGTGTGTGTGAGAAGGATGG - Intergenic
934914978 2:98294181-98294203 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
934918343 2:98319873-98319895 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
935189434 2:100764647-100764669 CAGTGTGAGTTTGAGTCTGAAGG - Intergenic
935329006 2:101962653-101962675 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
935366594 2:102298100-102298122 GTGTGTGAATATAGGAATGAGGG + Intergenic
935370095 2:102336338-102336360 TTGGGTGAGTGTGAGAATGAAGG + Intronic
935524929 2:104153831-104153853 GTGTGTGAATCTGAGCATGTGGG - Intergenic
935610634 2:105020945-105020967 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
935711509 2:105902943-105902965 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
935747410 2:106200810-106200832 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
935842444 2:107128209-107128231 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
935855685 2:107270488-107270510 GTGTGTGTGTGTGTGTATGACGG + Intergenic
935962500 2:108440679-108440701 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
936537623 2:113324376-113324398 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
936540597 2:113347437-113347459 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
936771043 2:115913762-115913784 GTGTGTGTGTTTGAGAATGAGGG + Intergenic
936792992 2:116171925-116171947 GTGTGTGTGTATGTGCATGTGGG + Intergenic
936845277 2:116823450-116823472 GTGTGTGTGTGTAACTATGAAGG + Intergenic
937076031 2:119107590-119107612 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
937149786 2:119678699-119678721 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
937239271 2:120449931-120449953 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
937326409 2:120992001-120992023 GTGTGTGTGTGTGTGTATGGTGG - Exonic
937865691 2:126749815-126749837 GTTTGGGATTATCAGTATGATGG + Intergenic
937894608 2:126969220-126969242 GTGTGTGTGTGTGAGTACGTAGG - Intergenic
937904137 2:127043988-127044010 ATGTGTGAATGTGAGTGTGAAGG - Intergenic
937904149 2:127044263-127044285 GTGTGTGAATGTGAGTGTGAAGG - Intergenic
937974644 2:127574946-127574968 GTGTGTGTGTGTGAGTGTAAGGG + Intronic
937982506 2:127623788-127623810 GTGTGTGAGTCTGAGGGTGTGGG - Intronic
938090356 2:128427319-128427341 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
938106267 2:128532420-128532442 GTGTGTGTGTGTGTGTATGGGGG - Intergenic
938271755 2:129978219-129978241 GTGGGTGAGTATGGGTGTGCAGG + Intergenic
938274392 2:130005092-130005114 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
938440988 2:131332186-131332208 GTGTGTGTGTATGTGTGTGTTGG - Intronic
938444248 2:131365589-131365611 GTGGGTGAGTATGGGTGTGCAGG - Intergenic
938479170 2:131645723-131645745 GTGTTTGTGTATGTGTGTGACGG - Intergenic
939042788 2:137211325-137211347 GTGTGTGTGTGTGTGTAGGAAGG - Intronic
939184846 2:138848243-138848265 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
939224178 2:139344294-139344316 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
939392400 2:141585451-141585473 GTGTGTGTGTGTGTGTGTGATGG + Intronic
939415167 2:141886921-141886943 GTGTGTGTGTATGTGTGTGAGGG + Intronic
939626898 2:144488685-144488707 GTGTGTGTGTGTGTGTGTGATGG + Intronic
939636068 2:144583992-144584014 GTGTGTGCGAATGTGTATGTAGG + Intergenic
939735423 2:145838617-145838639 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
939743566 2:145940321-145940343 AAGTATGAGTATGAGTATCAAGG - Intergenic
939855181 2:147350025-147350047 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
940035993 2:149312502-149312524 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
940182399 2:150949617-150949639 GTGTGTGAATATAAATGTGAAGG - Intergenic
940204227 2:151184984-151185006 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
940204630 2:151189241-151189263 GTGTGTGTGTGTGTGTATGGTGG - Intergenic
940359271 2:152780180-152780202 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
940394005 2:153166653-153166675 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
940617821 2:156072701-156072723 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
940795661 2:158074684-158074706 GTGTGTGTGTGTGTGTATGAAGG - Intronic
941417533 2:165240677-165240699 GTGTGTGTGTGTGTGTGTGATGG + Intronic
941770155 2:169336533-169336555 GTGTGTGTGTGTGTGTGTGATGG - Intronic
941812095 2:169765335-169765357 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
941905628 2:170714953-170714975 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
942149874 2:173064667-173064689 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
942271481 2:174280042-174280064 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
942346696 2:175010427-175010449 GTGTGTGTGTGTGGGTGTGAAGG + Intergenic
943301929 2:186213499-186213521 GTGTGTGTGTGTGTGTAGGAGGG - Intergenic
943341678 2:186689988-186690010 GTGTGTGTGTGTGTGTATGCAGG + Intergenic
943829895 2:192447267-192447289 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
944014564 2:195019562-195019584 GTGTGTGTGTGTGTGTATGGAGG - Intergenic
944185260 2:196940889-196940911 GTGTGTGTGTGTGAGTTTGTTGG - Intergenic
944194628 2:197039707-197039729 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
944238356 2:197461577-197461599 GTGTGTGTGTGTGTGTGTGAGGG + Intronic
944382081 2:199122718-199122740 GTGTGTGTGTGTGTGTATGGTGG - Intergenic
944733996 2:202544314-202544336 GTGTATTAGTATGTGTATGGTGG + Intronic
944940754 2:204623416-204623438 GGGTGTGGGTATGACTATAAAGG - Intronic
944960182 2:204863428-204863450 GTGTCTGACAATGAGAATGAGGG - Intronic
945352158 2:208793679-208793701 GCGTTTCAGTATGAGTCTGATGG + Intronic
945502070 2:210588723-210588745 ATGTGTGTGTATGTGTATGGAGG - Intronic
945502754 2:210597819-210597841 GTGTGTGTGTATATATATGAAGG - Intronic
945812662 2:214567535-214567557 GTGTGTGTGTATGTGGATGAAGG - Intronic
945821195 2:214667981-214668003 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
945854427 2:215051630-215051652 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
945924176 2:215786918-215786940 GTGTGTGTGTGTGTGTATGCAGG + Intergenic
945939202 2:215931701-215931723 GTCTTTGAGTTTGAGTCTGAGGG - Intergenic
946044348 2:216809379-216809401 GTGTGTGAGCATGAGTGTGAGGG - Intergenic
946115357 2:217457001-217457023 GTGTGTGGGGGTGAGGATGAGGG - Intronic
946613439 2:221483518-221483540 GTGTGTGTGTGTGTGTGTGATGG + Intronic
946673904 2:222136709-222136731 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
947017860 2:225641416-225641438 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
947339696 2:229124983-229125005 GTGTGTGAGTGTGTGTCTGTTGG + Intronic
947400202 2:229724221-229724243 GTGTGTGTGTGTGATTATGTGGG - Intergenic
947441252 2:230123705-230123727 GTGTGTGTGTGTGTGTAAGATGG + Intergenic
947628085 2:231633674-231633696 GTGTGTGAGTGTGTGTGTGCAGG + Intergenic
947738340 2:232471385-232471407 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
947881481 2:233517810-233517832 GTGTGTGTGTGTGTGTATGATGG + Intronic
948121851 2:235536624-235536646 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
948126100 2:235565542-235565564 GTGTGTGAATGTTATTATGAAGG + Intronic
948218677 2:236252264-236252286 GTGTGTGTGTGTGTGTGTGACGG - Intronic
948585755 2:239018737-239018759 GTGTGTGTGTGTGAGTATATGGG - Intergenic
948637192 2:239346552-239346574 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
948674802 2:239590638-239590660 GTGTGTGTATATGTGTATGTGGG - Intergenic
1168826319 20:816747-816769 GTGTGTGTGTTTGTGTGTGACGG + Intergenic
1168891124 20:1295918-1295940 GTGTGTGGGTCTGAGTATCAGGG + Intronic
1169010103 20:2243441-2243463 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1169136453 20:3200621-3200643 GTGTGTGTGCATGAATATGTAGG + Intronic
1169264607 20:4160308-4160330 GTGTGTGCATATCAGTATGTGGG + Intronic
1169807058 20:9570466-9570488 GTGTGAGTGTGTGTGTATGATGG + Intronic
1169963714 20:11191627-11191649 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1170178342 20:13498361-13498383 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170461623 20:16581991-16582013 GTGTGTGTGTGTGTGTATGAGGG - Intergenic
1170605815 20:17874406-17874428 GGGTGTGTGTATGAGTGTGTGGG - Intergenic
1170610750 20:17910858-17910880 GTGAGTGTGTGTGTGTATGACGG - Intergenic
1170901178 20:20465146-20465168 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1171093851 20:22312492-22312514 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1171202801 20:23255540-23255562 GTCTGTGTGTGTGTGTATGATGG + Intergenic
1171290482 20:23980130-23980152 GTGTGTGAGTGTGAGTATGGGGG - Intergenic
1171290499 20:23980289-23980311 GTATGTGAGTGTGAGTGTGGGGG - Intergenic
1171290505 20:23980321-23980343 TTGTGTGTGTATGAGTGTGTGGG - Intergenic
1171320868 20:24242885-24242907 GTGTGTGTGTGTGTGCATGAGGG - Intergenic
1171468537 20:25350956-25350978 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1171953395 20:31440999-31441021 GTGTGTGAGGAGGAGTGGGAGGG + Intronic
1172040848 20:32044398-32044420 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1172226498 20:33308519-33308541 GTGTGTATGTATGTGTATAAAGG - Intronic
1172226501 20:33308597-33308619 GTGTGTATGTATGTGTATAAAGG - Intronic
1172226504 20:33308675-33308697 GTGTGTATGTATGTGTATAAAGG - Intronic
1172256322 20:33520967-33520989 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1172305654 20:33878433-33878455 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1172361215 20:34313803-34313825 GTGAATGAGTATGTGTTTGAAGG - Intergenic
1172594840 20:36143726-36143748 GTGTGTGTGTATGTGTGTGCAGG + Intronic
1172958135 20:38776931-38776953 GTGTGTGTGTGTGTGTATGGTGG + Intergenic
1173004640 20:39130510-39130532 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1173418977 20:42883833-42883855 GTGTGTGTCTATGTGTATGGGGG - Intronic
1173418986 20:42883891-42883913 GTGTGTGTGTGTGTGTATGGGGG - Intronic
1173489316 20:43466925-43466947 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1173547403 20:43909418-43909440 GTGTGTGTGTGTGTGTAGGAAGG + Intergenic
1173551315 20:43934810-43934832 GTGTGTGTGTGTGTGTATGTGGG + Intronic
1173723834 20:45283029-45283051 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1173904671 20:46617614-46617636 GTGTGTGTGTGTGTGTATTAAGG + Intronic
1173941712 20:46916382-46916404 GTGTGTGAGTATATGAATGTGGG + Intronic
1173941714 20:46916462-46916484 GTGTGTGTATCTGAGTATGAAGG + Intronic
1174056405 20:47801391-47801413 GTGTGTGAGAGTGTGTATGTTGG + Intergenic
1174091230 20:48049866-48049888 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1174106213 20:48164233-48164255 GAGTGTGAGTGTGCGTGTGAGGG - Intergenic
1174372173 20:50098394-50098416 CTGTGTGAGGATGAGAGTGAAGG + Intronic
1174654627 20:52160374-52160396 CTGTGTGTGTATGTGTTTGAAGG - Exonic
1174758548 20:53183574-53183596 GTGTGTGTGGTTGTGTATGAAGG - Intronic
1175024038 20:55882632-55882654 GTGTGTGTGTATGCATATGTAGG - Intergenic
1175171311 20:57083343-57083365 GTGTGTGCGTATGTGTATGTGGG + Intergenic
1175434160 20:58930858-58930880 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1175518475 20:59584300-59584322 GTGTGTGACTGTGTGTGTGAGGG + Intronic
1175687472 20:61041934-61041956 GTGTGTGAGTGTGTGTGTGTAGG - Intergenic
1176837844 21:13810284-13810306 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1176956208 21:15107013-15107035 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1176960725 21:15155796-15155818 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1177020570 21:15851497-15851519 GTGTGTGTGTGTGTGTATGGGGG - Intronic
1177240488 21:18449852-18449874 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
1177412710 21:20750911-20750933 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1177948552 21:27503964-27503986 GTGTGTGTGTGTGTGTATTATGG - Intergenic
1178048412 21:28721897-28721919 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1178388998 21:32183137-32183159 GTGTGTGAGTACAAGTGTGTGGG - Intergenic
1178607729 21:34054393-34054415 GTGTGTGTGTATGTGTGTGTAGG + Intergenic
1178717781 21:34982400-34982422 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1178727120 21:35063452-35063474 GTGTGTGTGTCTGAGTTTGTGGG - Intronic
1178750479 21:35297723-35297745 GTGTGTGTGCATGTGTGTGAGGG - Intronic
1178823153 21:35993185-35993207 GTGTGTGAGTTGGGGTATGTGGG - Intronic
1179046064 21:37846387-37846409 GTGTGTGTGTGTGTGTGTGAGGG + Intronic
1179117154 21:38504008-38504030 GTGTGTGAGTGTGTGTATGAGGG + Intronic
1179176686 21:39012655-39012677 GTGCGTGAGTGTGTGTGTGAGGG - Intergenic
1179304067 21:40139070-40139092 GTGTGTATGCATGAGTATGTGGG + Intronic
1179333513 21:40428272-40428294 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1179341608 21:40516115-40516137 GTGTGTGTGTGTGTGTATGGTGG - Intronic
1179393211 21:41012594-41012616 GTGTGAGAGTATGTGTTTGAGGG - Intergenic
1179642993 21:42759409-42759431 GTGTGTGAGAGTGAGTATGGGGG + Intronic
1179772435 21:43632220-43632242 GTGTGTGAGCCTGTGTATGTGGG - Intronic
1179966698 21:44811033-44811055 GTGTGTGCGTGTGTGTATGTGGG - Intronic
1179975982 21:44866587-44866609 GTGTGTGTGTATGTGTGTTATGG - Intronic
1180071350 21:45437725-45437747 GTGTGTGAGTGTGTGTGTGCAGG - Intronic
1180071361 21:45437961-45437983 GTGTGTGAGTGTGTGTGTGCAGG - Intronic
1180071370 21:45438163-45438185 GAGTGTGAGTGTGTGTATGCAGG - Intronic
1180071372 21:45438203-45438225 GTGTGTGAGTGTGTGTGTGCAGG - Intronic
1180451996 22:15472109-15472131 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1180462938 22:15583293-15583315 GTGGGTGAGTATGGGTGTGCGGG + Intergenic
1180766935 22:18350853-18350875 GTGTGTGAGTGTGGGTGTGTGGG + Intergenic
1180766939 22:18350885-18350907 ATGTGTGAGTGTGAGTATGGGGG + Intergenic
1180779379 22:18511526-18511548 GTGTGTGAGTGTGGGTGTGTGGG - Intergenic
1180812090 22:18768814-18768836 ATGTGTGAGTGTGAGTATGGGGG - Intergenic
1180812094 22:18768846-18768868 GTGTGTGAGTGTGGGTGTGTGGG - Intergenic
1180816665 22:18793614-18793636 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1180849460 22:19007489-19007511 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1180863850 22:19104645-19104667 GTGTGGGAGTCTGTGTCTGATGG - Intronic
1180972722 22:19823840-19823862 GCGTGTGTGTATGTGTATGTAGG - Intronic
1181198249 22:21203061-21203083 ATGTGTGAGTGTGAGTATGGGGG - Intergenic
1181198253 22:21203093-21203115 GTGTGTGAGTGTGGGTGTGTGGG - Intergenic
1181202857 22:21227946-21227968 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1181401480 22:22652564-22652586 GTATGTGAGTGTGAGTGTGTGGG + Intergenic
1181401500 22:22652741-22652763 GTGTGTGAGTGTGAGTATGGGGG + Intergenic
1181410257 22:22713439-22713461 TTGTGTGAGTTAGAGAATGAAGG + Intergenic
1181601462 22:23954240-23954262 GTGTGTGAGTGTAAGTGTGCAGG - Intergenic
1181607044 22:23987097-23987119 GTGTGTGAGTGTAAGTGTGCAGG + Intergenic
1181607311 22:23988502-23988524 GTGTGTGAGTAGGATGTTGAGGG - Intergenic
1181703462 22:24633842-24633864 GTGTGTGAGTGTGAGTATGGGGG + Intergenic
1181868183 22:25876036-25876058 GTGTGTGTGTATGTGTTTTAAGG + Intronic
1182294238 22:29303793-29303815 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1182413121 22:30203970-30203992 GTGTGTGTGCATGTGTGTGAAGG - Intergenic
1182641517 22:31771712-31771734 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1182712941 22:32333868-32333890 GTGTGTGTGTATGTGTATTGTGG - Intergenic
1182918105 22:34054081-34054103 TTGTGAGAGAATGAGAATGAGGG - Intergenic
1182931814 22:34181572-34181594 GTGTGTGTGTATGCGTGTGATGG + Intergenic
1183310883 22:37109007-37109029 GTGTGTGTGTCTGTGTAGGAAGG - Intronic
1183614860 22:38937806-38937828 GTGTGTGAGTGTGTGTATGTGGG + Intergenic
1183659033 22:39207515-39207537 GTGTGTGTGTGTGTGTAGGAAGG - Intergenic
1183749088 22:39709153-39709175 GTGTGTGGGTCTGAGTAGGCTGG + Intergenic
1184326316 22:43789844-43789866 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1184496116 22:44842597-44842619 GTGAGTGAGTGTTAGGATGAGGG - Intronic
1184679722 22:46063798-46063820 CTATGTGTGTATGAGTATGAAGG + Intronic
1184914942 22:47562949-47562971 GTGTGTGTGTATGTGTGTGTAGG + Intergenic
1185143005 22:49113778-49113800 GTGTGTGAGCGTGAGTGTGTGGG - Intergenic
1185316152 22:50180037-50180059 GTGTGTGAGTGTGAGCAGGCGGG + Exonic
1203224063 22_KI270731v1_random:67467-67489 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1203228554 22_KI270731v1_random:91744-91766 GTGTGTGAGTGTGGGTGTGTGGG + Intergenic
1203228558 22_KI270731v1_random:91776-91798 ATGTGTGAGTGTGAGTATGGGGG + Intergenic
1203266765 22_KI270734v1_random:19325-19347 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
949331025 3:2922346-2922368 GTGTTTGAGGATGAGAATAAAGG + Intronic
950009776 3:9714837-9714859 GTGTGTGGTTAAGTGTATGAGGG + Intronic
950166897 3:10807915-10807937 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
950325635 3:12107021-12107043 GTGTGTGTGTGTGTGTTTGAGGG + Intronic
950468040 3:13167091-13167113 GTGTGTGCCTATGATTATGGCGG + Intergenic
950502647 3:13374072-13374094 GTAAGTGAGCATGAGTGTGAGGG - Intronic
950510884 3:13425864-13425886 GTGTGTGTGTATGTGTGTGGCGG - Intergenic
950545700 3:13636788-13636810 ATGTGTGTGTATGAGGAAGAGGG - Intronic
950685306 3:14613343-14613365 GTGTGTGTGTGTGTGTATCAGGG + Intergenic
950764755 3:15265509-15265531 GTGTGTGTGTGTGTGTGTGACGG - Intronic
951150523 3:19284535-19284557 GTGTGTGTGTGTGTGTGTGAGGG + Intronic
951394076 3:22143085-22143107 GTGTGTGTGTGTGTGTGTGACGG + Intronic
951569621 3:24048308-24048330 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
951595834 3:24317161-24317183 GTCTGTAAGTATGAGTTTGTGGG + Intronic
951882888 3:27496662-27496684 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
951918733 3:27829884-27829906 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
952110083 3:30112599-30112621 GTGTGTGTGTGTGAGTCTAAGGG - Intergenic
952150914 3:30589990-30590012 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
952253838 3:31678816-31678838 GTGTGTGTGTGTGTGTAGGAGGG + Intronic
952470542 3:33645923-33645945 GTGTGTGTGTGTGTGTATGCTGG - Intronic
952531400 3:34265753-34265775 GTGTGTGAGAATGTTGATGATGG - Intergenic
952760859 3:36913044-36913066 GTGTGTGTGTGTGTGTGTGATGG + Intronic
953031508 3:39182992-39183014 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
953070497 3:39515000-39515022 GTGTGTGTGTGTGTGTATGTTGG + Exonic
953364727 3:42334091-42334113 CTGTGTGTGTATGTTTATGAAGG - Intergenic
954424284 3:50435137-50435159 GTGTGTGTGTGTGTGTGTGAGGG + Intronic
954895978 3:53975038-53975060 GTGTGTGTGTGTGCGTAGGAAGG - Intergenic
954923951 3:54216139-54216161 GTGTGTGTGTGTGTGTATGGTGG + Intronic
954968459 3:54631197-54631219 GTGTGTGTGTGTGTGTTTGATGG - Intronic
955410060 3:58649487-58649509 GTGTGTATGTATGTGTGTGAAGG - Intronic
955470299 3:59279630-59279652 GTGTGTGTGTTTGTGTGTGATGG + Intergenic
955544103 3:60009215-60009237 GTGTGTGTGTGTGTGTATGGTGG + Intronic
955904666 3:63794160-63794182 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
955914417 3:63892464-63892486 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
955919474 3:63940282-63940304 GTGTGTGTGTGTGTGTGTGATGG - Intronic
956170471 3:66429792-66429814 GTGTGTGTGTGTGTGTGTGAGGG + Intronic
956214158 3:66831218-66831240 GTGTGAGAGTATAAGAATCAAGG + Intergenic
956454859 3:69410396-69410418 GTGTGTGAGTATGAGTATGAGGG + Intronic
956524552 3:70143370-70143392 GTGTGTGTGTGTGTGTATAATGG + Intergenic
956571479 3:70701369-70701391 GTGTGTATGTATGTGTATGGGGG + Intergenic
956744515 3:72300914-72300936 GTGTGTGTGTGTGTGTATGTCGG + Intergenic
956861811 3:73331634-73331656 GTGTGTGTGTATATATATGATGG - Intergenic
957124932 3:76146861-76146883 GTGTGTGAGTGTGTGTGTGGTGG - Intronic
957825972 3:85444434-85444456 GTGTGTGTGTGTGAGTGTGTAGG - Intronic
958043518 3:88254711-88254733 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
958574679 3:95933464-95933486 GTGTGTGCGTGTGTGTATGTGGG + Intergenic
958846082 3:99266420-99266442 GTGTGTGTGTATGACTTTAATGG + Intergenic
959143968 3:102522088-102522110 GTGTTTGTGTGTGTGTATGATGG + Intergenic
959212319 3:103401943-103401965 GTGTTTGTGTGTGTGTATGATGG + Intergenic
959265582 3:104133316-104133338 ATGTGTGTGTATGTGTATAAAGG - Intergenic
959359971 3:105376069-105376091 GTGTGTGAGTTTGTGTGTGTTGG + Intronic
959360698 3:105387231-105387253 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
960284478 3:115811576-115811598 GTGTGTGTGTAAAACTATGATGG + Intronic
960476190 3:118131563-118131585 GTGTGTGTGTGTGAGTGAGAGGG - Intergenic
960480412 3:118180968-118180990 GTGTGTGTGTGTGTGTATGCAGG - Intergenic
960503506 3:118465730-118465752 GTGTGTGTGTGTGTGTATGGAGG - Intergenic
960631898 3:119740857-119740879 GTGTGTGTGTGTGTGTGTGATGG + Intronic
961002818 3:123385336-123385358 GTGTGTGGCTGTGAGTATGTGGG + Intronic
961350140 3:126294858-126294880 GTGTGTGTGTGTGTGTATGGAGG - Intergenic
961781251 3:129321659-129321681 GTATGTGAGGATGTGTGTGAAGG - Intergenic
961805174 3:129484029-129484051 GTGTGTGAGTACGTGTGTGATGG + Intronic
961814334 3:129541221-129541243 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
961848697 3:129793160-129793182 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
961849728 3:129803774-129803796 TTGTGTGATTATGAGTAATAAGG - Intronic
962037414 3:131667447-131667469 GTGTGTGAGTGTGTATGTGACGG + Intronic
962054906 3:131861432-131861454 GTGTGTGTGTGTGTGTGTGACGG + Intronic
962092854 3:132263303-132263325 GTGTGTGTGTGTGAGTGTGAGGG - Intronic
962133662 3:132709693-132709715 GTGTGTGTGTATGTGTAGAAGGG + Intronic
962270352 3:133973703-133973725 GTGTGGGAGGGTGAGGATGAAGG + Exonic
962341844 3:134592500-134592522 GTGTGTGTGTGTGTGTATGGAGG + Intergenic
962360468 3:134738243-134738265 GTGTGTGTGTGTGTGTATGATGG - Intronic
962463561 3:135636537-135636559 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
962907336 3:139816533-139816555 GTGTGTGTGTATGTGTGTGCAGG - Intergenic
963200937 3:142585215-142585237 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
963286402 3:143438440-143438462 GTGTGTGTGTATGTGTGTGGTGG + Intronic
963657940 3:148083331-148083353 GTGTGTGTGTGTGTGTATGGGGG - Intergenic
963957357 3:151269394-151269416 GTGTGTGTGTGTGTGTGTGATGG - Intronic
963980830 3:151534815-151534837 GTGTGTGTGTGTGTGTATGAAGG + Intergenic
964110441 3:153081979-153082001 GTGTGTGTGTGTGAGAATGATGG - Intergenic
964211886 3:154237535-154237557 GTGTGTGTGTGTGTGTGTGACGG - Intronic
964290504 3:155174362-155174384 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
964307781 3:155359216-155359238 GTGTGTGTGTGTGTGTATCAAGG - Intergenic
964749735 3:160043153-160043175 GTGGCTCAGTCTGAGTATGAAGG - Intergenic
965550762 3:169962748-169962770 GTGTTTGAGTAATAGTATGGAGG - Intergenic
965570047 3:170163486-170163508 GTGTGTGTGTGTGTGTGTGATGG + Intronic
965652742 3:170950647-170950669 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
965664614 3:171079747-171079769 GTGTGTGTGTGTGTGTATGAAGG + Intronic
965719111 3:171641719-171641741 ATGTGTGGGTAAGATTATGAGGG - Intronic
965867698 3:173225553-173225575 GTGTGTGTGTGTGAGTTTCAGGG + Intergenic
965871053 3:173265839-173265861 ATGTGTGTGTATGTGCATGAAGG - Intergenic
965912078 3:173790693-173790715 GTGTGTGTGTTTGTGTATTAAGG + Intronic
966240268 3:177748069-177748091 GTGTGTGTGGATGTGTAGGAGGG + Intergenic
966266248 3:178048038-178048060 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
966493468 3:180553629-180553651 GTGTGTGTGTTTGTGTGTGATGG - Intergenic
966542591 3:181108366-181108388 GTGTGCAAGTATGAGAATGAAGG - Intergenic
966544994 3:181136637-181136659 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
966836812 3:184055708-184055730 GTGTGTGTGTGTGTGTGTGATGG - Intronic
966846318 3:184133454-184133476 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
967185196 3:186938952-186938974 GTGTGTGTGTATGTGTGTGTAGG + Intronic
967315449 3:188148523-188148545 GTGTGTGTGTATGTGTGTGGTGG + Intergenic
967403102 3:189085459-189085481 GTGTGTGTGTGTGTGTATTATGG + Intronic
967563891 3:190951116-190951138 GTGTGTGTGTGTGTGTATAATGG - Intergenic
967592615 3:191296248-191296270 GTGTGTGAGTGTGTGTAAGTTGG - Intronic
967680608 3:192358474-192358496 GTGTGTGTGTGTGTGTATGTGGG + Intronic
967681812 3:192372388-192372410 GTGTGTGTGTGTGTGTGTGATGG - Intronic
968017506 3:195351468-195351490 GTGTGTGTGTGTGTGTGTGACGG + Intronic
968194459 3:196695087-196695109 GTGTGTGAGTGTGGGCATGCGGG - Intronic
968364223 3:198172982-198173004 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968364408 3:198173597-198173619 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968364491 3:198173866-198173888 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968364518 3:198173951-198173973 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968364564 3:198174096-198174118 GTGGGTGAGGGTGAGGATGAAGG + Intergenic
968845186 4:3037091-3037113 GTGTGTGTGTGTGAGAAAGAGGG + Intronic
968889793 4:3362377-3362399 GTGTGTGAGGATGTGTGTGAAGG + Intronic
968889832 4:3362623-3362645 GTGTGTGAATGTGAGAGTGAGGG + Intronic
968889857 4:3362793-3362815 GTGTGTGAATATGAGAGTGAGGG + Intronic
968889859 4:3362831-3362853 GAGTGTGAGACTGAGTGTGAGGG + Intronic
969427090 4:7130731-7130753 GTGTGTGTGTGTGAGTGTGTGGG + Intergenic
969514642 4:7639669-7639691 GTGTGTGAGTGTGAGGGTGTGGG + Intronic
969610285 4:8224176-8224198 GTGTGTGCATATGTGTGTGAGGG - Intronic
970273988 4:14377749-14377771 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
970376938 4:15468232-15468254 GTGTGTGTGTCTGTGTATGATGG - Intergenic
970544415 4:17112588-17112610 GTGTGTATGTATCAGTATGGTGG + Intergenic
970716631 4:18934213-18934235 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
971062548 4:22988960-22988982 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
971133110 4:23835498-23835520 GTGTGTGTGTTGGAGTATGTGGG + Intronic
971152557 4:24049146-24049168 GTGTGTGAGTGTGTGTAAGAGGG + Intergenic
971225688 4:24749500-24749522 GTGTGTGTGTGTGTGTATTAGGG + Intergenic
971242969 4:24905437-24905459 GTGTGTGTGTGTGTGTGTGATGG + Intronic
971337375 4:25736225-25736247 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
971571388 4:28215600-28215622 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
971589542 4:28449903-28449925 GTATATGTGTATGATTATGATGG + Intergenic
971613099 4:28751696-28751718 GTGTGTGTGTGTGTGTATTATGG + Intergenic
971848762 4:31956151-31956173 GTGTGTGTGTATGTGTTTGTTGG - Intergenic
972086746 4:35226947-35226969 CAGTGTGAGTATGCATATGATGG + Intergenic
972406835 4:38754387-38754409 GTGTGTGAGTGTGTGTGTTATGG - Intergenic
972495757 4:39632772-39632794 GTGTGTGTGTGTGTGTGTGACGG - Intronic
972638092 4:40901925-40901947 GTGTGTGTGTGTGTGTGTGATGG + Intronic
972717581 4:41663155-41663177 GTGTGTGTGTGTGTGTGTGATGG + Intronic
972922810 4:43965212-43965234 GTGTGTGTGTATGTGTGTGTGGG - Intergenic
973058766 4:45692767-45692789 GTGTGTGTGTGTGTGTATCAGGG + Intergenic
973171525 4:47150307-47150329 GTGTGTGTGTGTGTGTGTGATGG - Intronic
973268872 4:48239988-48240010 GTGTGTGTGTGTGTGTGTGATGG + Intronic
973299356 4:48562631-48562653 ATGTGTGTGTATGTGTATGAAGG - Intronic
973328157 4:48884988-48885010 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
973862346 4:55077857-55077879 GTGTGTGGGTATGTGTGTGCTGG + Intergenic
973862363 4:55077919-55077941 GGGTGTGAGTGTGAGTATGGGGG + Intergenic
973871796 4:55174130-55174152 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
973958258 4:56085049-56085071 GTGTGTGATTGTGAGTGGGAAGG + Intergenic
974191952 4:58516670-58516692 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
974214167 4:58823512-58823534 GTGTGTGTGTGTGTGGATGAAGG - Intergenic
974276802 4:59731147-59731169 GTGTGTGTGTGTGTGTATGATGG + Intergenic
974634741 4:64546095-64546117 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
974672029 4:65044569-65044591 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
974715372 4:65662699-65662721 GTGTGTGAGAGTGTGTATGTGGG + Intronic
974770500 4:66405313-66405335 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
974999231 4:69199227-69199249 GTGTGTGTGTGTGTGTATCAGGG - Intronic
975014883 4:69403251-69403273 GTGTGTGTGTGTGTGTATCAGGG + Intronic
975016221 4:69424366-69424388 GTGTGTGTGTGTGTGTATCAGGG + Intergenic
975603179 4:76125313-76125335 GTGTGTGTGTGTGTGTGTGATGG - Intronic
975863098 4:78698827-78698849 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
975912763 4:79287673-79287695 GTGTGTGAGTGAGAGAAAGAGGG + Intronic
976165361 4:82248779-82248801 GTGTGTGTGTGTGTGTATGATGG + Intergenic
976333818 4:83862674-83862696 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
976499167 4:85767376-85767398 GTGTGTATATATGTGTATGATGG - Intronic
976508556 4:85880531-85880553 GTGTGTGTGTGTGTGTGTGACGG + Intronic
976620744 4:87124867-87124889 GTGTCTGTGTGTGAGTGTGATGG - Intronic
977044099 4:92047569-92047591 GTGTGTGTGTATGCGTCTGGTGG - Intergenic
977079555 4:92507433-92507455 GTGTGTGTTTGTGTGTATGAAGG + Intronic
977276280 4:94980988-94981010 GTGTGTGTGTGTGTGTGTGATGG - Intronic
977307989 4:95349369-95349391 GTGTGGGTGTGTGTGTATGAGGG - Intronic
977852530 4:101847730-101847752 GTGTGTGTGTGTGTGTATGATGG - Intronic
978144168 4:105352516-105352538 GTGTGTGTATATGTGTTTGAAGG - Intergenic
978215418 4:106195500-106195522 GTGTGTGTGTTTGTGTGTGATGG + Intronic
978247403 4:106590761-106590783 GTGTGTGTGTGTGTGTATGCTGG - Intergenic
978360196 4:107923474-107923496 GTGTGTGTGTATGTGTGTGTAGG - Intergenic
978384563 4:108167345-108167367 GTGTGTGTGTGTGTGTAGGATGG - Intronic
978803326 4:112775512-112775534 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
978843973 4:113249863-113249885 GTGAGTCATTATGAGTAAGATGG + Intronic
978990199 4:115071273-115071295 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
979222909 4:118249725-118249747 GTGTGTGTGTGTGTGTATGTGGG - Intronic
979377104 4:119959899-119959921 ATATGTGAGGATGAGGATGAGGG + Intergenic
979730819 4:124020641-124020663 GTGTGTGTGTGTGTGTATGCTGG - Intergenic
979854430 4:125613381-125613403 CTGTGTGTGTATGTGTATGTGGG - Intergenic
979876962 4:125905070-125905092 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
980136028 4:128859214-128859236 GTGTGTGAGTATGCGTATGTGGG + Intronic
980313838 4:131170043-131170065 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
980318076 4:131231776-131231798 GTGTGTGTGTGTGTGTATGAGGG - Intergenic
980597705 4:134976157-134976179 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
980791514 4:137626613-137626635 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
980805409 4:137806715-137806737 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
980843360 4:138293870-138293892 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
980970377 4:139561529-139561551 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
981398617 4:144284917-144284939 GTGTGTGTGTATGTGTGTGGTGG - Intergenic
981408571 4:144400625-144400647 GTGTGTGTGTGTGTGTCTGACGG + Intergenic
981563564 4:146073990-146074012 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
981724685 4:147834753-147834775 GTGGGTGTGTATGGGTGTGAGGG - Intronic
981844207 4:149148318-149148340 GTGTGTGTGTATGTGTGTGTAGG + Intergenic
981874938 4:149530768-149530790 GTGTCTGTGTCTGAGTATGCAGG - Intergenic
982100425 4:151961779-151961801 GTGTGTGTGTGTGTGTATTAAGG + Intergenic
982158722 4:152545868-152545890 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
982249654 4:153391721-153391743 GTGTGTGTGTGTGTGTATGATGG - Intronic
982493831 4:156065170-156065192 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
982635653 4:157893599-157893621 GTGTGTGTGTATGAGAGAGAGGG + Intergenic
982975281 4:162048586-162048608 GTGTGTGTGTATGTGTATAATGG - Intronic
982976151 4:162064553-162064575 ATGTTTTAGTATGAGTTTGAAGG - Intronic
983003324 4:162448276-162448298 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
983106927 4:163698152-163698174 GTGTATGAGAATCAGTATAATGG - Intronic
983129193 4:163994290-163994312 GTGTGTGTGTGTGAGTGTGGTGG + Intronic
983333926 4:166367861-166367883 GTGTGTGTGTGTGTGTATAATGG + Intergenic
983665981 4:170183689-170183711 GTGTGTGTGTGTGTGTATGTAGG + Intergenic
983839515 4:172439169-172439191 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
984413989 4:179433725-179433747 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
984501908 4:180567251-180567273 GTGGGTGAGTGTGAGTGTGTGGG + Intergenic
984603855 4:181760957-181760979 GTGTGTGTGTATGTGTGTGGTGG - Intergenic
984611347 4:181843154-181843176 GAGTGTAAGGATGAGTTTGAAGG - Intergenic
984622453 4:181969048-181969070 GTGTGTGTGTTTGTGTATGGGGG - Intergenic
984660661 4:182371226-182371248 GTGTGTGTGTGTGTGTGTGATGG - Intronic
984848446 4:184129285-184129307 GTGTGTGTGTGTGTGTATGTTGG - Intronic
984952499 4:185017879-185017901 GTGTGTGTGTTTGTGTGTGAAGG - Intergenic
984988743 4:185356974-185356996 GTGTGTGAGAAAGACTGTGAAGG - Intronic
985330630 4:188828618-188828640 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
985421264 4:189787237-189787259 GTGTGTGAGTGTGTGTGTGTTGG - Intergenic
985637791 5:1048052-1048074 GTGTGTTAGTGTGTGAATGAGGG + Intergenic
986012402 5:3727705-3727727 GAGTGTGTGTATGTGTGTGAGGG - Intergenic
986077796 5:4356245-4356267 GTGTGAGAGTAAGAGAATCACGG + Intergenic
986079393 5:4374432-4374454 TTTTGAGAGTATGTGTATGAGGG - Intergenic
986153650 5:5151716-5151738 GTGTGTGTGTATGTGTGTGGGGG + Intronic
986155079 5:5166240-5166262 GTGTGTGTGTGTGTGTGTGATGG - Intronic
986677009 5:10194538-10194560 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
986716822 5:10530846-10530868 GTGTGTGTGTATGAGAGTGTTGG + Intergenic
986901404 5:12438483-12438505 GTGTGTGTGTTTGAGATTGATGG + Intergenic
987065437 5:14285520-14285542 GTGTGTGAGTGTGAGTTAGTTGG + Intronic
987347156 5:16989426-16989448 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
987505128 5:18759232-18759254 GTGTGTGTGTATGTGTATGTGGG + Intergenic
987637285 5:20560456-20560478 GTGTGTGTGTATGAGTGTTGGGG - Intronic
987742959 5:21934113-21934135 GTGTGTGAGTGTGTGTGTGTGGG - Intronic
987814761 5:22885784-22885806 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
987881058 5:23746846-23746868 GTGTGTGTGTATGTGTGTAAAGG + Intergenic
987951390 5:24681590-24681612 GTGTGTGTGTATGTGTATGGAGG + Intergenic
988033271 5:25793865-25793887 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
988074116 5:26330505-26330527 GTGTCTGTGTGTGAGCATGATGG + Intergenic
988296295 5:29367265-29367287 GTGAGTGAGTGTGTGTATGGGGG - Intergenic
988485329 5:31663861-31663883 GTGTGTGTGTGTGTGTATGCGGG + Intronic
988485383 5:31664413-31664435 GTGTCTGTGTATGAGTGTGATGG - Intronic
988700707 5:33671739-33671761 GTGTGTGTTTGTGAGTATGTGGG - Intronic
988700726 5:33671923-33671945 GTGTGTGTATGTGAGTATGTGGG - Intronic
988700761 5:33672295-33672317 CTGTGTGTATATGAGTATGTGGG - Intronic
989088248 5:37699325-37699347 GTGTGTGTGTGTGTGTATGATGG - Intronic
989160961 5:38391400-38391422 GTGTGTGTGTGTGTGTGTGATGG + Intronic
989286015 5:39700721-39700743 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
989373161 5:40731355-40731377 GTGTGTGTGTATGTGTAGCAGGG - Intronic
989563150 5:42873917-42873939 GTGTGTGAGTGTATGTAAGAGGG - Intronic
989756000 5:44955136-44955158 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
989780002 5:45253408-45253430 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
989815878 5:45737126-45737148 GTGTGTGTGTATGTGTTTGTTGG + Intergenic
989826894 5:45867483-45867505 GTGTGAGAGTAATAGTTTGAAGG - Intergenic
990100043 5:52171901-52171923 GTGTGTGTGTGTGAATCTGATGG + Intergenic
990255423 5:53963802-53963824 GTGTGTGTGTGTGTGTGTGATGG - Intronic
990259322 5:54004793-54004815 GTGTGTGTGTGTGTGTAAGAGGG + Intronic
990266276 5:54079964-54079986 GTGTGTGTGTGTGTGTGTGACGG - Intronic
990282438 5:54265825-54265847 GTGTATGAGTTTTAGAATGATGG + Intronic
990333180 5:54747283-54747305 ATGTGTGAGTGTGCATATGACGG - Intergenic
990401697 5:55444753-55444775 GTGTGTGTGTGTGTGTGTGATGG + Intronic
990490693 5:56300186-56300208 ATGTGCGAGTATGGGTGTGAGGG + Intergenic
990733357 5:58833321-58833343 GTGTGTGTGTGTGTGTGTGATGG - Intronic
990804211 5:59639839-59639861 GTGTGTGTGTGTGTGTGTGATGG + Intronic
990918235 5:60933932-60933954 GTGTGTGTGTGTGTGTATCATGG - Intronic
990931840 5:61100530-61100552 GTGTGTGTGTGTGTGTATTAGGG - Intronic
991051967 5:62282457-62282479 GTGTGTGTGTATGTGTATGGAGG - Intergenic
991230073 5:64322623-64322645 GTGTGTGTGTGTGTGTATAACGG + Intronic
991491279 5:67185282-67185304 GTGTGTGTGTGTGTGTAAGAGGG - Intronic
991774366 5:70070160-70070182 GTGTGTGTGTGTGTGTATTAAGG + Intronic
991836037 5:70755694-70755716 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
991853661 5:70945585-70945607 GTGTGTGTGTGTGTGTATTAAGG + Intronic
991885007 5:71254706-71254728 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
991952210 5:71957053-71957075 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
992320059 5:75605106-75605128 GTGTGTGTGTATGTGTATACAGG - Intergenic
992383069 5:76257621-76257643 GTGTGTGGGTGTGGGTATGTAGG + Intronic
992517723 5:77512386-77512408 GTGTGTGTGTGTGTGTATGATGG + Intronic
992773685 5:80071643-80071665 GTGTGTGTGTATGTGTGTGTTGG - Intronic
992789173 5:80198399-80198421 GTGTTTAAGTTTGAGTAAGAGGG - Intronic
992822538 5:80512206-80512228 TTGGGTGACTATGTGTATGATGG + Intronic
993112126 5:83670697-83670719 GTGTGTGTGTGTGTGTGTGATGG + Intronic
993843499 5:92910176-92910198 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
993885238 5:93408368-93408390 GTGTGTGTGTGTGTGTATAAGGG - Intergenic
993982913 5:94564388-94564410 GTGTGTGTGTGTGTGTGTGATGG + Intronic
993982920 5:94564468-94564490 GTGTGTGTGTGTGTGTGTGATGG + Intronic
993982927 5:94564566-94564588 GTGTGTGTGTGTGTGTGTGATGG + Intronic
994023638 5:95056852-95056874 GTGTGTGTGTATTGGGATGAAGG - Intronic
994256742 5:97605906-97605928 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
994336101 5:98568245-98568267 GTGTATGAGTATGACAATGAAGG - Intergenic
994522178 5:100854001-100854023 GTGTGTGTGTATGTTTAAGATGG + Intronic
994548052 5:101193968-101193990 GTGTGTGTGTATATGTATGTAGG - Intergenic
995013435 5:107283679-107283701 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
995245714 5:109932993-109933015 GTGTGTGTGTGTGTGTATGATGG + Intergenic
995380124 5:111522719-111522741 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
995509820 5:112897348-112897370 GTGTGTGTGTGTGTGTGTGATGG - Intronic
995646874 5:114322570-114322592 GTGTGTGTGTGTGTGTATGGGGG - Intergenic
995648475 5:114340674-114340696 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
996004954 5:118408304-118408326 GTGTGTGTGTGTGTGTATGGGGG + Intergenic
996024122 5:118624692-118624714 GTGTGTGTGTGTGTGTATGATGG - Intergenic
996083277 5:119278403-119278425 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
996174087 5:120333141-120333163 GTGTGTGTGTGTGTGTATCAGGG - Intergenic
996225528 5:120989506-120989528 GTGTGTGTGTATGAGTGTGTTGG - Intergenic
996225664 5:120992451-120992473 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
996352166 5:122556691-122556713 GTGTGTGAGTGTGTGTGTGTAGG - Intergenic
996353781 5:122574946-122574968 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
996409521 5:123143163-123143185 GTGTGTGTGTGTGTGTATGTGGG + Intronic
996593529 5:125175540-125175562 GTGTGTGTGTGTGAGTGTGACGG - Intergenic
996642586 5:125774892-125774914 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
996661900 5:126013856-126013878 GTGTGTGAGTGTGTCTATGTTGG - Intergenic
996832747 5:127757837-127757859 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
996970292 5:129358927-129358949 CTAGCTGAGTATGAGTATGAAGG - Intergenic
997065170 5:130550793-130550815 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
997085835 5:130797446-130797468 GTGTATGTGTATTGGTATGAAGG - Intergenic
997196992 5:131986972-131986994 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
997867814 5:137480300-137480322 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
997901605 5:137771198-137771220 GCGTGTGTGTATGTGTATGGAGG - Intergenic
998018279 5:138750346-138750368 GTGTGTGTGTCTGTGTGTGACGG - Intronic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
998233441 5:140377219-140377241 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
998351010 5:141501284-141501306 GTGTGTGTGTGTGTGTATAAGGG - Intronic
998409929 5:141901967-141901989 GTGTGTGAGCATGAGTGTGTAGG + Intergenic
998566700 5:143222240-143222262 GTGTGTGTGTGTGTGTATGAAGG - Intronic
998708064 5:144787654-144787676 GTGTGTGTGTGTGTGTAGGAAGG - Intergenic
998867869 5:146523236-146523258 GTGTTTGGATATGACTATGAAGG - Intergenic
998928258 5:147151870-147151892 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
999290387 5:150421671-150421693 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
999439160 5:151588117-151588139 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
999514787 5:152290162-152290184 GTGTGTGTGTGTGTGTATAAAGG + Intergenic
999616712 5:153432751-153432773 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
999674978 5:153990061-153990083 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
999679550 5:154043545-154043567 GTGTGTGTGTGTGTGTGTGACGG - Intronic
999911394 5:156204461-156204483 GTGTGTGTGTATGAGTGTGTTGG - Intronic
1000058225 5:157628362-157628384 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1000212173 5:159117819-159117841 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1000313324 5:160065351-160065373 GTGTGTGTGTATGATCAGGAAGG - Exonic
1000373690 5:160560302-160560324 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1000396665 5:160782432-160782454 GTGTGTGTGTGTGTGTATGGAGG - Intronic
1000486184 5:161847659-161847681 GTGTGGGAGTGTGTGTGTGAGGG + Exonic
1000627690 5:163558277-163558299 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1000924196 5:167173719-167173741 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1000956538 5:167550732-167550754 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1000991978 5:167920512-167920534 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1001440944 5:171742300-171742322 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1001828474 5:174765653-174765675 GTGTGTGTGTATGCGTGTGTGGG - Intergenic
1002052287 5:176577870-176577892 GTGTGTGTGTATGTGTGAGATGG + Intronic
1002054026 5:176588565-176588587 GTGTGTGAGAGTGTGTGTGAGGG + Intronic
1002357781 5:178644823-178644845 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1002633283 5:180594779-180594801 GTGTGTGGGTGTGTGTGTGAGGG + Intergenic
1002918999 6:1552713-1552735 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1002952380 6:1827112-1827134 GTGTGTGTGTATGTGTATCCAGG + Intronic
1003006676 6:2389234-2389256 GTATGTGTGTATGTGTATTAGGG - Intergenic
1003157119 6:3606455-3606477 GTGTGTGTGTCTGTGTGTGATGG - Intergenic
1003408204 6:5840378-5840400 CTGTGTAAGTAGAAGTATGAAGG - Intergenic
1003409171 6:5848183-5848205 GCATCTGAGTATGAGGATGAGGG - Intergenic
1003469391 6:6415147-6415169 ATGTGTGAGTGTGAGTGTGCAGG - Intergenic
1003729023 6:8799620-8799642 GTGTGTGTATGTGAGCATGAGGG + Intergenic
1003776209 6:9368435-9368457 GTGTGTGAGAATGTGTGTGGGGG - Intergenic
1003811040 6:9780949-9780971 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1003846184 6:10175958-10175980 GTGTGTGTGTGTGTGTATTAGGG - Intronic
1003943493 6:11051593-11051615 TTGTGTGAGTGTGAGTGTGGGGG + Intergenic
1003967694 6:11268722-11268744 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1004036494 6:11929433-11929455 GTGTGTGTGTGTGAGTGTGTTGG - Intergenic
1004144109 6:13048536-13048558 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1004164782 6:13247347-13247369 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1004317935 6:14606992-14607014 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1004481064 6:16019626-16019648 GTGTGTGTGTCTGTGTGTGAAGG - Intergenic
1004481151 6:16020454-16020476 GTGTGTGTGTCTGTGTTTGAGGG - Intergenic
1004514244 6:16308319-16308341 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1004747291 6:18523578-18523600 GTGTGTGTGTGTGTGAATGAGGG + Intergenic
1004886047 6:20052474-20052496 GTGTGTGTGTTTGTGTATGGAGG - Intergenic
1004952870 6:20694078-20694100 GTGTGTGTGTGTGTGTATGTAGG + Intronic
1005127523 6:22464594-22464616 GTGTGTGTGTATGTGTATCAAGG - Intergenic
1005199256 6:23324707-23324729 GTGTGTGTGTATGTGTGTGTTGG - Intergenic
1005220516 6:23582921-23582943 GTGTGTGTGTGTGTGTATGCAGG - Intergenic
1005226420 6:23648514-23648536 GTGTGTGTGTGTGTGTATGATGG + Intergenic
1005301349 6:24474168-24474190 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1005586562 6:27282215-27282237 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1006309253 6:33245910-33245932 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1006439458 6:34044019-34044041 GTGTGTGTGTATGTGTGTGGTGG - Intronic
1006859762 6:37163440-37163462 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1006959325 6:37912054-37912076 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1007193417 6:40039093-40039115 GTGTGTCAGGATGAGACTGAGGG - Intergenic
1007624440 6:43235687-43235709 GTGTGTGTGTGTGTGTATAACGG + Intergenic
1008034534 6:46732356-46732378 GTGTGTGTGTATGTGTGTGTTGG - Intronic
1008147091 6:47905040-47905062 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1008861058 6:56150511-56150533 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1008892811 6:56514614-56514636 GTGTGTGTGTATGCGCATGAGGG - Intronic
1008920652 6:56841836-56841858 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1008931037 6:56940185-56940207 GTGTGTGTGTGTGTGTATGGGGG - Intronic
1008964334 6:57299092-57299114 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1009379944 6:63014892-63014914 GTGTGTGAGTATGTGTGTGGAGG - Intergenic
1009412680 6:63384519-63384541 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1009513067 6:64577485-64577507 GTGTGTGAGTGTGTGTGTGTAGG - Intronic
1009791020 6:68401191-68401213 GTGTGTGTGTATGTGTGTGTTGG - Intergenic
1009966861 6:70587165-70587187 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1009983619 6:70756521-70756543 TTGTGTGAGTAAAAGTATGGAGG + Intronic
1010063488 6:71652800-71652822 GTGTGAGAGAGAGAGTATGATGG - Intergenic
1010379466 6:75208210-75208232 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1010572330 6:77492295-77492317 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1010937676 6:81881304-81881326 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1010948444 6:82005962-82005984 GTGTGTGTGTGTGTGTATGGTGG - Intergenic
1011283772 6:85703110-85703132 GTGTGTGTGTGTGTGTAGGAGGG - Intergenic
1011482343 6:87807803-87807825 GTGGGGGAGAATGAGGATGATGG - Intergenic
1011966736 6:93168007-93168029 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
1012101399 6:95091211-95091233 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1012199160 6:96384093-96384115 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1012433466 6:99190319-99190341 GTGTGTGAGTATGTGTGCGTGGG - Intergenic
1012705006 6:102513689-102513711 GTGTGTGTGCATGTGTATTAGGG + Intergenic
1012882732 6:104810589-104810611 GTGTGTGGGTGTGGGTGTGACGG + Intronic
1012999961 6:106012104-106012126 GTGTGTGTGTATGAATGTGGAGG - Intergenic
1013066156 6:106686124-106686146 GTGTGTGTGTGTGTGTAAGAGGG - Intergenic
1013329506 6:109085512-109085534 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1013386478 6:109636747-109636769 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1013555182 6:111249706-111249728 GTGTGTGAGTGTGTGTCAGAAGG + Intergenic
1013648290 6:112167837-112167859 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1013855009 6:114561990-114562012 GTGTGTGTGTGTGTGTATGCAGG + Intergenic
1013895299 6:115080945-115080967 GTGTGTGTGTATATGTATGTAGG - Intergenic
1014181454 6:118389031-118389053 GTTTGTGATTTTGAGTAGGATGG + Intergenic
1014205960 6:118655617-118655639 GTGTGTGGGTTTGTGTGTGAAGG - Intronic
1014444720 6:121513976-121513998 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1014461383 6:121699829-121699851 GTGTGTGAGTGTGTGTGTGGTGG + Intergenic
1014571742 6:123017104-123017126 GTGTGTGTGTGTGCGTAAGATGG + Intronic
1014616438 6:123606420-123606442 TTGTGTGTGTATGTGTGTGATGG + Intronic
1014759542 6:125341444-125341466 GTGTGTGAGTTTTTGTGTGAAGG - Intergenic
1015011006 6:128347593-128347615 CCATGTGAGTATGTGTATGAGGG + Intronic
1015038020 6:128681038-128681060 GTGTGTGTGTTTGTGTATCATGG - Intergenic
1015088444 6:129325401-129325423 GTTTGTGAGAATGATTATGTTGG - Intronic
1015321859 6:131885011-131885033 GTGTTTGACTTTGATTATGATGG + Exonic
1015416931 6:132959889-132959911 GTGTGTGAGTGTGAGTATGAAGG - Intergenic
1015491891 6:133836330-133836352 GTCTGTGTGTGTGAGTATGGTGG - Intergenic
1015560903 6:134514871-134514893 GTGTGTGAGTAGGAGTGAGGGGG + Intergenic
1015626646 6:135185940-135185962 ATGTGTGACCATGACTATGATGG + Exonic
1015747901 6:136529999-136530021 ATGTGTGCGTATGTGTATGCAGG - Intronic
1015872418 6:137790584-137790606 GTGTGTGTGTGTGTGTATGAGGG - Intergenic
1016060616 6:139626202-139626224 GTGTGTGTGTGTGAGTGTGTGGG + Intergenic
1016286545 6:142480269-142480291 GTATGTGTATATGAGTATGTTGG - Intergenic
1016332671 6:142970075-142970097 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1016386995 6:143538087-143538109 GTGTGTGTGTGTGTGTAAGACGG - Intronic
1016513237 6:144866463-144866485 GTGTGTGTGTGTGTGTATGCGGG + Intergenic
1016633019 6:146254026-146254048 GTGTGTATGTATAAGTTTGAGGG + Intronic
1017322505 6:153110419-153110441 GTGTGTGTGTGTGTGTATGTTGG - Intronic
1017397481 6:154019309-154019331 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1017481164 6:154857464-154857486 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1017501318 6:155025815-155025837 GTGTGTGTGTGTGTGTTTGAGGG - Intronic
1017724311 6:157266284-157266306 GTGTGTGTGTATGTGTGTGGTGG - Intergenic
1017735369 6:157358053-157358075 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1017889474 6:158626865-158626887 GTGTGAGAGTGTGAGAGTGAGGG - Intronic
1017889501 6:158627044-158627066 GTGTGAGGGTGTGAGAATGAGGG - Intronic
1018032775 6:159855893-159855915 GTGTGAGAGTGTGTGTATAACGG - Intergenic
1018212869 6:161498929-161498951 GTGTGTGTGTATGGGGATGGGGG + Intronic
1018378881 6:163240007-163240029 GGGTGTGTGTATGTGTATGTGGG - Intronic
1018588032 6:165384654-165384676 GTGTGTGTGTGTGTGTATGGGGG + Intronic
1018704501 6:166453194-166453216 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1018857667 6:167686879-167686901 ATGTGTGAGCATGTGTATGAGGG + Intergenic
1018941550 6:168311497-168311519 GTGTGTGTGTATGTGTGTGGGGG - Intronic
1018980670 6:168599420-168599442 GTGTGTGAGTGTGGGTGTGGGGG - Intronic
1019067460 6:169314232-169314254 GTGTGTGAGAGTGAGTGTGCGGG - Intergenic
1019067554 6:169315006-169315028 GTGTGTGAGAGTGAGTGTGTGGG - Intergenic
1019092719 6:169553012-169553034 GTGTGTGTGTGTGTGTATGCAGG + Intronic
1019092732 6:169553080-169553102 GTGTGTGTGTGTGTGTATGCAGG + Intronic
1019217464 6:170453013-170453035 GTGTGTGTGTATGTGTGTGAGGG + Intergenic
1019251588 7:16659-16681 GAGGGTGAGGATGAGGATGAGGG - Intergenic
1019601753 7:1887219-1887241 GTGTGTGAGCATGTGTATGTGGG + Intronic
1020184405 7:5947874-5947896 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1020298511 7:6776870-6776892 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1020480612 7:8655493-8655515 GTGTGTGTGTGTGCGTGTGATGG - Intronic
1020569978 7:9846943-9846965 GTGTGTGTGTGTGTGTATGACGG - Intergenic
1020983607 7:15104021-15104043 GTGTGTGTGTGTGCGTGTGAAGG + Intergenic
1021194695 7:17662399-17662421 GTGTGTGTGTAGGTGTATGTGGG - Intergenic
1021200120 7:17719349-17719371 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1021227284 7:18042863-18042885 GTGTGTGTGTGTGAGCATGCAGG - Intergenic
1021314758 7:19134448-19134470 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1021333822 7:19373306-19373328 GTGTGTGTGTATGTGTATGGAGG + Intergenic
1021434087 7:20594680-20594702 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1021857166 7:24868361-24868383 GTGTGTGTGTCTGTGTGTGATGG + Intronic
1021988788 7:26122702-26122724 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1022057528 7:26754357-26754379 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1022242403 7:28525761-28525783 GTGTGTCTGTGTGTGTATGATGG + Intronic
1022246099 7:28561026-28561048 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1022275489 7:28851376-28851398 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1022478251 7:30726095-30726117 GTGTGTGTGTGTGTGTCTGAGGG + Intronic
1022548555 7:31212761-31212783 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1022556381 7:31302192-31302214 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1022764133 7:33391433-33391455 GTGTGTATGTATGGGTATGCTGG - Intronic
1022850809 7:34259802-34259824 GTGTGTGTGTATGTGTCTGTGGG + Intergenic
1023173945 7:37417657-37417679 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1023177343 7:37447644-37447666 GTGTGTGAGTGTGTGTGTGTGGG - Intronic
1023366588 7:39470578-39470600 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1023371258 7:39514353-39514375 GAGTGTGAGTGTGAGTGTGGTGG - Intergenic
1023537448 7:41228405-41228427 GTGTGTGTGTGTGTGTATGATGG + Intergenic
1023544330 7:41301649-41301671 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1023720126 7:43084419-43084441 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1023748449 7:43345787-43345809 GTGTGTGTGTATATATATGATGG - Intronic
1023761414 7:43468170-43468192 GTGTGTGTGTATGTGTAGGGGGG - Intronic
1023761760 7:43470726-43470748 GTGTGTGAGCATGTGTGTGTAGG - Intronic
1023765704 7:43508577-43508599 GTGTGTGTGTATGTGTATGTGGG - Intronic
1024000470 7:45186041-45186063 GTGTGTGAGCGTGTGTGTGAGGG + Intronic
1024137050 7:46420105-46420127 GTGTGTGCGTGTGTGTATAAAGG + Intergenic
1024178338 7:46863223-46863245 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1024202876 7:47124542-47124564 GTGTGTGTGTCTGTGTATAAGGG - Intergenic
1024248193 7:47486040-47486062 GTGTGTGAGTGTGGGTGTGTGGG + Intronic
1024620862 7:51156695-51156717 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1024824137 7:53369395-53369417 GTGTGTGTGTATGTGTATAGCGG - Intergenic
1025034500 7:55585230-55585252 GTGTGTGTGTGTGTGTATGGAGG + Intergenic
1025098373 7:56115459-56115481 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1025601596 7:63004289-63004311 GTGTGTGTGTGTGTGTATGGTGG - Intergenic
1025780150 7:64594553-64594575 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1025920722 7:65909720-65909742 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1026078323 7:67193868-67193890 GTGTGAGTGAATGTGTATGAGGG + Intronic
1026145982 7:67747113-67747135 ATTTGGGAGTGTGAGTATGATGG + Intergenic
1026287334 7:68974853-68974875 GTGTGTGTGTGTGTGTATGGTGG - Intergenic
1026359108 7:69586548-69586570 GTGTGTGTGTGTGTTTATGATGG + Intergenic
1026398409 7:69983516-69983538 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1026881987 7:73912669-73912691 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1027204721 7:76088707-76088729 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1027338474 7:77180263-77180285 GTGTGTGTGTCTGTGTATGGTGG - Intronic
1027422787 7:78033684-78033706 AAGTGTGAGTTTGAGTTTGAAGG + Intronic
1027548839 7:79565054-79565076 GTGTGTGTGTATGTGTATGTTGG + Intergenic
1027675880 7:81157937-81157959 GTGTATGTGTATGTGTATGTTGG + Intergenic
1027698023 7:81435432-81435454 GTGTGTGTGTATGTAGATGAGGG - Intergenic
1027953995 7:84856801-84856823 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1028079689 7:86559652-86559674 GTGTGTGCGTGTGTGTGTGAGGG - Intergenic
1028272829 7:88814441-88814463 GTGTGTGTGTGTGTGTTTGAAGG - Intronic
1028324080 7:89500474-89500496 GGGTGTGTGTATGTGTATGTAGG - Intergenic
1028362159 7:89981676-89981698 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1028426606 7:90696638-90696660 ATATGTGAGTCTGAGGATGAGGG + Intronic
1029119766 7:98259620-98259642 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1029590733 7:101505294-101505316 GTGTGTATGCATGAGTGTGATGG + Intronic
1029688225 7:102163491-102163513 GTGGGAGGGTCTGAGTATGAAGG + Intronic
1029842534 7:103381565-103381587 GTGTGTGTGTATATGTATGTAGG - Intronic
1029878295 7:103777880-103777902 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1029987194 7:104933357-104933379 GTGTGTGTGTATGTGTATGCGGG - Intergenic
1030099981 7:105937402-105937424 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1030109813 7:106017552-106017574 GTGTGTGTGTCTGTGTGTGACGG - Intronic
1030515169 7:110529622-110529644 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1030607430 7:111652574-111652596 GTGTGTGTGTGTTAGGATGAAGG - Intergenic
1030618054 7:111759072-111759094 GTGTGTGTGTATGTGTGTGTAGG + Intronic
1030638244 7:111974530-111974552 GTGTGTGTGTGTGTGTATGATGG + Intronic
1030740655 7:113105410-113105432 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1030814503 7:114018673-114018695 GTGTGTGGGTGTGTGTATGCTGG - Intronic
1030933110 7:115549726-115549748 GTGTGTGTGTGTGTGTATGCTGG + Intergenic
1031134488 7:117871841-117871863 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1031147377 7:118011905-118011927 GTGTGTGAGTATGTGAATTGTGG + Intergenic
1031654461 7:124335547-124335569 GTGTGTGTGTGTGTGTATGGGGG + Intergenic
1031949804 7:127880723-127880745 GTGTGTGTGTGTGTGTATAATGG + Intronic
1032023372 7:128422208-128422230 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
1032086727 7:128887734-128887756 GTGTGTGTGTATGAGAGTGTGGG - Intronic
1032417443 7:131747311-131747333 GTGTGTGTGTGTGTGTATGGAGG + Intergenic
1032451367 7:132034770-132034792 GTGTGTGAGTCTGTGGATGGGGG - Intergenic
1032479415 7:132234620-132234642 GTGTGTGTGTATGTGTATTGGGG + Intronic
1032843419 7:135732686-135732708 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1033005975 7:137562984-137563006 TTTTGTGATTATGATTATGAGGG - Intronic
1033013035 7:137642956-137642978 GTGTGTGTGTGTGTGTATGGGGG + Intronic
1033076564 7:138255440-138255462 GTCTGTGAGTATGTGGCTGAAGG + Intergenic
1033133225 7:138763146-138763168 GTCTGTGTGTATGTGTATTAGGG - Intronic
1033296671 7:140144704-140144726 GTGTGTGTGTGTGTGTATGGTGG - Intronic
1033316945 7:140305318-140305340 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1033380486 7:140812176-140812198 GTGTGTGTGTGTGTGTGTGAGGG + Intronic
1033400996 7:141025435-141025457 GTGTGTGTGTGTGTGTTTGAAGG + Intergenic
1033407355 7:141083081-141083103 GTGTGCGTGTCTGTGTATGATGG - Intronic
1033638040 7:143230630-143230652 GTGTGTGAATGTGAGTGTGTGGG - Intergenic
1033638043 7:143230676-143230698 GTGTGTGAATGTGAGTGTGTTGG - Intergenic
1033638054 7:143230939-143230961 GTGTGTGAATGTGAGTGTGTTGG - Intergenic
1033807132 7:144967297-144967319 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1033975891 7:147100120-147100142 GTTTGTGTGTATGTGTATGGGGG + Intronic
1034140712 7:148813046-148813068 GTGTGTGTGTGTGTGTATGTGGG - Intronic
1034171212 7:149064893-149064915 GTGTGTGTGTGTGAGTGAGACGG - Intergenic
1034404060 7:150890190-150890212 GTGTGTGTGTGTGTGTATGGTGG - Intergenic
1034480136 7:151313556-151313578 GTGTGAGAGTGTGAGTGTGGGGG + Intergenic
1034564611 7:151903425-151903447 GTGTGTGTGTGTGAGTGTGTGGG - Intergenic
1034570015 7:151948094-151948116 ATGTGTGTATATGTGTATGAGGG + Intergenic
1034709145 7:153175547-153175569 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
1034858286 7:154574701-154574723 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1034937176 7:155207805-155207827 GTGTGTGAGTGTGTGTGTGTGGG + Intergenic
1034937194 7:155207923-155207945 GTGTGTGGGAATGGGTATGTGGG + Intergenic
1034937221 7:155208062-155208084 GTGTGTGGGAATGGGTGTGAGGG + Intergenic
1034946286 7:155264057-155264079 GTGTGTGAGTGTGTGTCTGAGGG + Intergenic
1035094772 7:156345368-156345390 GTGTGTGAGAGTGAGTGTGACGG - Intergenic
1035207906 7:157306563-157306585 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1035336459 7:158131730-158131752 ATGTGTGTGTATGAGTGTGTTGG - Intronic
1035392258 7:158512529-158512551 GTGTGTGAGTGTGTGCATGTGGG - Intronic
1035407604 7:158609792-158609814 GTGTGTGAGGCAGAGTGTGAGGG + Intergenic
1035877380 8:3206228-3206250 GTGTGTGTGTATGTGTGTGGGGG + Intronic
1035877400 8:3206379-3206401 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1035877407 8:3206441-3206463 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1035909336 8:3548653-3548675 GTGTGTGTGTGTGTGTATGATGG - Intronic
1035925695 8:3725508-3725530 GTGTGTGTGTATGTGTATGTGGG + Intronic
1036012206 8:4738913-4738935 GTGTGTGTGTATGTGTTAGAAGG + Intronic
1036086485 8:5618278-5618300 GTGTGTGAGCATGTGTGTGTGGG + Intergenic
1036087990 8:5634603-5634625 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1036382623 8:8247248-8247270 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1036486278 8:9182246-9182268 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1036505645 8:9352985-9353007 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1036563572 8:9918926-9918948 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1036652380 8:10653644-10653666 GTGTGTGTGTATGCGTGTGTGGG - Intronic
1036753088 8:11455496-11455518 GTGTGTGAGTGTGAGTGTGTGGG + Intronic
1036753098 8:11455535-11455557 GTGTGTGAGTCTGAGTGTGGGGG + Intronic
1036753149 8:11455822-11455844 GTGTATGAGTGTGAGTGTGAGGG + Intronic
1036753160 8:11455893-11455915 GAGTGTGAGTGTGAGTGTGAGGG + Intronic
1036753282 8:11456497-11456519 GTGTGTGAGTGTGAGTGTGGGGG + Intronic
1036753291 8:11456536-11456558 GTGTGTGAGTGTGAGTGTGGGGG + Intronic
1037118430 8:15253949-15253971 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1037387142 8:18355296-18355318 GTGTGTGTGTGTGTGTATGATGG - Intergenic
1037424188 8:18737329-18737351 GTGTGTGTGTGTGCGTGTGACGG + Intronic
1037458041 8:19083191-19083213 GTGTGTGAGCATGAGGGTGGAGG - Intronic
1037748562 8:21665071-21665093 GTATGTGAGGACAAGTATGATGG + Intergenic
1037992746 8:23332344-23332366 GTGGGTGTGTATGAGTGTGGGGG - Intronic
1037992809 8:23332662-23332684 GAGTGTGTGTATGAGTGTGGGGG - Intronic
1037992828 8:23332783-23332805 GAGTGTGGGTATGAGTGTGGGGG - Intronic
1038000013 8:23383321-23383343 GGGTGTGTGTGTGTGTATGATGG + Intronic
1038680255 8:29660359-29660381 GGGTGTGTGTATGTGTATGGGGG - Intergenic
1038688170 8:29737560-29737582 GTGTGTGTGTATGTGTGTGTTGG - Intergenic
1038704274 8:29879360-29879382 GTGTGTGTGTGTGTGTCTGAGGG - Intergenic
1038898603 8:31816197-31816219 ATGTGTGAGTCTTAGGATGAAGG - Intronic
1039051739 8:33501391-33501413 ATATGTGTGTATGCGTATGAGGG - Intronic
1039428100 8:37503578-37503600 GTGTGTGTGTGTGTGTATGCTGG + Intergenic
1039439099 8:37582224-37582246 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1039452413 8:37686070-37686092 GTGTGCTAGCATGAGTATGGGGG - Intergenic
1039665446 8:39522420-39522442 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1039784474 8:40821076-40821098 GTGTGTGTGTATGTGTATGGGGG + Intronic
1040532180 8:48275088-48275110 GTGTGTGAGTGGGTGTGTGAGGG + Intergenic
1040680658 8:49804360-49804382 GTGTGTGTGTGTGTGTAAGAAGG + Intergenic
1040713695 8:50221500-50221522 GTGTGTGTGTATGTGTGTGTTGG - Intronic
1040833142 8:51700162-51700184 GTGTGTGTGTGTGTGTATGCAGG - Intronic
1041088394 8:54278919-54278941 GAGTGTGAGTGTGAGTGTGGGGG - Intergenic
1041326665 8:56674023-56674045 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1041391232 8:57349198-57349220 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1041714113 8:60918187-60918209 GTGTGTGTGTGTGTGTATGGTGG + Intergenic
1041853695 8:62423469-62423491 GTGTGTGTGTATGTATATGTTGG - Intronic
1042844844 8:73159569-73159591 GTGTGTGAGCATGTGTGTGTAGG - Intergenic
1042882779 8:73512643-73512665 GTGTGTGTGTATGTGTGTGGGGG + Intronic
1043649519 8:82573707-82573729 GTGTGTGTGTGTGTGTATGGTGG + Intergenic
1043744013 8:83851034-83851056 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1043764103 8:84107153-84107175 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1043870449 8:85425892-85425914 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1043890679 8:85649612-85649634 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043893809 8:85720891-85720913 GTGTGTATGTATGTGTGTGAGGG - Intergenic
1043896489 8:85742340-85742362 GTGTGTATGTATGTGTGTGAGGG - Intergenic
1043898513 8:85757835-85757857 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043900125 8:85770029-85770051 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043902087 8:85785304-85785326 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043905308 8:85809691-85809713 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1043906918 8:85821878-85821900 GTGTGTATGTATGTGTGTGAGGG + Intergenic
1044063795 8:87673263-87673285 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1044210601 8:89545361-89545383 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1044470811 8:92564596-92564618 GTGTGTGAGCAGGACCATGAAGG + Intergenic
1044512848 8:93103384-93103406 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1044522950 8:93220744-93220766 GTGTGTGTGTGTGTGTCTGAAGG - Intergenic
1044644642 8:94425602-94425624 GTGAGTGATTATCAGTTTGAAGG - Intronic
1045310380 8:100996063-100996085 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1045363274 8:101452419-101452441 GAGTGTGTGTATGTGTGTGAGGG + Intergenic
1045471803 8:102519233-102519255 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
1045512380 8:102822167-102822189 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1045768896 8:105710693-105710715 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1045779450 8:105846941-105846963 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1046088955 8:109475321-109475343 GTGAGTAAGTATGAGGATGTAGG - Intronic
1046106891 8:109677038-109677060 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1046248256 8:111594266-111594288 GTGTGTGTGTATGTGTATGATGG - Intergenic
1046456775 8:114475604-114475626 GAGTGTGTGTATTAGTATGCAGG + Intergenic
1046553664 8:115748979-115749001 GTGTGTGTGTTTGTGTATAATGG + Intronic
1046563595 8:115870007-115870029 GTGTGTGTGTGTGTGTATTATGG + Intergenic
1046583442 8:116122335-116122357 GTGTGTGTGTAAGAGAAGGATGG + Intergenic
1046610384 8:116416931-116416953 GTGTGTGTGCATGTGTATGTGGG - Intergenic
1046993866 8:120493458-120493480 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1047072667 8:121364207-121364229 GTGTGTGTGTGTGTGTATGTAGG - Intergenic
1047211500 8:122843956-122843978 GTGTGTGTGTGTGTGTGTGAAGG - Intronic
1047367540 8:124225705-124225727 GTGTGTGTGTATGTGTATCATGG - Intergenic
1047503472 8:125460543-125460565 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1047677148 8:127214781-127214803 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1047796973 8:128267648-128267670 ATGTGTGAGTAACAGAATGAAGG + Intergenic
1048069109 8:131003203-131003225 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1048203523 8:132396956-132396978 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1048400647 8:134065851-134065873 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1048852848 8:138661063-138661085 GTGTGTATGTATGTGTATGTGGG - Intronic
1048871852 8:138805509-138805531 GTGTGTGTGTATATGTGTGATGG + Intronic
1048871888 8:138805924-138805946 GTGTGTGACTGTGTGTGTGATGG + Intronic
1048882517 8:138882549-138882571 GTGTGGGAGTGTGAGTTTGAGGG - Intronic
1048882530 8:138882661-138882683 GTATGGGAGTGTGAGTTTGAGGG - Intronic
1048898396 8:139015413-139015435 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1048933654 8:139337501-139337523 GTGTGTGTGTGTGTGTATGGAGG - Intergenic
1048974471 8:139663193-139663215 GTGTGTGTGCATGTGTATGTGGG - Intronic
1049029979 8:140027815-140027837 GTGAGTGAGTGTGTGTGTGAAGG + Intronic
1049140806 8:140952239-140952261 GGGTGTGAGTCTGTGTGTGAGGG - Intronic
1049301407 8:141872563-141872585 GTGTGTGAGTGAGGGTGTGATGG + Intergenic
1049398616 8:142413812-142413834 GTGTGTGCGTGTGCGTATGTGGG - Intergenic
1049478624 8:142809395-142809417 GTGTATGAGTGTGTGTGTGAGGG + Intergenic
1049525510 8:143124419-143124441 GTGTGTGAGTGTGTGTGTGGGGG - Intergenic
1050080989 9:1915773-1915795 GTGTGAGGGTGTGAGGATGAAGG - Intergenic
1050140074 9:2508357-2508379 GTGTGTGTGCATGTGTGTGAGGG + Intergenic
1050771230 9:9203224-9203246 GTGTGTGTGTGTGTGTCTGATGG - Intronic
1050787203 9:9419122-9419144 GTGTGTGTGTGTGTGTATAAGGG - Intronic
1050800173 9:9601135-9601157 GTGTGTGTGTGTGTGTATGGGGG + Intronic
1051196142 9:14564613-14564635 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1051360348 9:16276511-16276533 GTGTGTGTGTGTGAGTGTGTCGG - Intergenic
1051449956 9:17185582-17185604 GTTTGTGAGTTTGTGAATGACGG + Intronic
1051722995 9:20058486-20058508 GTGTGTGTGTGTGTGTATGAAGG - Intergenic
1051967077 9:22842309-22842331 GTGTGTGAACATGTGTATGTTGG - Intergenic
1052442351 9:28513078-28513100 GTGTGTGTGTGTGTGTATGATGG - Intronic
1052475988 9:28959609-28959631 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1052895501 9:33744010-33744032 GTGTGTGTGTGTGTGTATGATGG + Intergenic
1053014279 9:34653302-34653324 GTGAGAGTGTATGAGTCTGAGGG + Intronic
1053202862 9:36164605-36164627 GTGTGTGTGTGTGTGTATGGGGG - Intergenic
1053261228 9:36666889-36666911 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1053292425 9:36890200-36890222 GTGTGTGAGTGAGAGAAAGAAGG + Intronic
1053480624 9:38414024-38414046 GTGTGTGTGTGTGAGAAAGAGGG - Intronic
1053589618 9:39498778-39498800 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1054195885 9:62031844-62031866 GTGTGTGTGTATGTGTGTGCGGG - Intergenic
1054576679 9:66866530-66866552 GTGTGTGTGTGTGTGTGTGATGG - Intronic
1054642523 9:67556846-67556868 GTGTGTGTGTATGTGTGTGCGGG + Intergenic
1055111585 9:72565567-72565589 GTGTGTGTGTATGTGTATGTTGG + Intronic
1055159568 9:73108947-73108969 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1055478204 9:76684624-76684646 TTGTGGGACAATGAGTATGAAGG - Intronic
1055520756 9:77078733-77078755 GTGTGTGTGTATGTGTGTCATGG - Intergenic
1055564126 9:77550850-77550872 GTGTGTGAGAGTGAATACGAAGG - Intronic
1055693219 9:78856424-78856446 GAGAGTGAGTAAGAGCATGAGGG + Intergenic
1056198601 9:84252725-84252747 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
1056207866 9:84337448-84337470 GCGTGTGTGTATGCGTATGTGGG + Intronic
1056247437 9:84709987-84710009 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1056251368 9:84751574-84751596 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1056316845 9:85398463-85398485 GTGTGTGTGTGTGTGTTTGAGGG - Intergenic
1056360452 9:85852605-85852627 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1056743973 9:89283914-89283936 GTGTGTGTGTATGTATGTGATGG - Intergenic
1056804345 9:89717168-89717190 GTGTGTGAGTATATGTATGTGGG - Intergenic
1056807645 9:89741245-89741267 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1056840328 9:89993666-89993688 GTGTATAAGTATGAGTGTGTAGG + Intergenic
1056910299 9:90694168-90694190 GTGTGTGAATGTGAGTGTGCGGG + Intergenic
1056910308 9:90694410-90694432 GTGTGTGAATGTGAGTGTGTGGG + Intergenic
1056910312 9:90694522-90694544 GTGTGTGAATGTGAGTGTGTGGG + Intergenic
1056984495 9:91349631-91349653 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1057579126 9:96270235-96270257 GTGTGTGTGTATGTGTTTGGGGG - Intronic
1057833151 9:98422524-98422546 GTGTGTGTGTCTGTGTGTGATGG + Intronic
1058107602 9:100990543-100990565 GATTATGAGTATCAGTATGAAGG + Intergenic
1058245158 9:102614325-102614347 GTGTGTGTGTGTGTGTATGATGG - Intergenic
1058451797 9:105103861-105103883 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1058615854 9:106827087-106827109 GTGTGTGTGTATGAGTGTATTGG - Intergenic
1058640005 9:107074520-107074542 GTGTGTGTGTGTGTGTAGGAGGG - Intergenic
1058669178 9:107346302-107346324 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1058732359 9:107862366-107862388 GTGTGTGTGTGTGAGTGTCAAGG - Intergenic
1058736572 9:107899594-107899616 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1058887281 9:109330936-109330958 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1058919658 9:109601215-109601237 GTGTGTGTGTGTGAATGTGAAGG + Intergenic
1058976755 9:110132053-110132075 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1058998821 9:110326927-110326949 GTGTGTGTGCATGAGTAGCAGGG - Intronic
1059078268 9:111218450-111218472 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1059452254 9:114377716-114377738 GGGTTTGAGTTTGAGTTTGAAGG - Intronic
1059502778 9:114769387-114769409 GTGTGTGGGTGTGTGCATGAAGG + Intergenic
1059541629 9:115136261-115136283 GTGTGTGTGTGTGTGTATGTTGG + Intergenic
1059842039 9:118228432-118228454 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1060227882 9:121807147-121807169 GTGTGTGTGGATGTGTGTGAGGG + Intergenic
1060239818 9:121893352-121893374 GTGTGTGTGTGTGTGTGTGAGGG + Intronic
1060295535 9:122340672-122340694 GTGCCTGAGTATGAGGAAGATGG + Intergenic
1060400632 9:123347202-123347224 GTGTGTTGGTGTGTGTATGAGGG + Intergenic
1060706810 9:125810382-125810404 GTGTGTGTGTGTGTGTATGGTGG + Intronic
1060781104 9:126413838-126413860 GTGTGTGTGTGTGTGTATAAGGG + Intronic
1060982436 9:127801460-127801482 GTGTGTGTGTGTGTGTATGGGGG + Intronic
1061292533 9:129659634-129659656 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1061557084 9:131377509-131377531 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1061589041 9:131586519-131586541 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1061589057 9:131586789-131586811 GTGTGTGTGTGTGTGTTTGACGG - Intronic
1061849990 9:133408968-133408990 GTGTGTGTGTGTGTGTGTGACGG + Intronic
1062106820 9:134759721-134759743 GTGTGTGTGTATGAGTGTGGGGG - Intronic
1062106941 9:134760525-134760547 GTGTGGGTGTATGAGTGTGGGGG - Intronic
1185896249 X:3861680-3861702 GTGTGTGAGTGTAACCATGAGGG + Intergenic
1185901368 X:3900106-3900128 GTGTGTGAGTGTAACCATGAGGG + Intergenic
1185993488 X:4917283-4917305 GTGTGTGTGTGTGTGAATGAGGG - Intergenic
1186046800 X:5545304-5545326 ATGTGTGGGTTTGTGTATGATGG - Intergenic
1186213938 X:7279425-7279447 GTGTGTGTGTGTGTGTATGATGG + Intronic
1186510669 X:10127588-10127610 GTGTGTGCGTGTGTGTGTGATGG - Intronic
1186539174 X:10382704-10382726 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1186568077 X:10685865-10685887 GTGTGTGTGTATGAGTATGTGGG - Intronic
1187269893 X:17770160-17770182 ATGTGTGAGTATGACTATGAGGG - Intergenic
1187399754 X:18949064-18949086 GTGTGTGCCTATGAGTAGAAAGG + Intronic
1187792618 X:22967572-22967594 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1188228817 X:27635813-27635835 GTGTGTGTGTGTGTGTGTGATGG + Intronic
1188231793 X:27673044-27673066 GTGTGTGTGTATGTGTGTGGTGG - Intronic
1188286575 X:28333295-28333317 GTGTGTGTGTGTGTGTATCAAGG - Intergenic
1188392995 X:29644337-29644359 GTGTGTGAGGAAGAGCATGGTGG + Intronic
1188432969 X:30127494-30127516 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
1188547628 X:31326647-31326669 GTGTGTGTATGTGATTATGATGG - Intronic
1188549298 X:31344852-31344874 GTGTGTGTGTGTGTGTATCAAGG - Intronic
1188805483 X:34583392-34583414 GTGTGTGTGTGTGTGTATGATGG - Intergenic
1189204770 X:39228201-39228223 GTGTGTGTGTGTGTGTATGATGG - Intergenic
1189344634 X:40231746-40231768 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1189379323 X:40490784-40490806 GTGTGTAGGTATGTGTATGTAGG - Intergenic
1189756776 X:44280024-44280046 GTGTGTGTGTGTGTGTATGGGGG - Intronic
1189905386 X:45753992-45754014 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1190133937 X:47777157-47777179 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1190342294 X:49307215-49307237 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190344557 X:49325582-49325604 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190345649 X:49335128-49335150 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190346752 X:49344678-49344700 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190348001 X:49535705-49535727 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190349102 X:49545261-49545283 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190350206 X:49554817-49554839 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190351308 X:49564376-49564398 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190352408 X:49573929-49573951 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190353509 X:49583477-49583499 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190354611 X:49592999-49593021 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1190355717 X:49602551-49602573 GTGTGTGTGTGTGAGTGTGTGGG - Intronic
1191067256 X:56362766-56362788 GTGTGTGTGTGTGTGTATGACGG - Intergenic
1191126115 X:56955467-56955489 GTGTGTGTGTGTGTGTCTGAAGG - Intergenic
1191158821 X:57305074-57305096 GTGTGTGTGTATGTGTATAATGG + Intronic
1192184193 X:68935385-68935407 GTGTGTGTGTATGTGTGTGTGGG + Intergenic
1192284411 X:69719709-69719731 GTGTGTGTGTGTGTGTATAACGG - Intronic
1192445440 X:71207650-71207672 GTGTGTGTGTGTGTGTGTGACGG - Intergenic
1192624460 X:72713667-72713689 GTGTGTGTGTGTGTGTGTGACGG - Intronic
1192792905 X:74400570-74400592 GTGTGTGAGAAGGAGTATATGGG + Intergenic
1192847852 X:74924710-74924732 ATGTGTGTGTCTGTGTATGAGGG - Intronic
1192866456 X:75138217-75138239 GTGTGTGTGTGTGTGTATGAGGG - Intronic
1192899017 X:75474567-75474589 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1193304981 X:79938323-79938345 GTGTGTGTGTGTGATTATTATGG + Intergenic
1193488530 X:82117914-82117936 GTGTGTGTGTGTGTGTATAATGG - Intergenic
1193763204 X:85491772-85491794 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
1193851368 X:86541819-86541841 GTGTGTGTGCATGAGGAGGAAGG + Intronic
1194267961 X:91778586-91778608 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1194296786 X:92135771-92135793 GTGTGTGTGTGTGTGTATGGTGG + Intronic
1194598693 X:95892555-95892577 GTGTGTGTGTATGTGTGTGTTGG + Intergenic
1194652717 X:96534368-96534390 GTGTGTGTGTGTGTGTTTGATGG - Intergenic
1194667066 X:96686916-96686938 GTGTGTGTATATGAGTGTAAAGG + Intronic
1194786695 X:98093719-98093741 GTGTGTGTGTGTGTGTATGTGGG - Intergenic
1194888915 X:99353872-99353894 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1194976133 X:100397989-100398011 GTGTGTGTGTGTGTGTATGAGGG - Intronic
1195334326 X:103834499-103834521 GTGTGTGTGTGTGACTCTGAAGG - Intergenic
1195406614 X:104521536-104521558 GTGTGTGTGTGTGTGTAAGAAGG + Intergenic
1195935017 X:110116883-110116905 GTGTGTGTGTGTGTGTGTGAAGG + Intronic
1196050512 X:111298962-111298984 GTGTGTGTGTGTGTGTAAGAAGG + Exonic
1196160567 X:112478109-112478131 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1196225708 X:113164116-113164138 GTGTGTAAGTATGGGAGTGAGGG + Intergenic
1196409468 X:115400705-115400727 GTGTGTGTGTGTGTGTATGTGGG + Intergenic
1196615730 X:117765103-117765125 GTGTGTGTGTGTGTGTATAAGGG - Intergenic
1196760654 X:119197957-119197979 GTGTGTGTGTGTGTGTGTGAGGG - Intergenic
1196929478 X:120667003-120667025 GTGTGTGTGTATGTGTGTGATGG - Intergenic
1197180231 X:123527403-123527425 GTGTGTGAGAATGTGTGTGTAGG + Intergenic
1197199586 X:123736368-123736390 GTGTGTGTGTGTGTGTATGGGGG - Intergenic
1197387209 X:125816082-125816104 GTGTGTGTGTGTGTGTATTATGG + Intergenic
1197489062 X:127094167-127094189 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1197585523 X:128342672-128342694 GTGTGTGTGTGTGTGTATGTTGG - Intergenic
1197883990 X:131199001-131199023 GTGTGTGAGTATGTATGTGAGGG + Intergenic
1198235510 X:134733049-134733071 GTGTGTGAGTGTGTGTACCATGG - Intronic
1198496117 X:137195282-137195304 GTGTGTGTGTATACGGATGAGGG + Intergenic
1198845654 X:140907613-140907635 ATGTGAGAGTAAGAGTAGGATGG - Intergenic
1199365514 X:146976868-146976890 GTGTGTGTGTGTGTGTGTGAGGG + Intergenic
1199387071 X:147235536-147235558 GTGTGTGAGTATGTGTGTGTTGG - Intergenic
1199471944 X:148205431-148205453 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1199573833 X:149293596-149293618 GTGTGTGTGTGTGTGTGTGAAGG + Intergenic
1199670975 X:150148030-150148052 GTGTGTGTGTATTAGTATGCTGG + Intergenic
1199701289 X:150377816-150377838 GTGTGTGTGTGTGTGTGTGAGGG - Intronic
1199726226 X:150585095-150585117 GTGTGTGTGTATGTGTGTGTGGG + Intronic
1199782886 X:151079630-151079652 GTGTGTGTGTATGAGTGTGTTGG + Intergenic
1200067805 X:153512855-153512877 GTGTGTGTGTGTGAGTGTGTGGG - Intergenic
1200097947 X:153672880-153672902 GTGTGTGTGTGTGAATATGTAGG - Intronic
1200367271 X:155680176-155680198 GTGTGTGTGTGTGTGTTTGAGGG + Intergenic
1200585167 Y:4999511-4999533 GTGTGTGTGTGTGTGTGTGAAGG - Intergenic
1200614301 Y:5360347-5360369 GTGTGTGTGTGTGTGTATGGTGG + Intronic
1201298121 Y:12482737-12482759 GTGTGTGTGTGTGTGTGTGATGG + Intergenic
1201336073 Y:12881015-12881037 GTGTGTGTGTGTGTGTGTGATGG - Intergenic
1201360582 Y:13143884-13143906 GTGTGTGTGTGTGTGTGTGACGG + Intergenic
1202253060 Y:22892948-22892970 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202406050 Y:24526697-24526719 CTGTGTGAGTCCAAGTATGAGGG + Intergenic
1202464730 Y:25143384-25143406 CTGTGTGAGTCCAAGTATGAGGG - Intergenic