ID: 956462275

View in Genome Browser
Species Human (GRCh38)
Location 3:69484690-69484712
Sequence CTGGACAACCAGCAGCAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 699
Summary {0: 1, 1: 2, 2: 35, 3: 154, 4: 507}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956462275_956462277 2 Left 956462275 3:69484690-69484712 CCTCTCTGCTGCTGGTTGTCCAG 0: 1
1: 2
2: 35
3: 154
4: 507
Right 956462277 3:69484715-69484737 ATCTCCAGTTATCAGCAGAGAGG 0: 1
1: 13
2: 25
3: 73
4: 467
956462275_956462279 23 Left 956462275 3:69484690-69484712 CCTCTCTGCTGCTGGTTGTCCAG 0: 1
1: 2
2: 35
3: 154
4: 507
Right 956462279 3:69484736-69484758 GGATAACTCCTCTCTGCAGCTGG 0: 1
1: 18
2: 178
3: 281
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956462275 Original CRISPR CTGGACAACCAGCAGCAGAG AGG (reversed) Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
901322626 1:8348953-8348975 CTGGACAGGCCTCAGCAGAGCGG - Intergenic
901399995 1:9009246-9009268 CTGCACAAGCAACAGCAAAGAGG + Intronic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
902644726 1:17790495-17790517 CGGGACAACAGGCTGCAGAGAGG - Intronic
902651256 1:17839079-17839101 CTGGACAACCAGCTGGTAAGAGG - Intergenic
903672100 1:25042603-25042625 CAGGACAACTAGCTGCAGAGAGG - Intergenic
903759026 1:25684882-25684904 CTGGGCCAGCAGCAGCACAGGGG + Intronic
904344780 1:29860653-29860675 TTGGAGAAGAAGCAGCAGAGGGG + Intergenic
904403938 1:30274291-30274313 TGGGAGAACCAGCTGCAGAGGGG - Intergenic
904461068 1:30680074-30680096 TGAGACAACCAGCTGCAGAGAGG + Intergenic
904577396 1:31513951-31513973 TGGCACAACCAGCTGCAGAGAGG - Intergenic
905546094 1:38801590-38801612 CCTGACCACCAGCTGCAGAGAGG + Intergenic
905546106 1:38801660-38801682 CGGGACTACCAGTTGCAGAGAGG + Intergenic
906938669 1:50236680-50236702 ATGGATAACCAGCCACAGAGAGG - Intergenic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907321591 1:53606185-53606207 CTGTCCAGACAGCAGCAGAGGGG - Intronic
907369603 1:53992413-53992435 TGAGACAACCAGCTGCAGAGAGG - Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
908259289 1:62327245-62327267 CCGGACTACCAGCTGCAGACAGG - Intergenic
908259296 1:62327311-62327333 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
908798652 1:67856139-67856161 CTTGACAACCAAAGGCAGAGTGG - Intergenic
909238269 1:73180585-73180607 CAGAACGACCAGCAGTAGAGAGG - Intergenic
909282340 1:73771036-73771058 TGGGATAACCAGCTGCAGAGAGG + Intergenic
910259901 1:85284505-85284527 TGGGACTACCAGCTGCAGAGAGG + Intergenic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
911025053 1:93427149-93427171 TGGGACGACCAGCTGCAGAGAGG + Intergenic
912713509 1:111966076-111966098 CTGGGGAGCCAGCAGCAGGGTGG - Intronic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
914392697 1:147236600-147236622 TGGGACAACCAACTGCAGAGAGG - Intronic
914392717 1:147236741-147236763 TGGGATAACCAGCCGCAGAGAGG - Intronic
915138962 1:153754397-153754419 CTGGAAGACCAGCAGAAGACAGG + Intronic
915185065 1:154098530-154098552 TGGGATGACCAGCAGCAGAGAGG - Intronic
915185075 1:154098598-154098620 TTGGGCAACCAGCTGCAGAGAGG - Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
916204673 1:162304222-162304244 CTGGACATCCATTTGCAGAGAGG - Intronic
917468653 1:175307283-175307305 ATGGAGAAACTGCAGCAGAGAGG + Intergenic
917579646 1:176362582-176362604 CTGGACACCCAGCAGCAGTAAGG - Intergenic
919083218 1:192891235-192891257 TGGGACTACCAGCTGCAGAGAGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
919249127 1:195030367-195030389 CTGTTCAACCCTCAGCAGAGAGG + Intergenic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097849 1:211902185-211902207 TGGGACAACCAGCTGCAGAGAGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
921275085 1:213511357-213511379 CTGGCCATCCAGCAGCATTGTGG + Intergenic
922041650 1:221903671-221903693 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
923450356 1:234111621-234111643 CTGAAGAGCCAGCAGCACAGTGG + Intronic
923514584 1:234683976-234683998 CTGGTCAGCCAGCTGCAGAGGGG + Intergenic
923755311 1:236786043-236786065 CAGGACAACCAGCTGCAGAGGGG + Intergenic
923980076 1:239311628-239311650 CTGCACTACCAGCAGCTGAGGGG + Intergenic
924623870 1:245684813-245684835 CTGGACATGCAGCAGGGGAGGGG - Intronic
924679924 1:246220858-246220880 TGGGACAACCAGCTGCAGAGAGG + Intronic
924679946 1:246220998-246221020 TGGGACGACCAGCTGCAGAGAGG + Intronic
924779489 1:247133315-247133337 CTGGAGTACCAGCAGGAGACAGG + Intronic
1062770014 10:91964-91986 TAGGACAACCAGCTGCAGAGAGG - Intergenic
1063151446 10:3340241-3340263 CTGCACAACCAGCAGATGTGAGG + Intergenic
1064699849 10:18007596-18007618 ATGGGCAACCAGCAGCAATGGGG - Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065407898 10:25389283-25389305 TGGGACAACCAACTGCAGAGAGG + Intronic
1067018069 10:42772252-42772274 CAGGACAACTAGCTACAGAGAGG + Intergenic
1067288107 10:44922084-44922106 CCGGATAACTAGGAGCAGAGTGG - Intronic
1067715796 10:48690614-48690636 AGGGACAACCAGCTGCAGAGAGG - Intronic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068137487 10:52965219-52965241 CAGGACTACCAGCAGCAGGAGGG - Intergenic
1068164011 10:53304540-53304562 CTGGACAACCAGCAGCCCTCCGG - Intergenic
1069592989 10:69653239-69653261 TGGGACAATCAGCTGCAGAGAGG + Intergenic
1069784999 10:70982088-70982110 CTGGTCACCCAGCAGCAGCTGGG - Intergenic
1070859327 10:79638163-79638185 TGGGACGACCAGCTGCAGAGAGG - Intergenic
1071436584 10:85653383-85653405 CTGGACTAAGAGGAGCAGAGAGG + Intronic
1071886015 10:89951552-89951574 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1071886034 10:89951715-89951737 TGGGACAATCAGCTGCAGAGAGG - Intergenic
1072082732 10:92048005-92048027 TTGGAAAAGCAGCAGCAGAAAGG + Intronic
1072617128 10:97057282-97057304 CTGGAGAAAAGGCAGCAGAGAGG + Intronic
1072753338 10:97999825-97999847 CAGGACGACCAGCTGCAAAGAGG + Intronic
1073262487 10:102201089-102201111 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1073511359 10:104044708-104044730 CTGGACAACATGCACAAGAGGGG - Intronic
1073670223 10:105579705-105579727 CAGTACAACCAGCTGCAGAGAGG - Intergenic
1073733609 10:106320476-106320498 CAGGACAACCAGCTACAGAGAGG + Intergenic
1073766515 10:106688510-106688532 CTGGACAAACAACAACAGATTGG + Intronic
1074991512 10:118712684-118712706 TGGGACGACCAGCTGCAGAGAGG - Intronic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076589804 10:131575189-131575211 CTGAGCAGCCAGGAGCAGAGCGG + Intergenic
1076601945 10:131663039-131663061 CTGGACACCCAGCAGGACACAGG + Intergenic
1077318859 11:1931943-1931965 CTGCACACCCAGCCGGAGAGGGG + Intronic
1077376775 11:2208962-2208984 CTGGCCAATGGGCAGCAGAGGGG + Intergenic
1078042758 11:7883963-7883985 CTGGATGATCAGCCGCAGAGAGG - Intergenic
1078315134 11:10288542-10288564 CAGGACAACCAGCTGCAGAGAGG - Intronic
1079184100 11:18221049-18221071 CAGGACAACCAGCTGTGGAGAGG - Intronic
1079510467 11:21204864-21204886 CTAGCAAACCTGCAGCAGAGGGG - Intronic
1079733270 11:23962348-23962370 CGGGACCACCAGCTGCAGAGAGG + Intergenic
1079803173 11:24896431-24896453 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
1079882296 11:25943673-25943695 ATGGAAGACCAGCTGCAGAGAGG - Intergenic
1080583954 11:33665489-33665511 TGGGACAACCAGCAGCAGAGAGG - Intronic
1080966972 11:37224573-37224595 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1081163931 11:39785805-39785827 CAGGATCACCAGCTGCAGAGAGG - Intergenic
1081268625 11:41057792-41057814 TGGGACAACCAGCTGCAGAAAGG + Intronic
1081759640 11:45568244-45568266 CTGGTAAAGCAGCTGCAGAGGGG - Intergenic
1082282439 11:50284337-50284359 TTAGAAAAGCAGCAGCAGAGAGG - Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083971610 11:66080261-66080283 CTGGAGAAGCAGCAGCAGACAGG + Intronic
1085100647 11:73797112-73797134 CGGGACAACCGGCTGCAGAGAGG + Intronic
1086085059 11:82945432-82945454 CAGGACAACCAGCAGTAGAAAGG - Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1087014828 11:93544477-93544499 GTGGAAAACCTGCAGAAGAGTGG - Intergenic
1087239078 11:95755391-95755413 CTGGAGACCCAAAAGCAGAGTGG + Intergenic
1088135685 11:106552831-106552853 TGGGACACCCAGCTGCAGAGAGG + Intergenic
1088345733 11:108822688-108822710 CGGGACATCCAGCTTCAGAGAGG - Intronic
1088401243 11:109423812-109423834 CAGGACAATCAGCACCAGCGTGG - Exonic
1088513304 11:110599744-110599766 CCTGACAACCAGCTGCAGAGAGG + Intronic
1088704246 11:112447683-112447705 TGGGACAACCAACTGCAGAGAGG - Intergenic
1089822505 11:121241314-121241336 CCAGACCACCAGCTGCAGAGAGG - Intergenic
1089847854 11:121472383-121472405 CTGGACAAACAGGAGCCAAGAGG + Intronic
1090124873 11:124075399-124075421 CAGGATGATCAGCAGCAGAGAGG - Intergenic
1090160022 11:124482744-124482766 GTGGAGAAGCAGAAGCAGAGGGG - Intergenic
1090514594 11:127411973-127411995 TGGGACAGCCAGCTGCAGAGAGG - Intergenic
1091344235 11:134842263-134842285 CGGGACAATCAGCAGGAGGGAGG + Intergenic
1091450625 12:570186-570208 CAGCACAACCTGCAGCCGAGGGG + Intronic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092447070 12:8567850-8567872 CTGGACAACCAGCTGCAAAGAGG - Intergenic
1092501432 12:9051264-9051286 CGGGATTACCAGCTGCAGAGAGG + Intergenic
1092508139 12:9125060-9125082 TGGGACAACCAGCTGCACAGAGG + Intergenic
1093492987 12:19725956-19725978 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1093914917 12:24790584-24790606 CTGGTAAACCAGCTGCAGTGAGG + Intergenic
1094388080 12:29917181-29917203 CTGCAGAACCAGAAGAAGAGTGG - Intergenic
1095320229 12:40818283-40818305 TTGGACAACCAGAAGGAGATGGG - Intronic
1095603220 12:44037807-44037829 CAGGACTACCAGCTGCAGAGAGG + Intronic
1095608608 12:44100842-44100864 TTGGACAAGCAGTAGCACAGAGG - Intronic
1095727526 12:45469633-45469655 GGAGACAACCAGCTGCAGAGAGG + Intergenic
1096171972 12:49479072-49479094 AGGGACAACCTGCTGCAGAGAGG - Intronic
1096602150 12:52736967-52736989 CAGGACGACGAGCTGCAGAGAGG - Intergenic
1096602907 12:52742766-52742788 CAGGACGACGAGCTGCAGAGAGG + Intergenic
1097130834 12:56809790-56809812 CGAGACAACCACCTGCAGAGAGG - Intergenic
1097130857 12:56809953-56809975 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1097298947 12:57997867-57997889 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1098143858 12:67478280-67478302 CTGAATAACCAGCTGAAGAGGGG - Intergenic
1098465591 12:70783302-70783324 CTGCACAACCAGTAGCAGAGAGG - Intronic
1099693419 12:85991181-85991203 TGGATCAACCAGCAGCAGAGAGG - Intronic
1099982132 12:89616877-89616899 CAGGAGAACCAGAACCAGAGTGG - Exonic
1100672813 12:96835282-96835304 TCGGACAACCAGGTGCAGAGAGG - Intronic
1100847930 12:98679206-98679228 TGGGACAACCAGCTGCAGAGAGG + Intronic
1100847940 12:98679276-98679298 CAGGAGGACCAGCTGCAGAGAGG + Intronic
1101013781 12:100478138-100478160 TTCAACAACCAGCACCAGAGTGG - Intronic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1102060451 12:109926990-109927012 CGGGACAACCAGCTGCAGAGAGG + Intronic
1102269126 12:111516193-111516215 CTGGAGAACCATGAGCAGAGGGG + Exonic
1103638322 12:122327676-122327698 CTGGGAAACAAGCAGCACAGGGG + Intronic
1103920107 12:124394975-124394997 CTGGAGGATGAGCAGCAGAGGGG - Intronic
1104150827 12:126081240-126081262 CTGGACAAACACCAGCCAAGGGG + Intergenic
1104516422 12:129431322-129431344 CTGGAAAATCTGAAGCAGAGAGG - Intronic
1104629844 12:130391157-130391179 AGGGACAACCAGCAGCACATGGG + Intergenic
1104805573 12:131587177-131587199 AAGGACGACCAGCTGCAGAGAGG + Intergenic
1105048582 12:133027802-133027824 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1105743069 13:23349101-23349123 CTGGAAAACCTGCAGCAGGAGGG + Intronic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106308950 13:28535775-28535797 AAGGACAACCAGCTGCAGAAAGG + Intergenic
1106308965 13:28535894-28535916 CTGGAGGACCAGCAGCAGAGAGG + Intergenic
1106397391 13:29394340-29394362 TGGGACAACTAGAAGCAGAGGGG + Intronic
1106440558 13:29763340-29763362 CGGGACAAGCCGCAGCAGAGTGG - Intergenic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1108240295 13:48457302-48457324 CAGGACGAGCAGCTGCAGAGAGG - Intronic
1108407100 13:50115468-50115490 CAGGAGTACCAGCAGCAGATGGG + Intronic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1108686734 13:52826400-52826422 CCGGACCAGCAGCTGCAGAGGGG + Intergenic
1109416450 13:62046759-62046781 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109525274 13:63566709-63566731 CCAGACGACCAGCTGCAGAGAGG + Intergenic
1109562819 13:64075686-64075708 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1109622177 13:64925229-64925251 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1109633681 13:65085722-65085744 CTGGACAACCAACTGCGGAGAGG - Intergenic
1109939765 13:69346228-69346250 CTGGAATAACAGCAGTAGAGAGG + Intergenic
1109950454 13:69495927-69495949 CTTGACAACCAGCAGCATACTGG - Intergenic
1110624494 13:77637632-77637654 GGGGATCACCAGCAGCAGAGGGG - Intronic
1110796810 13:79647939-79647961 CAGAACAAACATCAGCAGAGAGG - Intergenic
1110810691 13:79808084-79808106 TGGGACAACCAGAAGCAGAGAGG + Intergenic
1110939472 13:81330944-81330966 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1110939478 13:81331006-81331028 TGGGACTACCAGCTGCAGAGAGG + Intergenic
1111274891 13:85935673-85935695 TGAGACAACCAGCATCAGAGAGG + Intergenic
1111333569 13:86792396-86792418 CTGGGCGAGCAGCTGCAGAGGGG + Intergenic
1111512658 13:89287226-89287248 CAGGACTACTAGCTGCAGAGAGG - Intergenic
1111800449 13:92974613-92974635 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1112638391 13:101243816-101243838 CTGGACCACAAGCAGCATACAGG + Intronic
1112755619 13:102629563-102629585 CTGGACAACCAACTGTAGACAGG - Exonic
1113339182 13:109404944-109404966 GGAGACAACCAGCTGCAGAGAGG + Intergenic
1113970733 13:114186257-114186279 CAGGACAACCAGCTTCAGGGAGG + Intergenic
1114281074 14:21192751-21192773 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1114349550 14:21835448-21835470 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1114349557 14:21835516-21835538 CAGGATGACCAGCAGCAGAAAGG - Intergenic
1115485027 14:33901937-33901959 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1116131431 14:40859437-40859459 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1116322157 14:43481797-43481819 ATGGACAAACAACATCAGAGAGG + Intergenic
1116760905 14:49012360-49012382 TGGGAAAACAAGCAGCAGAGAGG - Intergenic
1116862702 14:50007387-50007409 CTGGACAGCCTGCAGTTGAGGGG - Exonic
1118746666 14:68779018-68779040 CAGGACAAACAGCCGGAGAGGGG + Intergenic
1119196477 14:72720498-72720520 CTGGCCAAGCAGCAGCTGAATGG - Intronic
1120590063 14:86364270-86364292 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1121695321 14:95907866-95907888 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1121974089 14:98386096-98386118 TGGGACAACCAGCTACAGAGAGG + Intergenic
1122148354 14:99707587-99707609 CTGGGCACCCAGCAGCATACTGG - Exonic
1122172253 14:99886648-99886670 CTGGGCAACTAGGATCAGAGTGG - Intronic
1122558147 14:102592487-102592509 TTGGACAGCCAGCGGCAGCGGGG - Intergenic
1123216585 14:106813789-106813811 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1123216596 14:106813845-106813867 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1124247671 15:28084880-28084902 CTGGAGAGCGAGCAGCAGTGAGG + Intronic
1124937612 15:34187069-34187091 GAGGACAATCAGCTGCAGAGTGG + Intronic
1124937617 15:34187122-34187144 TGGGACCACCAGCTGCAGAGAGG + Intronic
1125312347 15:38393778-38393800 ATCAACATCCAGCAGCAGAGTGG - Intergenic
1125381562 15:39092258-39092280 CGGGAGGACCAGCTGCAGAGAGG - Intergenic
1125502501 15:40248330-40248352 CTGGACAGCCTGGAGGAGAGGGG + Intronic
1126835085 15:52654319-52654341 TTGGAAAACTAGCAGCATAGAGG - Intronic
1127525891 15:59791886-59791908 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1127918724 15:63476524-63476546 CTGGAAGACCAGGAGCAGGGAGG + Intergenic
1127966127 15:63924185-63924207 CTGGAAAGCCAGCAGCTGACTGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128552887 15:68609606-68609628 CTGGGAGACCAGCAGCAAAGAGG - Intronic
1128706073 15:69838164-69838186 TTGGACAGGCAGGAGCAGAGAGG - Intergenic
1129306863 15:74671662-74671684 CTTGGCAGCCAGCACCAGAGGGG + Exonic
1129377708 15:75144733-75144755 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1129454728 15:75670591-75670613 CAGGGCAGCCAGCAGGAGAGGGG - Intergenic
1129507853 15:76098334-76098356 CTAGCAGACCAGCAGCAGAGGGG - Intronic
1129656852 15:77530100-77530122 CATCACAACCAGAAGCAGAGTGG - Intergenic
1129725415 15:77899163-77899185 CTGCACCTCCAGCAGCACAGTGG - Intergenic
1129800007 15:78406372-78406394 CTGGACTACCAGCTGGAGAGAGG + Intergenic
1130028958 15:80294958-80294980 GGGAACACCCAGCAGCAGAGAGG - Intergenic
1132302411 15:100784204-100784226 CAGGGCAAGCTGCAGCAGAGGGG + Intergenic
1132305368 15:100807996-100808018 CAGGACAACTGGCTGCAGAGAGG + Intergenic
1133915334 16:10104499-10104521 ATGGAAAGCCAGAAGCAGAGGGG - Intronic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1137256431 16:46778677-46778699 TGGGACAACCACCTGCAGAGAGG + Intronic
1137334290 16:47533120-47533142 CAGGACAACCAGGTGCAGAGAGG - Intronic
1137442408 16:48508298-48508320 TTGGAAAACCAGGAACAGAGTGG - Intergenic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138394824 16:56695765-56695787 CAGGACAACCACCTGCAGAAAGG + Intronic
1138394845 16:56695888-56695910 CAGGACAACCAGTAGCAGAGAGG + Intronic
1138406068 16:56795147-56795169 TTGGACAATCAGCAGCATAGCGG + Intronic
1138629446 16:58281759-58281781 CTGAACCACGAGCAGCAGAAAGG + Exonic
1139392822 16:66615982-66616004 CAGGAGAAGCAGCAGCAGAGAGG + Exonic
1139469249 16:67169652-67169674 CTGGACATCCAGCAGGAGTGGGG - Exonic
1141209735 16:81966302-81966324 CTGTACAACAAGCCACAGAGCGG + Intergenic
1141583851 16:85019810-85019832 CTAGACAAACAGGACCAGAGAGG + Intergenic
1141618051 16:85221243-85221265 CTGGCAAACCAGCCGCACAGTGG - Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099374 16_KI270728v1_random:1291932-1291954 CAGGACGACCAGCTGCAGGGAGG + Intergenic
1142794952 17:2300430-2300452 CTGAACAACCAAGAGCAGAATGG - Exonic
1143102731 17:4513255-4513277 CTGGACATCCAGCAGCACTTTGG + Exonic
1143880551 17:10026514-10026536 CTGGACACCCAGAAGCAGCCAGG + Intronic
1144043224 17:11431231-11431253 CTGGACAGTCAGCAGCAGCGAGG - Intronic
1144060905 17:11582929-11582951 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1144386297 17:14751620-14751642 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1144714533 17:17424728-17424750 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
1146459475 17:33033934-33033956 CAGGACGACCAGCTGCAGAGAGG + Intronic
1146533507 17:33630339-33630361 CTGCACAGACAGGAGCAGAGGGG - Intronic
1146559660 17:33857183-33857205 CTGGTTGACCAGCAGCAGAAAGG - Intronic
1146761540 17:35483028-35483050 CAGGACAACCAGCCGCAGAGTGG + Intronic
1148038403 17:44686493-44686515 CAGGAAAAGGAGCAGCAGAGAGG + Intronic
1148187882 17:45657693-45657715 CTTGACAGCCAGAAGAAGAGCGG - Intergenic
1148568562 17:48647955-48647977 CTGGACAACCACCTGCAGGAAGG - Intergenic
1148640379 17:49183333-49183355 CAGGGCAACCAGCTGCAGAGAGG - Intergenic
1148640390 17:49183403-49183425 CAGGACGAACAGCTGCAGAGAGG - Intergenic
1149088728 17:52751668-52751690 CAGGACAATCAACTGCAGAGAGG + Intergenic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1150201458 17:63361966-63361988 GTGTACAACCCTCAGCAGAGAGG + Intronic
1150389141 17:64780778-64780800 CTAGACAACCAGCCCCAGACCGG - Intergenic
1150433109 17:65134425-65134447 CTGAACAGAGAGCAGCAGAGGGG - Intergenic
1150529172 17:65958955-65958977 GGGGACAACCAGCTGCAGAGGGG + Intronic
1150529182 17:65959023-65959045 CAGGACAACCAGCTGCAGAGAGG + Intronic
1150529193 17:65959093-65959115 CGGGACCACCAGCTGCAGATAGG + Intronic
1150952838 17:69822003-69822025 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1151010036 17:70483797-70483819 CTGGACGACCAGCTGCAAAGAGG - Intergenic
1151395262 17:73819139-73819161 CAGGACAACCAGTTGCAGAGAGG - Intergenic
1151449357 17:74188434-74188456 CTTCAAAACCAGCAGGAGAGAGG + Intergenic
1151562532 17:74878259-74878281 CTGGACCAGCAGCAGCAGGAGGG + Exonic
1151773115 17:76177743-76177765 TGGGACCACCAGCTGCAGAGAGG + Intronic
1151873177 17:76850487-76850509 CTGGACAGCCAGCAGCCCTGAGG + Intergenic
1151895179 17:76975168-76975190 CAGGACAGCCGGCTGCAGAGAGG + Intergenic
1152248056 17:79196176-79196198 CTGGAGAAACAGCAGCAGAGTGG + Intronic
1152301326 17:79496635-79496657 AGGGACAGACAGCAGCAGAGGGG + Intronic
1152530395 17:80915109-80915131 TGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530403 17:80915179-80915201 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530412 17:80915247-80915269 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530421 17:80915317-80915339 CAGGAAAACCAGCTGCAGAGAGG + Intronic
1152530430 17:80915387-80915409 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530439 17:80915457-80915479 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530449 17:80915527-80915549 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530460 17:80915597-80915619 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530470 17:80915667-80915689 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152530481 17:80915737-80915759 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530492 17:80915807-80915829 CGGGAAAACCAGCTGCGGAGAGG + Intronic
1152530502 17:80915877-80915899 CGGGAAAACCAGCTGCAGAGAGG + Intronic
1152713168 17:81885041-81885063 CAGGACAGCCAGAGGCAGAGGGG + Intergenic
1153707138 18:7757530-7757552 CTGGGCAGCCAGCAGCAGGTGGG + Intronic
1154507975 18:15061145-15061167 AGGGACAACCAGCGGCAGAGAGG + Intergenic
1155830861 18:30513666-30513688 CAGGACAACCAGTAGTAGAGAGG - Intergenic
1155830866 18:30513721-30513743 ATGGATAACCAGCTGCAGAGAGG - Intergenic
1155904589 18:31434323-31434345 CTGGACATCCACATGCAGAGAGG + Intergenic
1156298756 18:35817593-35817615 GGGGACAACCAGCTGCAGAGAGG - Intergenic
1156327305 18:36085760-36085782 CAAGACGACCAGCTGCAGAGGGG + Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1159035868 18:63276439-63276461 CTGGACAACCTGCAGTACATGGG + Intronic
1159186702 18:64984178-64984200 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1159519055 18:69495476-69495498 TGGGACAACCAGCTGCAGAGAGG - Intronic
1160196117 18:76757005-76757027 CTGGCCAGCCAGTCGCAGAGTGG - Intergenic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1161173185 19:2823714-2823736 CCGGACGACCAGCTGCAGAGAGG - Intronic
1161645923 19:5453417-5453439 GTGGAAAAACAGAAGCAGAGAGG - Intergenic
1161780214 19:6286707-6286729 CGGGACTACCAGCTGCAGAGAGG + Intergenic
1161953838 19:7482212-7482234 CTGCAGGACCAGGAGCAGAGGGG + Intronic
1162045018 19:7993363-7993385 CTGGACACCCTGCTGCTGAGGGG + Intronic
1162543829 19:11315807-11315829 CTTGATAAACAGCAGCAAAGTGG - Intronic
1164571579 19:29378591-29378613 CCAGCCAACCAGCAGCAGACAGG + Intergenic
1166571575 19:43800023-43800045 CTGGACTGTCAGCTGCAGAGAGG - Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166748309 19:45152395-45152417 CTGGAGGACCGGCAGCAGACCGG - Exonic
1166897511 19:46033057-46033079 TGGGACAACCAGCTGCAGAGCGG + Intergenic
1166920561 19:46226560-46226582 CTTGTCAGCCAGCAGCAGAGGGG + Intergenic
1167272305 19:48512222-48512244 GTGGACAGCCATCAGCAGACGGG + Intronic
1167293560 19:48636941-48636963 CGGGCCGCCCAGCAGCAGAGGGG + Exonic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925071321 2:969929-969951 CTGGAGAACCAGAAGCAGACAGG - Intronic
925206377 2:2010501-2010523 ATGGACAGACAGCAGCAGAGTGG - Intronic
925339523 2:3126515-3126537 CTCAACCAGCAGCAGCAGAGGGG + Intergenic
926399769 2:12485514-12485536 CTGGCCAACCAGATTCAGAGGGG - Intergenic
927266861 2:21161935-21161957 TAGGACAACCAGCTACAGAGAGG - Intergenic
927497797 2:23562412-23562434 CTGCACCACCGGCAGCAGCGAGG + Exonic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
927743155 2:25590569-25590591 TGGGACAACCAGCTGCAGAGAGG - Intronic
927875111 2:26650099-26650121 CTGCAGAATGAGCAGCAGAGAGG + Intergenic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
928969058 2:37007793-37007815 CTGGAAAACTAGCATCAGTGAGG - Intronic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929601600 2:43208007-43208029 GTGGAGAAACAGCAGAAGAGGGG + Intergenic
930708492 2:54527718-54527740 ATGGACATCCAGCAGAAAAGAGG + Intronic
930800586 2:55438657-55438679 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
930957301 2:57217835-57217857 CAGGACTACCAGCTGCAGAGAGG + Intergenic
931300517 2:60973895-60973917 GGGGACAACCAACAGCAGAGAGG + Intronic
932485345 2:72081148-72081170 TGGGACAGCCAGCTGCAGAGAGG + Intergenic
932501613 2:72187620-72187642 CAGGACGACCAGCTGCAGAGAGG - Intronic
932522472 2:72427929-72427951 TGGGACAACCAGCTGAAGAGAGG + Intronic
933624672 2:84585624-84585646 CGGGAAAACCAGCTGCAGAGGGG - Intronic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
935518731 2:104078173-104078195 CAGGACGACAAGCTGCAGAGAGG - Intergenic
936658663 2:114517799-114517821 GTGAACACCCAGCTGCAGAGCGG + Intronic
937164006 2:119795104-119795126 TGGGACAACCAACTGCAGAGAGG - Intronic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
938144840 2:128824576-128824598 CCAGCCAACCTGCAGCAGAGGGG + Intergenic
938244991 2:129769506-129769528 ATGGACAGACAGCAGCAGATAGG - Intergenic
938261418 2:129897869-129897891 CCAGACAACAAGCAGCAAAGTGG + Intergenic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
940612174 2:156006254-156006276 TGGGACAACCAGCTGCAGAGAGG - Intergenic
941541865 2:166795932-166795954 GTGGACAACCACCAGCTGGGAGG + Intergenic
941547323 2:166868252-166868274 CTGGCCACACAGCAGGAGAGCGG + Intergenic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
943182319 2:184560296-184560318 CAGGACTACCAGCTGCAGAGAGG - Intergenic
943426975 2:187749800-187749822 CAGGACAAACAGCTGCAGAGAGG - Intergenic
943526307 2:189021053-189021075 CAGGACAACCAACTGCAGAGAGG + Intergenic
943820398 2:192314641-192314663 CAGGACAACCAGCTGCAGAGAGG - Intergenic
944483855 2:200182669-200182691 TGGGAAAACCAGCTGCAGAGAGG + Intergenic
944483861 2:200182735-200182757 CGGTACTACCAGCTGCAGAGAGG + Intergenic
944557709 2:200904473-200904495 CTGCCCAACCAGCAGCAGGCAGG - Intergenic
944901792 2:204223360-204223382 CGGGACGACCGGCTGCAGAGAGG - Intergenic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
946414911 2:219535098-219535120 GTGGCCCACCAGCTGCAGAGAGG - Intronic
947316708 2:228866622-228866644 CAGGACAACCAGCTGCAGAGAGG + Intronic
947316719 2:228866690-228866712 TGGGACAACCAGCTGCAGAGAGG + Intronic
947688417 2:232112200-232112222 CTGGCAAGCAAGCAGCAGAGTGG - Intronic
948029031 2:234801293-234801315 CTGGGGAACCAGCAGCCGGGTGG + Intergenic
948575364 2:238946468-238946490 CAGGATAACCAGCTGCAGAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1169067993 20:2705338-2705360 CTGGAAAACAAGAGGCAGAGTGG - Intronic
1169165858 20:3423464-3423486 TAGGAAAACGAGCAGCAGAGTGG - Intergenic
1170043819 20:12065257-12065279 CGAGACAACCAGCTGCAGACAGG - Intergenic
1170495046 20:16915732-16915754 CTGGACAACCAGCTACAGAGAGG + Intergenic
1171021921 20:21592293-21592315 CTGGACAGCCACCAGCTGTGTGG - Intergenic
1172167530 20:32908107-32908129 CGTCACACCCAGCAGCAGAGAGG - Intronic
1172610378 20:36246634-36246656 CTGGACAGCCAGCAACACCGTGG - Intronic
1172676723 20:36677532-36677554 CTGGACAACCAGCTGCAGAGAGG + Intronic
1173207578 20:41006977-41006999 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1173524429 20:43721235-43721257 TGGGACAAACAGTAGCAGAGAGG - Intergenic
1173798282 20:45878041-45878063 CTGGACACCTTGCACCAGAGTGG + Exonic
1174816630 20:53692678-53692700 CTGGACATACAGCAGCAAATGGG - Intergenic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1175116132 20:56683811-56683833 CTGGAGCAGAAGCAGCAGAGAGG + Intergenic
1175478621 20:59295443-59295465 CTCCAGAACCAGCAGCAGAATGG - Intergenic
1175675847 20:60945954-60945976 CAGGATGACCAGCAGCAGACAGG + Intergenic
1175959884 20:62630672-62630694 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1175969015 20:62674538-62674560 CTTGACCACTGGCAGCAGAGAGG - Intronic
1176145556 20:63563846-63563868 CGGGGCCACCAGCAGCAGGGCGG - Exonic
1176408452 21:6434535-6434557 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1176790106 21:13310652-13310674 AGGGACAACCAGCGGCAGAGAGG - Intergenic
1176976528 21:15327309-15327331 CAGGACAACAAGCTGCAGAGAGG + Intergenic
1177357804 21:20031551-20031573 CGGGACAACCAGCTGCTGAGAGG - Intergenic
1177396048 21:20537852-20537874 CGGGACGACCAGCAGCACAAAGG - Intergenic
1177989287 21:28018850-28018872 TGGGACAACCAGCGGCAGAGAGG - Intergenic
1178909650 21:36664287-36664309 CTGGAGAAGCAGCAGGAGTGAGG + Intergenic
1179683945 21:43042861-43042883 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1180178906 21:46109212-46109234 CAGGACGACCAGCTGCAGAGAGG - Intronic
1182237224 22:28884590-28884612 CTGGACAAGCAGCAGCAGGCAGG + Intronic
1182398428 22:30054881-30054903 CTGGACAAACAGATGCAGTGTGG + Intergenic
1182556989 22:31134485-31134507 CTGGAGGAGCAGCAGGAGAGAGG - Exonic
1183024943 22:35058057-35058079 TGGGACAACCAGCTGCAAAGAGG - Intergenic
1183589664 22:38772667-38772689 CTGGGGAAGCAGCCGCAGAGGGG - Intronic
1184054239 22:42033759-42033781 TGGGACGACCAGCTGCAGAGAGG - Intronic
1184069349 22:42138422-42138444 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184636093 22:45832978-45833000 CAGGACAACCTTCAGCAGAAAGG - Intronic
1184865801 22:47201383-47201405 CAAGACGACCAGCTGCAGAGAGG - Intergenic
1184918104 22:47587104-47587126 CAGGACAGCCAGCAGGAGAGAGG - Intergenic
949218531 3:1600966-1600988 CGGGACAACCAGCTGCAGAATGG - Intergenic
949724486 3:7027580-7027602 GTGGAGAGCCAGCAGAAGAGAGG - Intronic
950207626 3:11092694-11092716 CAGTACAGCCAGCTGCAGAGAGG + Intergenic
950432742 3:12960353-12960375 GTGCACTACCATCAGCAGAGTGG - Intronic
950637458 3:14324828-14324850 CTTCACGCCCAGCAGCAGAGTGG - Intergenic
950702062 3:14757630-14757652 CTCTACAACCACCAGCAGCGGGG + Exonic
951182250 3:19672142-19672164 GGGGACAACCAGCTGCAGAGAGG - Intergenic
951347122 3:21560407-21560429 CTAGCAAACCTGCAGCAGAGGGG - Intronic
952661520 3:35855715-35855737 CTGGATACTCAGTAGCAGAGAGG - Intergenic
953416486 3:42722728-42722750 ATGGACAACCAGCAGCCCTGGGG + Intronic
953844907 3:46419399-46419421 ATGGACAACCACCAGCAGCCGGG + Intergenic
954099347 3:48357585-48357607 CAGGATTACCAGCTGCAGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
955241469 3:57182407-57182429 TGGGACAACCAGTTGCAGAGAGG - Intergenic
955241485 3:57182524-57182546 CAAGACAACCAGCAGCAGAGAGG - Intergenic
956462275 3:69484690-69484712 CTGGACAACCAGCAGCAGAGAGG - Intronic
956746166 3:72312470-72312492 CTGTCCAACCAGCAGCACGGAGG + Intergenic
956989958 3:74751663-74751685 CAGGACAACCAGCCGTAGAGAGG - Intergenic
957625868 3:82651093-82651115 CGGGACTACCAGCTGCAGAAAGG + Intergenic
957678783 3:83404511-83404533 CAGGAGTACCAGCTGCAGAGAGG + Intergenic
957678787 3:83404565-83404587 CGGAACAACCAGTTGCAGAGAGG + Intergenic
957845152 3:85722136-85722158 CAGGATAACCAGCTGCAGAGAGG - Intronic
957845162 3:85722204-85722226 CAGGATAACCAGCTGCAGAGAGG - Intronic
957923099 3:86772345-86772367 CAGAACAACTAGCTGCAGAGAGG + Intergenic
958195337 3:90235868-90235890 CCAGACAACCAGCTGCAGAAAGG + Intergenic
958418749 3:93907260-93907282 CCAGACAACCAGCTGCAGAAAGG + Intronic
958418769 3:93907391-93907413 TGGGACAACCAGCTGCAGACAGG + Intronic
958636264 3:96750642-96750664 CAGGAGGACCAGCTGCAGAGAGG + Intergenic
959863660 3:111242810-111242832 TAGGATGACCAGCAGCAGAGAGG - Intronic
959932484 3:111999303-111999325 CTGGCCCAGCAGCAGCAAAGAGG - Exonic
960011122 3:112835439-112835461 TGGGCCAACCAGCTGCAGAGAGG - Intronic
960208239 3:114929264-114929286 CTGAAAAAACAGAAGCAGAGAGG + Intronic
960763211 3:121096593-121096615 CCAGCCAACCTGCAGCAGAGGGG - Intronic
961493608 3:127274625-127274647 CTGGACAACCAGCTGCAGAGAGG + Intergenic
961623848 3:128245502-128245524 CTGGACAGGGAGAAGCAGAGTGG + Intronic
961850738 3:129815535-129815557 ATGGACAACCACCTGCAGAATGG + Intronic
961932318 3:130547280-130547302 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
962188687 3:133287457-133287479 CAGGACAACCTACAGAAGAGAGG - Intronic
962824500 3:139088269-139088291 TGGGATGACCAGCAGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
963583336 3:147154226-147154248 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
964255018 3:154766335-154766357 TGGGATGACCAGCAGCAGAGGGG - Intergenic
964791779 3:160460030-160460052 TGGGACAACCAGTTGCAGAGAGG - Intronic
964996792 3:162891871-162891893 CTGGACAACCAGTTACAAAGAGG + Intergenic
965541449 3:169875458-169875480 GGGAACAACCAGCTGCAGAGAGG + Intergenic
965720999 3:171662143-171662165 CAGACCAATCAGCAGCAGAGCGG + Exonic
965793060 3:172410745-172410767 CTGGAAAACCAGCTGCAGAGAGG - Intergenic
966256133 3:177918061-177918083 CTGGACCAGCAGCTACAGAGAGG + Intergenic
966256144 3:177918129-177918151 TTTGACAACCAGCAGCACAAAGG + Intergenic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
966491518 3:180532310-180532332 CAGGACAACCAGCTGTAGAGAGG + Intergenic
966840189 3:184081781-184081803 CAGGACGACCAGCTGCATAGAGG + Intergenic
967111303 3:186296499-186296521 CTGGCCAGCCAACAGCAGAGAGG + Intronic
967326084 3:188241239-188241261 CAGGGCAAACAGCTGCAGAGAGG - Intronic
967649851 3:191973317-191973339 ATGGGTGACCAGCAGCAGAGAGG - Intergenic
968538649 4:1151022-1151044 CAGGGCAACCAGATGCAGAGAGG - Intergenic
968925506 4:3545258-3545280 CTGGACACACAGATGCAGAGAGG - Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
970155256 4:13134840-13134862 CTGGAGTACCAGAAGCAGATGGG + Intergenic
970597973 4:17617169-17617191 GTGATCACCCAGCAGCAGAGAGG - Intronic
972072596 4:35039181-35039203 CCGGACGACCAGCTGCAGAAAGG + Intergenic
972158797 4:36198234-36198256 CAGGACGACCAGCTGCAGGGAGG - Intronic
972203955 4:36748221-36748243 CGGGACTACCAACAGCACAGAGG + Intergenic
972358235 4:38302972-38302994 TGGGGCAACCAGCTGCAGAGAGG - Intergenic
972358244 4:38303029-38303051 CAGGACAACCCGCTGCAGAGAGG - Intergenic
972627495 4:40815019-40815041 CTGGGCAAAAAGCATCAGAGGGG + Intronic
972886495 4:43497261-43497283 TCTGACAACCAGCAGCAGAGGGG - Intergenic
972930991 4:44071575-44071597 AAGGACAATCAGCTGCAGAGAGG - Intergenic
972977164 4:44650027-44650049 ATTGATAACCAGGAGCAGAGTGG - Exonic
973026878 4:45284109-45284131 CTGTACAGCCCTCAGCAGAGAGG + Intergenic
973045386 4:45530596-45530618 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
973336912 4:48965919-48965941 CAGGGCAACTAGAAGCAGAGGGG - Intergenic
973603711 4:52566250-52566272 ATGGCCACCCAGGAGCAGAGTGG + Intergenic
974972969 4:68853827-68853849 CAGGACAACCAGCTGCAGAGAGG - Intergenic
974972976 4:68853897-68853919 CGGGACAACAAGCTGCAGAGAGG - Intergenic
975305758 4:72847122-72847144 CTAGCCAACCTGCAGCAGAAGGG + Intergenic
975597759 4:76066568-76066590 TGGGATGACCAGCAGCAGAGAGG - Intronic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
976092818 4:81474551-81474573 CCAGCAAACCAGCAGCAGAGGGG + Intronic
976675455 4:87697704-87697726 AGGGACAATCAGCTGCAGAGAGG - Intergenic
976679887 4:87745248-87745270 CCAGACGACCAGTAGCAGAGAGG - Intergenic
976700821 4:87966824-87966846 AGGGACAGCCAGCAGCAGAGAGG + Intergenic
976734495 4:88296401-88296423 CAGGACAACCAGCTGCAGAGAGG - Intergenic
976815814 4:89148062-89148084 TGGGACAACCAGCTGCAGAGAGG - Intergenic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977471877 4:97452572-97452594 CTGGACAACCAACTACAAAGAGG + Intronic
977471891 4:97452706-97452728 CAGGACTACCAGCTGCAGAGAGG + Intronic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
977575164 4:98666744-98666766 ATGGCCAACCACCAGCAGTGGGG + Intergenic
977586867 4:98783808-98783830 CAGGACACACAGCAGCAGAGAGG + Intergenic
977860895 4:101958529-101958551 CTGGAAAAATAGCAGCAGATGGG - Intronic
978229865 4:106385594-106385616 TGGGATAACCAGCTGCAGAGAGG - Intergenic
978466256 4:109012617-109012639 CTGGGCCAGCAGCTGCAGAGGGG + Intronic
978514611 4:109557544-109557566 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic
978663402 4:111154468-111154490 CAAGACTACCAGCTGCAGAGAGG - Intergenic
979145397 4:117240119-117240141 CTGGAAGACCAGCTGCTGAGAGG + Intergenic
979417557 4:120461545-120461567 CTGGCAGACCTGCAGCAGAGGGG + Intergenic
979649463 4:123113993-123114015 CAGGATGACCAGCAGCAGAGAGG - Intronic
979671717 4:123366607-123366629 CTAGAGCAGCAGCAGCAGAGAGG + Intergenic
979678613 4:123435590-123435612 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
980180260 4:129392913-129392935 CAGGACAACCAGCTGCAGAGAGG + Intergenic
980243227 4:130203234-130203256 CAGTGCAACCAGCTGCAGAGAGG + Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
982392279 4:154877615-154877637 CTGCAGAACCAGCTGCTGAGAGG + Intergenic
983651497 4:170040727-170040749 TGGGACCACCAGCTGCAGAGAGG + Intergenic
984088404 4:175340401-175340423 CCTGAGAAGCAGCAGCAGAGAGG - Intergenic
985420859 4:189783965-189783987 GTGGCCAGCCAGCAGGAGAGAGG - Intergenic
985799586 5:1995795-1995817 CTAGACCCCCAGCTGCAGAGAGG + Intergenic
986215059 5:5712522-5712544 CAGGACAGTCAGCTGCAGAGAGG - Intergenic
986923550 5:12717588-12717610 TGGGACAGCCAGCTGCAGAGTGG + Intergenic
987567248 5:19606562-19606584 CTGAACAAACAGCAGAAGAAAGG + Intronic
987798886 5:22667280-22667302 CGGGACAACCAGCTGCAGAGAGG - Intronic
988093185 5:26569010-26569032 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
988776109 5:34479343-34479365 CTGGGCAACCAGCAACGGTGTGG - Intergenic
990308212 5:54514549-54514571 CAGGACAGCCAACTGCAGAGAGG - Intergenic
990923459 5:60993770-60993792 CAGGACAACAAGCTGCAAAGAGG - Intronic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
991359277 5:65803019-65803041 CAGGACAACCAGCTGCAGAGAGG - Intronic
992693081 5:79259102-79259124 TGGGACAACCAGCTTCAGAGAGG - Intronic
994473414 5:100238433-100238455 CTGCAGAAGCAGTAGCAGAGAGG + Intergenic
994828075 5:104742415-104742437 CTGGAAAAACAGTAGCAAAGAGG - Intergenic
995744932 5:115393464-115393486 CAGCACAACCAGTAGCAGAGAGG - Intergenic
995744941 5:115393532-115393554 CAGGACGACCAGCTGCAGATAGG - Intergenic
995744952 5:115393602-115393624 TGGGACCACCAGCTGCAGAGAGG - Intergenic
996086203 5:119308222-119308244 CTGGAAAACCTGCAGGAAAGAGG - Intronic
996234419 5:121108591-121108613 CCGGCGGACCAGCAGCAGAGAGG - Intergenic
996511298 5:124319066-124319088 CTGGACACCCAGCTCCAGACAGG + Intergenic
996747092 5:126854748-126854770 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
996923808 5:128799827-128799849 CAGGACAACCAGCTGCACAGAGG - Intronic
996923830 5:128799957-128799979 CCAGACAACCAGCCGCAGAGAGG - Intronic
999170085 5:149586589-149586611 CTGGATACACAGCATCAGAGTGG - Intronic
999643401 5:153694820-153694842 CTGCACAACCATCAGTAGAAAGG - Intronic
999799383 5:155019393-155019415 GGGGACAACCAGCTGCAGAGCGG - Intergenic
1000426238 5:161093977-161093999 TGGGACTACCAGCTGCAGAGAGG + Intergenic
1000586092 5:163100744-163100766 AGGCACAACCAGGAGCAGAGGGG - Intergenic
1002001849 5:176200481-176200503 TAGGAGAGCCAGCAGCAGAGAGG + Intergenic
1002252489 5:177938497-177938519 TAGGAGAGCCAGCAGCAGAGAGG - Intergenic
1002352019 5:178590027-178590049 CTGGACACCCAGCAGCAGGCAGG + Exonic
1002902000 6:1417207-1417229 CTGGGCGCCCAGCAGCAGATGGG + Intergenic
1003289983 6:4772255-4772277 CTGGCCAAGGAGCAGCAGTGTGG + Intronic
1004279870 6:14271473-14271495 CAGGAAGACCAGCTGCAGAGGGG - Intergenic
1004304515 6:14487803-14487825 CGGGACGACCAGCTGCAGAGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1005775871 6:29130209-29130231 CAAGACAACCAGCTGCAGAGAGG + Intergenic
1005781962 6:29201731-29201753 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1006225923 6:32535869-32535891 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1006867585 6:37222032-37222054 TAGGACGACCAGCTGCAGAGAGG - Intronic
1006946047 6:37785141-37785163 CTGAATAACCACCAGGAGAGAGG + Intergenic
1007649996 6:43413332-43413354 GGGGACAACCAGGAGCAGAGAGG + Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1011530128 6:88312423-88312445 TGGGACAACTGGCAGCAGAGAGG - Intergenic
1012141847 6:95635336-95635358 CGGGTCAACCAGCAGCAGAGAGG + Intergenic
1012141987 6:95636276-95636298 CAGGTCAACCAGCTGCAGAGAGG - Intergenic
1013086330 6:106861080-106861102 CAGGATAAGCAGCTGCAGAGAGG - Intergenic
1013375564 6:109510374-109510396 CAGGACGACCAACTGCAGAGAGG + Intronic
1013375568 6:109510427-109510449 CAGAACAACCAGTTGCAGAGAGG + Intronic
1013375584 6:109510544-109510566 CAGGACAACCAGTAGCAGAGAGG + Intronic
1014289317 6:119539977-119539999 CTGGACTACCAACTGCAGAGAGG + Intergenic
1015663766 6:135604051-135604073 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1017329723 6:153182236-153182258 CTGTACAATGAGCATCAGAGTGG + Intergenic
1017420486 6:154267869-154267891 CCTGACAACCAGCTGCAGGGAGG - Intronic
1018064942 6:160118381-160118403 TGGGACAACCAGCTGCAGAAAGG - Intergenic
1019296066 7:276131-276153 TGGAACAACCAGCTGCAGAGAGG - Intergenic
1020009897 7:4802060-4802082 CTGGGCAGCCTGCAGCAGAAGGG + Intronic
1020034912 7:4958988-4959010 CTGGAAATCCAGCAGCCGGGGGG + Exonic
1020104492 7:5415745-5415767 CTGGACAACCACCTGGAGATGGG - Intronic
1020333509 7:7043020-7043042 CTAGCAAACCTGCAGCAGAGGGG + Intergenic
1020812415 7:12863848-12863870 CAGGATAACCAGCAGCATAGAGG - Intergenic
1020812425 7:12863918-12863940 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1021097281 7:16548083-16548105 CAGGACGACCAGCTGCAGAGAGG + Intronic
1022423406 7:30245787-30245809 CCAGACAACCAGCTGCAGAGAGG - Intergenic
1023007355 7:35886459-35886481 TTAGAAAAGCAGCAGCAGAGAGG + Intronic
1023014199 7:35950630-35950652 TTAGAAAAGCAGCAGCAGAGAGG + Intergenic
1023256876 7:38321231-38321253 CTGCACATAGAGCAGCAGAGGGG + Intergenic
1023790406 7:43749467-43749489 CGGGACTACCAGCTGCAGAGAGG - Intergenic
1023790412 7:43749533-43749555 CAGGACGATCAGCTGCAGAGAGG - Intergenic
1024066797 7:45744376-45744398 TTAGAAAAGCAGCAGCAGAGAGG - Intergenic
1024832499 7:53477949-53477971 CTGGAGTAACTGCAGCAGAGGGG - Intergenic
1027333681 7:77126561-77126583 TGGGACAACCAGTAGTAGAGAGG - Intronic
1027365005 7:77448139-77448161 ATGGACAACCAGCAGCCCTGAGG - Intergenic
1027529963 7:79317948-79317970 CTGGTCAAAGAGCAGCAAAGAGG - Intronic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1028816858 7:95156755-95156777 CGAGACTACCAGCTGCAGAGTGG - Intronic
1029327644 7:99823585-99823607 TTAGACAACCAGCAGCAGAGAGG + Intergenic
1029782112 7:102744771-102744793 CAGGACAACCAGTAGTAGAGAGG + Intergenic
1029973736 7:104814228-104814250 TGGGACAACCAGCTGCAGAGAGG - Intronic
1031248651 7:119350739-119350761 CAGGACAACCAGCTGCAGAGAGG + Intergenic
1031265327 7:119573084-119573106 TAGGACAAACAGCTGCAGAGAGG + Intergenic
1031786608 7:126041069-126041091 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1031941847 7:127797669-127797691 TTGGGCCACCAGCAGCAAAGTGG - Intronic
1032658296 7:133955353-133955375 CGGGACAACCAGCTGCAGAGAGG - Intronic
1032699077 7:134363006-134363028 CTGGGCAAGCAGAAGCAAAGCGG - Intergenic
1032717499 7:134522471-134522493 CTGGACAACTCGAAGCAGGGAGG - Intergenic
1034210377 7:149358015-149358037 CGGGACAACCAGCTGCAGAAGGG - Intergenic
1034406393 7:150905702-150905724 CAGGACGACCAGCTGCAGAGAGG - Intergenic
1034481238 7:151321511-151321533 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1035415698 7:158683745-158683767 CTGGACAACCTTCAGAAGACTGG + Intronic
1035434513 7:158849646-158849668 CAGGACGACCAGCTGCAGAGCGG - Intergenic
1035540866 8:436732-436754 CGGGAAAAACATCAGCAGAGAGG + Intronic
1036752062 8:11449654-11449676 CAGGCCACCCAGCAGCAGTGGGG + Intronic
1036915418 8:12799574-12799596 TGGGACAACCAGCCGCAGAGAGG - Intergenic
1037763463 8:21757145-21757167 GAGCACAGCCAGCAGCAGAGGGG + Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1038149351 8:24928404-24928426 CAGGACAACCAGCTGCAAAGAGG + Intergenic
1039559376 8:38500354-38500376 TTGGAGACCCAGAAGCAGAGAGG - Intergenic
1040003698 8:42600286-42600308 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1040965572 8:53077847-53077869 CTGGACCAGCAGCTGCATAGGGG - Intergenic
1041712070 8:60903795-60903817 CTGGAAAACCACCACCGGAGGGG + Intergenic
1042004949 8:64169589-64169611 CAAGACGACCAGCTGCAGAGAGG + Intergenic
1042191808 8:66194635-66194657 CTGGCCAACGAGCAGCAGAACGG + Intergenic
1042687834 8:71461924-71461946 TGGGACAACCAGCTGCAGAGAGG - Intronic
1043230001 8:77789051-77789073 CAGGCCAGCCAGGAGCAGAGGGG - Intergenic
1043568073 8:81570591-81570613 CGGGACAACCAGCTGCAGAGAGG - Intergenic
1043655742 8:82663016-82663038 CTGGTCATGAAGCAGCAGAGAGG + Intergenic
1043750298 8:83926263-83926285 CAGGAAGACCAGCTGCAGAGAGG - Intergenic
1043758323 8:84031848-84031870 TGGGACAATCAGCTGCAGAGAGG + Intergenic
1044008660 8:86965953-86965975 CAGGAGGACCAGCTGCAGAGAGG - Intronic
1044524942 8:93241480-93241502 TGGGACAGCCAGCTGCAGAGAGG - Intergenic
1044927899 8:97224691-97224713 CTGCAGAAGCAGCGGCAGAGGGG - Intergenic
1046260321 8:111758975-111758997 CTGGGCCAGCAGCTGCAGAGGGG - Intergenic
1047052299 8:121126335-121126357 CTGGAAATCCAGTAGCAGAGTGG + Intergenic
1048421673 8:134283911-134283933 CTGCACAACTCTCAGCAGAGAGG + Intergenic
1048465176 8:134659594-134659616 CTGGAGAACAATCATCAGAGAGG - Intronic
1049021784 8:139961960-139961982 TGGGACAACCAGCTGCAGAGAGG + Intronic
1049506612 8:143004354-143004376 CTGGAAAACCAGCATGAGATAGG - Intergenic
1049824024 8:144655335-144655357 CAGGACAACCAGCTGAAGAGAGG + Intergenic
1050130526 9:2407082-2407104 CGGGACTACCAGCTGCAGAAAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1053128206 9:35599652-35599674 CAGGACAATCAGCTGCAGAGAGG + Intergenic
1053128216 9:35599719-35599741 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1053800394 9:41760440-41760462 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054144802 9:61554395-61554417 CTGGACACGCAGGTGCAGAGAGG + Intergenic
1054188823 9:61972592-61972614 CTGGACACGCAGATGCAGAGAGG - Intergenic
1054464493 9:65485352-65485374 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054649698 9:67616025-67616047 CTGGACACGCAGATGCAGAGAGG + Intergenic
1054933381 9:70660399-70660421 CAGGACAACTCGAAGCAGAGAGG - Intronic
1055230454 9:74057986-74058008 CAAGACAATCAGCTGCAGAGAGG + Intergenic
1055706430 9:79010351-79010373 CTCAACAGCCAGAAGCAGAGAGG - Intergenic
1056192002 9:84194233-84194255 CAGGACAACCAGTAGCAGGGAGG - Intergenic
1056192011 9:84194286-84194308 CAGGACCACCAGCTACAGAGAGG - Intergenic
1056986137 9:91364782-91364804 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1056986154 9:91364918-91364940 TAGGACAACCAGCTGCAGAGAGG + Intergenic
1057468583 9:95337892-95337914 TGGGACAACCAGCTGCAAAGAGG + Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057510794 9:95678289-95678311 CAGGAGGACCAGCTGCAGAGAGG - Intergenic
1058091957 9:100814630-100814652 CAGGACTACCAGCTGCAGAGAGG + Intergenic
1058620629 9:106879200-106879222 CTGGGCAAGCAGCAGCATGGGGG + Intronic
1061479064 9:130887557-130887579 CTGGACCCCGAGAAGCAGAGGGG - Intronic
1062184765 9:135212037-135212059 CAGGACGACCAGCTGCAGAGAGG + Intergenic
1062287262 9:135778689-135778711 CTGGACAGCCTGCTGCAGTGTGG + Exonic
1062400689 9:136371431-136371453 CTGGACATCCTGCAGCGGACCGG - Exonic
1203441894 Un_GL000219v1:16440-16462 CAGGACAGCCAGGAGGAGAGAGG - Intergenic
1203512702 Un_KI270741v1:135349-135371 CAGGACAGCCAGGAGGAGAGAGG - Intergenic
1188756539 X:33969561-33969583 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1188859849 X:35243966-35243988 CAGGACAACCAGCTGCAGAGAGG - Intergenic
1189083608 X:37997940-37997962 TGGGACCACCAGCTGCAGAGAGG + Intronic
1189856332 X:45228885-45228907 TGGGGCAACCAGCTGCAGAGAGG - Intergenic
1189929092 X:45988991-45989013 CTGGGCACTCAGTAGCAGAGTGG - Intergenic
1190444835 X:50514461-50514483 TGGGACAACCAGCTGCAGAGAGG - Intergenic
1190619618 X:52272335-52272357 CTGGACAACTCGAAGCAGGGAGG - Intergenic
1190620659 X:52284422-52284444 CAGGACGACCAGTTGCAGAGGGG - Intergenic
1190681771 X:52831837-52831859 TGGGACGACCAGCTGCAGAGAGG + Intergenic
1190998859 X:55637836-55637858 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1192265301 X:69533585-69533607 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1192542117 X:71982903-71982925 CTGGACAACCAGCTTCAAATTGG - Intergenic
1192961375 X:76134863-76134885 CTGGAGACTCAGAAGCAGAGAGG + Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1194205029 X:91002494-91002516 ACAGACAACCAGCTGCAGAGAGG - Intergenic
1195126550 X:101814149-101814171 TGGGACAACCAGCTGCAGAGAGG + Intergenic
1196679239 X:118453963-118453985 CTGGAGAAGCAGCAGCAGCTGGG + Intergenic
1196838395 X:119834926-119834948 CTGGAGATTCAGCAGCAGAAAGG - Exonic
1197952100 X:131908425-131908447 CAGGACGACCAGCTACAGAGGGG + Intergenic
1198500224 X:137237066-137237088 CTGTACAGCCAGCAGCATATTGG + Intergenic
1199103826 X:143838132-143838154 CAGGACAACCACCTGCAGAGAGG + Intergenic
1199103855 X:143838268-143838290 CAGGACAACCAGCTTTAGAGTGG + Intergenic
1199359992 X:146906947-146906969 CAGGACTACCAGCTGCAGAGAGG - Intergenic
1199360001 X:146907027-146907049 CAGGATGACCAGCAGCAGAGAGG - Intergenic
1199614812 X:149647974-149647996 CGGGACAACCAGCTTCAGAGAGG + Intergenic
1200252095 X:154559199-154559221 CCCGACTCCCAGCAGCAGAGCGG + Intronic
1200265673 X:154645217-154645239 CCCGACTCCCAGCAGCAGAGCGG - Intergenic
1200955319 Y:8938473-8938495 CTGGGCCAGCAGCTGCAGAGGGG + Intergenic