ID: 956455325

View in Genome Browser
Species Human (GRCh38)
Location 3:69415260-69415282
Sequence GGGGCTTTATCTCCATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956455325_956455330 -2 Left 956455325 3:69415260-69415282 CCATCAAATGGAGATAAAGCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 956455330 3:69415281-69415303 CCATACTGACTTCTCAAGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 118
956455325_956455331 -1 Left 956455325 3:69415260-69415282 CCATCAAATGGAGATAAAGCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 956455331 3:69415282-69415304 CATACTGACTTCTCAAGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 144
956455325_956455326 -6 Left 956455325 3:69415260-69415282 CCATCAAATGGAGATAAAGCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 956455326 3:69415277-69415299 AGCCCCATACTGACTTCTCAAGG 0: 1
1: 0
2: 0
3: 15
4: 143
956455325_956455332 16 Left 956455325 3:69415260-69415282 CCATCAAATGGAGATAAAGCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 956455332 3:69415299-69415321 GCTGGGCACCCACCTCTAAAAGG 0: 1
1: 0
2: 2
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956455325 Original CRISPR GGGGCTTTATCTCCATTTGA TGG (reversed) Intronic
902071930 1:13747689-13747711 GGGGCTTTATCTAGACTAGAAGG + Intronic
906001856 1:42433279-42433301 TGGGCTTCATCTGCATTGGAAGG + Exonic
906974221 1:50551977-50551999 GTAGTTTTATCTCCATTTCATGG + Intronic
907221740 1:52911957-52911979 GGGTTTTTCTCTCCATTTTATGG - Intronic
907794393 1:57700373-57700395 GGGTATTTATCTCCAAGTGAAGG - Intronic
910705936 1:90129708-90129730 CTTGCTTCATCTCCATTTGAAGG - Intergenic
910840297 1:91554849-91554871 GAAGCTTAATCTCCATGTGATGG - Intergenic
913161424 1:116149220-116149242 GGGGCTTTATCTGCATTTTCAGG + Intergenic
918981819 1:191571236-191571258 TGGTCTTTATCTCCATTTTCAGG - Intergenic
922457541 1:225787581-225787603 AAGGCCTTATCTCCAATTGATGG + Intronic
923072227 1:230576388-230576410 GGGTCTTTATTTCCTTATGAAGG + Intergenic
1064429109 10:15256182-15256204 TGGGCTTTATCTCCACTCCAGGG + Intronic
1069105498 10:64378616-64378638 GGTGCTTCATCTACATTGGATGG - Intergenic
1069140125 10:64811855-64811877 GGGCCTTTGTATCCATCTGAGGG - Intergenic
1071191562 10:83107795-83107817 GGTGCTTTATCTCCATGAGAAGG - Intergenic
1071433863 10:85628519-85628541 GGCTCTTTATCTCCAGCTGAAGG - Intronic
1076212045 10:128656863-128656885 TGGGATTTATCTCCCTCTGATGG + Intergenic
1080861960 11:36157687-36157709 GGGGCTATATCTTCCTGTGATGG - Intronic
1082942418 11:58721757-58721779 GGGGCTTTATTTACATTATAAGG - Intronic
1084935652 11:72585247-72585269 GGGACTTCATCACCTTTTGAGGG - Intronic
1085429173 11:76432168-76432190 GGGTCTTTATTTCCTTATGATGG - Intergenic
1085948551 11:81301832-81301854 AGGCCATTATCTCCATTTGCTGG + Intergenic
1086576731 11:88347212-88347234 GGGGCATTATCACCATCTGAGGG + Intergenic
1087845418 11:102966600-102966622 GGTGATTTCTCCCCATTTGATGG - Intergenic
1089220536 11:116867492-116867514 GGGGCTTTGTCTTCATTTCCAGG + Intronic
1091954878 12:4631010-4631032 GGACATTTATCTCCATTAGATGG - Intronic
1092500394 12:9040409-9040431 GGAGGTTTTTCACCATTTGATGG + Intergenic
1093161615 12:15753541-15753563 GTGGATATATTTCCATTTGAGGG + Intronic
1093560643 12:20534733-20534755 TGTCCTTTATCTCCTTTTGATGG + Intronic
1097487828 12:60228128-60228150 GGGGCTTTTCCTCCTTTTGCTGG - Intergenic
1098695536 12:73549346-73549368 GGGGTTTTATTACCATTTGGTGG + Intergenic
1100137893 12:91577110-91577132 GGGGCTTTATTTCTTTTTGGTGG - Intergenic
1104241959 12:126998884-126998906 CGGGGTTTATGTCCCTTTGAAGG + Intergenic
1104371354 12:128226543-128226565 GAGGCTTTATTCTCATTTGATGG + Intergenic
1105012557 12:132765547-132765569 GGGCCGTTATCTCCACCTGAGGG - Intergenic
1105292205 13:19060402-19060424 GGGGTTTTAGCTGCATTCGAGGG + Intergenic
1109900463 13:68762634-68762656 AGGGCTTTATTTCATTTTGAAGG + Intergenic
1111787238 13:92804590-92804612 AGGGTTTTGCCTCCATTTGATGG + Intronic
1111903024 13:94222940-94222962 GGGGCTATCTCTGAATTTGATGG - Intronic
1114889302 14:26896899-26896921 GTAGCTTTATCTCCATTTGTGGG + Intergenic
1121081741 14:91114184-91114206 GGGCCTTTATGCCCTTTTGAGGG + Intronic
1127270557 15:57397585-57397607 GGGGTTTTTTCTCCATTTTCTGG - Intronic
1129170972 15:73807592-73807614 GGGGCTTTCTCTGCATTTGGTGG + Intergenic
1130742103 15:86612098-86612120 GAGGTTTTATCTCCAGCTGAGGG - Intronic
1131573415 15:93562426-93562448 GGGGCTTTGGCTCCTTTTGAAGG + Intergenic
1133970550 16:10564720-10564742 GGTGGTTTATTTCCATTTGGTGG - Intronic
1138302485 16:55944257-55944279 GGGCCATTAACTCCATTTTATGG - Intronic
1138844157 16:60544914-60544936 AGGGCTTTATCACCATATGTGGG - Intergenic
1141370109 16:83478903-83478925 CTGGCTTTATTTTCATTTGAGGG - Intronic
1142320898 16:89382194-89382216 GTGGCCTTAAATCCATTTGATGG - Intronic
1147865203 17:43547244-43547266 GGGGCTTTTGCTCCTTTTGCTGG - Intronic
1148639545 17:49176164-49176186 GGGGCTTGAACCCCAGTTGAAGG - Intergenic
1148950125 17:51303400-51303422 GGGGCTTTATTTACATAAGAAGG + Intergenic
1150484374 17:65533565-65533587 GAGGCTTTACCTGCAATTGAGGG - Intronic
1155339765 18:24802145-24802167 GAGGCCTTATCTCAATTTGTAGG - Intergenic
1157196399 18:45623630-45623652 GGGACTTTATCCCCTTTTGAAGG + Intronic
1159306492 18:66650099-66650121 GAGGATTTATCCTCATTTGAAGG - Intergenic
1159687137 18:71436543-71436565 TGTGCTATCTCTCCATTTGACGG - Intergenic
1161088227 19:2344743-2344765 AGGGCTTTATCTCCAGCCGACGG - Intronic
1163328569 19:16621258-16621280 GGTGCTTCATCTTCATTTTAGGG - Intronic
1165753658 19:38278219-38278241 GGGTCTTTATCACAATCTGAGGG - Intronic
1165966158 19:39582695-39582717 GTGGCTTTCTGTCCATGTGAAGG + Intergenic
1166220838 19:41363562-41363584 AGTGTATTATCTCCATTTGACGG + Intronic
928069635 2:28201874-28201896 GGGGCTTCATCTCTATTTCATGG - Intronic
933780087 2:85795307-85795329 GGAGCTTTATCCAGATTTGAAGG - Intergenic
938946094 2:136213323-136213345 GGGGACTTATCTTCCTTTGATGG + Intergenic
939763070 2:146209158-146209180 GTGGCTTCATTTCCTTTTGAAGG - Intergenic
940406258 2:153305849-153305871 GGGACTCTATCTCCTTTTAAAGG + Intergenic
940800571 2:158128449-158128471 CTGGATTTATCTCCATTTTAGGG - Intronic
941460574 2:165766654-165766676 GGGCTTTTATCTCCAATTTATGG - Intronic
941480853 2:166009726-166009748 AGAGCCTTATCTCGATTTGAAGG - Exonic
943626177 2:190202584-190202606 TGGGCTTTACTTCAATTTGAAGG + Exonic
947388681 2:229618040-229618062 GGGGGGTTATCTCCATTGGATGG - Intronic
949061143 2:241958232-241958254 GGGGCTTTTCCTCCTTTTGCTGG - Intergenic
1169962615 20:11178253-11178275 GGGGCTATGTCTCCACTTTAAGG + Intergenic
1170051438 20:12149794-12149816 TGGGCTTTCTCACCATTTGCTGG - Intergenic
1170920327 20:20672145-20672167 AGCACTTTAGCTCCATTTGAGGG - Intronic
1173195051 20:40907215-40907237 AGGGCTTTATCTGCATTTCTTGG + Intergenic
1173233029 20:41217074-41217096 GGGGTTTCATCTCCATTTTTTGG + Intronic
1173664413 20:44754468-44754490 GGGGCCTGGTCTCCATTAGAGGG - Intronic
1173928666 20:46800011-46800033 AGGGCTTTATCCCCCTTTGCTGG + Intergenic
1174075177 20:47930147-47930169 GGGGCTTTATTTCCATCTGGGGG - Intergenic
1176873695 21:14104840-14104862 GGGGCTTTAAATCCATTACAAGG - Intergenic
1178444961 21:32631338-32631360 AGGGCTTCATCTTCACTTGATGG - Exonic
1181602104 22:23958783-23958805 GGGGGCTTCTCTGCATTTGAAGG + Intronic
1181606406 22:23982524-23982546 GGGGGCTTCTCTGCATTTGAAGG - Intronic
952072079 3:29649311-29649333 GGGGCACAATTTCCATTTGATGG + Intronic
952978184 3:38713965-38713987 CGGGCTCTTTCTCGATTTGAAGG - Exonic
953546154 3:43864862-43864884 GGAGCATTCTCTCCATTTCAGGG - Intergenic
956455325 3:69415260-69415282 GGGGCTTTATCTCCATTTGATGG - Intronic
957398408 3:79675968-79675990 GGGTCTTTATTTCCTTATGAAGG + Intronic
957614875 3:82513841-82513863 TGGGTTTTCACTCCATTTGAAGG - Intergenic
959852780 3:111109329-111109351 GTGGTTTTACCTCCATTTGAAGG + Intronic
960175332 3:114510887-114510909 AGGGCCTTTTTTCCATTTGAAGG + Intronic
960422148 3:117460013-117460035 GGGGGTTTATATCCCTTAGAAGG + Intergenic
961542968 3:127612685-127612707 GGTGCTTTTTCTCCGTTTGCTGG + Intronic
962989896 3:140568418-140568440 GGGGTTTTATATTCATTGGATGG + Exonic
964086573 3:152826452-152826474 GGGACTTTTTTTCCTTTTGAAGG - Intergenic
964896208 3:161599396-161599418 GTCGCTTTTTCTCCATTTTAAGG + Intergenic
968758150 4:2427386-2427408 GGGACTTGGTCTCCATTGGATGG + Intronic
969489635 4:7491761-7491783 GTGGCTTGATCCCCATTTGTTGG + Intronic
972319490 4:37960150-37960172 TGGGTTTTACCTCCATTTTATGG + Intronic
975270899 4:72431996-72432018 TGGGCTTTCTCTTCATTTGCTGG - Intronic
978889644 4:113808886-113808908 GGGTCTTTATTTCCACATGATGG + Intergenic
992269037 5:75047133-75047155 GGGGCTTCATTTCCTTATGAGGG + Intergenic
995850264 5:116537584-116537606 GTTACTTTATCTCCATTTGGGGG - Intronic
996225029 5:120982096-120982118 GGGCCTTTATTTCCTTATGAAGG + Intergenic
996560601 5:124824757-124824779 TGTAATTTATCTCCATTTGAAGG + Intergenic
996576994 5:124986671-124986693 GCAGCTTTATATCCATTTGCGGG + Intergenic
998381925 5:141731868-141731890 GAGGCTTTCTCTCCACCTGATGG + Intergenic
1001195192 5:169666808-169666830 AAGGCTTTATCTCCACTTGCTGG - Intronic
1003770805 6:9297437-9297459 TGTGCTTTATGTCCATTGGAAGG - Intergenic
1004059146 6:12174500-12174522 TGATCTTTATCTCCATTTAAAGG - Intergenic
1005601388 6:27429905-27429927 GGGTCTTTATTTCCTTATGAAGG - Intergenic
1006836179 6:37000067-37000089 GGGGCAATGTCTCCATTTCAGGG - Intergenic
1007125183 6:39419856-39419878 GGGGCTTCATGGCCATTTGGAGG + Intronic
1007219123 6:40264674-40264696 GGTCCTTGATCTCCATGTGAAGG + Intergenic
1012516540 6:100068067-100068089 GTAACTTTATCTCCATTTCAAGG - Intergenic
1013291411 6:108721810-108721832 GCATCTTTATCTCCATTTGACGG - Intergenic
1016079141 6:139834369-139834391 GGGGCTTTATCTGCCTTCGCTGG + Intergenic
1017311395 6:152982195-152982217 GGGGGTGTCTCTCCATTTGGCGG + Intronic
1018193315 6:161330569-161330591 GGGGCTTTATTTCCATAACAAGG + Intergenic
1020783139 7:12540177-12540199 GAGGCTTTTCCTCCATTTCAAGG + Intergenic
1023153777 7:37227275-37227297 GGGGGTAAATTTCCATTTGATGG - Intronic
1024084608 7:45883005-45883027 GGGGCTTCATCTCCAGCTGGTGG + Intergenic
1025657547 7:63533112-63533134 GGGGCTTCATCTGCAATGGAAGG + Intergenic
1026398105 7:69979451-69979473 AGGGCTTTATTTCCAATGGAAGG + Intronic
1035862233 8:3041809-3041831 TGGGGTTTACCGCCATTTGATGG - Intronic
1036795915 8:11756820-11756842 ATGGCTTTATCTACATTTGCCGG - Intronic
1037534648 8:19813204-19813226 GAGGCTTTATGTACATTTGTAGG + Intergenic
1038976792 8:32706463-32706485 GGGGCTTGCTGTCCATATGATGG + Intronic
1041957734 8:63574773-63574795 GGAGCTATATCTCCATTAAAAGG - Intergenic
1042499990 8:69498479-69498501 TGGGCTTTGTCTCCATCTTATGG - Intronic
1044923883 8:97193323-97193345 GTGTGATTATCTCCATTTGACGG + Intergenic
1045263374 8:100596989-100597011 GGGGCATTATCTCTATGTGTAGG - Intronic
1045492612 8:102681760-102681782 CAGGCTTTATCCTCATTTGAAGG + Intergenic
1045611207 8:103844600-103844622 GTGGCTTTATTTCTATATGATGG - Intronic
1046405290 8:113764705-113764727 GGGGCTTTATCACCAATTATAGG + Intergenic
1047534067 8:125703281-125703303 GGGGTCTTGTCTCCGTTTGATGG + Intergenic
1048252090 8:132875064-132875086 GGGGCTTGTCTTCCATTTGACGG - Intronic
1057412767 9:94832451-94832473 GGGGCTTCACCTCCATGGGAAGG + Intronic
1189309887 X:40011773-40011795 GGGTCTTTAACTCCATTTCTTGG - Intergenic
1190812623 X:53899316-53899338 GTGACTTTCTCTTCATTTGAGGG - Intergenic
1195260001 X:103122547-103122569 GGGGCTCCATCTCCAGCTGATGG + Intergenic
1199092730 X:143711213-143711235 GAGGTTTTTTGTCCATTTGAGGG + Intergenic