ID: 956455325

View in Genome Browser
Species Human (GRCh38)
Location 3:69415260-69415282
Sequence GGGGCTTTATCTCCATTTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956455325_956455332 16 Left 956455325 3:69415260-69415282 CCATCAAATGGAGATAAAGCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 956455332 3:69415299-69415321 GCTGGGCACCCACCTCTAAAAGG 0: 1
1: 0
2: 2
3: 8
4: 96
956455325_956455331 -1 Left 956455325 3:69415260-69415282 CCATCAAATGGAGATAAAGCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 956455331 3:69415282-69415304 CATACTGACTTCTCAAGGCTGGG 0: 1
1: 0
2: 0
3: 10
4: 144
956455325_956455330 -2 Left 956455325 3:69415260-69415282 CCATCAAATGGAGATAAAGCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 956455330 3:69415281-69415303 CCATACTGACTTCTCAAGGCTGG 0: 1
1: 0
2: 1
3: 16
4: 118
956455325_956455326 -6 Left 956455325 3:69415260-69415282 CCATCAAATGGAGATAAAGCCCC 0: 1
1: 0
2: 0
3: 12
4: 132
Right 956455326 3:69415277-69415299 AGCCCCATACTGACTTCTCAAGG 0: 1
1: 0
2: 0
3: 15
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956455325 Original CRISPR GGGGCTTTATCTCCATTTGA TGG (reversed) Intronic