ID: 956462330

View in Genome Browser
Species Human (GRCh38)
Location 3:69484983-69485005
Sequence CCTCCTGGGCAGAAGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 618
Summary {0: 1, 1: 0, 2: 5, 3: 97, 4: 515}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956462330_956462343 12 Left 956462330 3:69484983-69485005 CCCCCCACCTTCTGCCCAGGAGG 0: 1
1: 0
2: 5
3: 97
4: 515
Right 956462343 3:69485018-69485040 CGTGACCATCCATGGCACCCAGG 0: 1
1: 0
2: 1
3: 15
4: 148
956462330_956462345 19 Left 956462330 3:69484983-69485005 CCCCCCACCTTCTGCCCAGGAGG 0: 1
1: 0
2: 5
3: 97
4: 515
Right 956462345 3:69485025-69485047 ATCCATGGCACCCAGGCTGCTGG 0: 10
1: 8
2: 19
3: 39
4: 296
956462330_956462347 27 Left 956462330 3:69484983-69485005 CCCCCCACCTTCTGCCCAGGAGG 0: 1
1: 0
2: 5
3: 97
4: 515
Right 956462347 3:69485033-69485055 CACCCAGGCTGCTGGCACCAAGG 0: 3
1: 14
2: 15
3: 74
4: 497
956462330_956462339 4 Left 956462330 3:69484983-69485005 CCCCCCACCTTCTGCCCAGGAGG 0: 1
1: 0
2: 5
3: 97
4: 515
Right 956462339 3:69485010-69485032 CTGCCTCCCGTGACCATCCATGG 0: 1
1: 1
2: 4
3: 30
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956462330 Original CRISPR CCTCCTGGGCAGAAGGTGGG GGG (reversed) Intronic
900291851 1:1927067-1927089 CGGCCTGGGCCGATGGTGGGTGG - Intronic
900504096 1:3020631-3020653 CCGCTTGGGGAGAAAGTGGGAGG - Intergenic
901221713 1:7587164-7587186 CCTCTGTGGCAGGAGGTGGGGGG + Intronic
901414489 1:9107191-9107213 CCTTCTGGAGAGGAGGTGGGTGG - Intronic
901632416 1:10654373-10654395 CTTCGTGGGCAGAAGCGGGGAGG - Intronic
901643430 1:10704559-10704581 CCTCCTGGGGGGAAGGGGGCCGG + Intronic
901685406 1:10940903-10940925 CCCCGTGGGGAGAAGGTGGGTGG - Intergenic
901788036 1:11637537-11637559 CCTCCTGGGCAGGGTGTGAGGGG - Intergenic
902696852 1:18145924-18145946 CCTCCTGGGCAGAAAGGGACAGG + Intronic
903027230 1:20438125-20438147 CTTGGTGGGCAGGAGGTGGGAGG - Intergenic
903650202 1:24917340-24917362 TCTCATGGGCAGCAGCTGGGTGG - Intronic
903833779 1:26189955-26189977 GCTCTTGGCCAGAGGGTGGGTGG + Intergenic
904403997 1:30274521-30274543 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
904461022 1:30679858-30679880 GCTCCTGGACAGAAGGTGGCAGG + Intergenic
904577451 1:31514202-31514224 AGTCCTGGGCAGAAGGGGGCAGG - Intergenic
904597551 1:31656392-31656414 CCTCCTGGTCCCAAGGTGAGTGG - Exonic
905371404 1:37484451-37484473 CCTCCTGGGGTGAAGGAGGTCGG - Intergenic
907020180 1:51059519-51059541 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
907369651 1:53992657-53992679 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
908673644 1:66576888-66576910 CTGCTTGGGGAGAAGGTGGGAGG - Intronic
909238327 1:73180855-73180877 GCTCCTGGGCAGAAGGGGGCGGG - Intergenic
909593831 1:77381981-77382003 CTCCCTGTGCAGAGGGTGGGTGG - Intronic
910082844 1:83362101-83362123 TGTGCTGGGCAGAAGGTGGGGGG + Intergenic
910259843 1:85284226-85284248 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
910377464 1:86588031-86588053 CCTCTGGGGCAGGAGGTTGGAGG - Intergenic
912309622 1:108607222-108607244 CCTCCTGGACACCAGGTGGCTGG + Intronic
912544581 1:110441538-110441560 CCTCCTGGGCCATAGCTGGGTGG + Intergenic
915129823 1:153688522-153688544 CCTACAGGGCAGGAGGCGGGAGG - Intronic
915797410 1:158751889-158751911 ATTCCTGGGCAGAAGGGGGCAGG - Intergenic
915983404 1:160438271-160438293 TCCTCTGGGCAGAAGGAGGGAGG - Intergenic
917449181 1:175132721-175132743 CTTCCTGGGCAGGGGATGGGTGG - Intronic
919239183 1:194889553-194889575 GCTCCTGGGCAGAAGGAGGCAGG + Intergenic
919314016 1:195948434-195948456 ACTCCTGGGCAGAAGGGGCGAGG - Intergenic
919513468 1:198494250-198494272 GCTCCTGGGCAGAAGGGGGTTGG - Intergenic
919798618 1:201337123-201337145 ACTCCTGGGCAGAAAGGGAGTGG - Intergenic
920195152 1:204221852-204221874 CCTCCTAGGGATGAGGTGGGAGG + Exonic
920399943 1:205670256-205670278 GCTGCTGGGGAGATGGTGGGAGG + Intronic
920879671 1:209867941-209867963 CCTGCTGGGCTGCAGGTGGGTGG + Intergenic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
922337609 1:224630602-224630624 CCTCCTGGGGTAAGGGTGGGAGG + Intronic
922815545 1:228446467-228446489 CCATCTGGGGAGAAGGTGTGCGG - Intergenic
923792931 1:237127419-237127441 CCTTCTGGGAGGGAGGTGGGGGG - Intronic
924766039 1:247032463-247032485 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
1062770060 10:92183-92205 GTTCCTGGGCAGAAGTTGGTGGG - Intergenic
1063360072 10:5446464-5446486 CCTCCTGGGCGAAAGCTGAGAGG + Intronic
1064928770 10:20599971-20599993 CATCCAAGGCAGAAGGTGGAAGG - Intergenic
1065925714 10:30432955-30432977 CCTCCTGGGCCGTAGGTGGGGGG + Intergenic
1065976538 10:30847116-30847138 GCTCCTGGGCAGAAAAGGGGAGG + Intronic
1066101581 10:32122756-32122778 ATTCCTGGGCAGAAGGGGGTGGG - Intergenic
1067189042 10:44054465-44054487 CCACCTGGGCAGCAGCAGGGAGG - Intergenic
1067479815 10:46587416-46587438 CCTCCTGGGGAGGAGGAGGGAGG + Intronic
1067614922 10:47754381-47754403 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1067811235 10:49428832-49428854 CCTCCTGGGCAGAGGGTAGTAGG + Intergenic
1068351071 10:55845921-55845943 CCTCCTAGGCAGTGTGTGGGGGG - Intergenic
1069357066 10:67598435-67598457 GATCCTGGGCTGAAGGGGGGAGG - Intronic
1069570814 10:69493258-69493280 CCCCCGGGGCAGAAGTTGGGTGG - Intronic
1069723869 10:70565488-70565510 GCTCCTGGGAAGTGGGTGGGTGG + Intronic
1070697171 10:78572011-78572033 ACTCCTGGGCAGGGAGTGGGTGG + Intergenic
1070760994 10:79024378-79024400 CCCCCTGGGCAGGAGCTAGGTGG + Intergenic
1071124456 10:82318176-82318198 CCTCATGGGCAAAATTTGGGTGG + Intronic
1071630327 10:87214345-87214367 CCTCCTGGGGAGGAGGAGGGAGG - Intergenic
1071957052 10:90770805-90770827 GCTCCTGGGCAGAAGGCGGTGGG + Intronic
1072451283 10:95541488-95541510 GCTCCTGGGCATGAGGTGGTAGG - Intronic
1072451424 10:95542199-95542221 GCTCCTGGGGACAGGGTGGGGGG - Intronic
1072455880 10:95575360-95575382 ACCCCTGGGCAGAAGTAGGGTGG + Intergenic
1072871362 10:99124402-99124424 GCTTCTGGGCAGAAAGTGGTGGG - Intronic
1073013786 10:100382284-100382306 CAGCCTGGGGAGAAGGGGGGAGG - Intergenic
1073300801 10:102470113-102470135 CCTCCTGGGTAGCAGTAGGGTGG - Intronic
1074301838 10:112240456-112240478 GCTCCTGGGCAGAAAGGGGCGGG - Intergenic
1075282940 10:121156304-121156326 CCTCCCAGGTAGAAGATGGGAGG + Intergenic
1076857934 10:133126756-133126778 CCTCAGGGGAAGAAGGTCGGAGG - Intronic
1076920952 10:133454422-133454444 GGTCCTGGGAAGGAGGTGGGAGG + Intergenic
1077412170 11:2408696-2408718 CCTGCGGGGCAGGAGGAGGGAGG + Intronic
1077501756 11:2912580-2912602 CCACCTGGGCAGCAGGTGGGAGG + Intronic
1077668735 11:4137952-4137974 CCATCTGGGAAGGAGGTGGGGGG - Intronic
1077685065 11:4283381-4283403 CCTCCTGGGAGGGAGGTGGGTGG + Intergenic
1077690123 11:4334549-4334571 CCTCCTGGGAGGGAGGTGGGTGG - Intergenic
1078102242 11:8336791-8336813 CCTCCTGGGCTAAGGCTGGGCGG + Intergenic
1078422758 11:11225699-11225721 CCTACATGGCAGAAGGTGGAAGG + Intergenic
1078536523 11:12179372-12179394 GCTGCTGGGGAGAAGGTGAGAGG - Intronic
1078720966 11:13882843-13882865 CCTCCTGGGAAGAAAGAGTGGGG + Intergenic
1079244746 11:18743928-18743950 CATCCTGGGGAGGAAGTGGGAGG + Intronic
1079399123 11:20091561-20091583 ACTCCATGGCAGAAGGTGGGAGG - Intronic
1079710744 11:23680058-23680080 GCTCCTGGGCAGAATGGGGTGGG - Intergenic
1080530719 11:33173195-33173217 CCTCCCAGACAGAAGCTGGGAGG + Intergenic
1081397434 11:42603370-42603392 CATCCTTGGCAGAAGGTAGAAGG + Intergenic
1082693545 11:56332433-56332455 CCTCCTGGGCACGACGAGGGTGG - Intergenic
1083324142 11:61865062-61865084 CCACCTGGGCAGAGGCTGGCTGG - Intronic
1083609930 11:63999832-63999854 CGGCCTGGGCAGAAGGGGGCAGG + Intronic
1083649404 11:64192668-64192690 CCTCACAGGAAGAAGGTGGGCGG - Intronic
1083687292 11:64384242-64384264 CCTCCTAGGCAGAGGGCAGGAGG + Intergenic
1084005196 11:66318918-66318940 CCACCTGGGCCGGGGGTGGGTGG - Intergenic
1085100552 11:73796588-73796610 CTTCCTGGGCAGAAGGGGGCAGG + Intronic
1085334246 11:75678977-75678999 GCTTCTGGGCAGAAAGTGGCGGG - Intergenic
1086122496 11:83316740-83316762 CCGCCTGGGAGGGAGGTGGGGGG - Intergenic
1086268270 11:85028427-85028449 GCTCCTGGGCAGAAAGGGGTAGG - Intronic
1087829868 11:102807989-102808011 CCTCCACGGCGGAAGGTGGCAGG + Intergenic
1088328836 11:108629212-108629234 GCTCCTGGGCAGAAAGGGGTGGG - Intergenic
1088706287 11:112467194-112467216 ACTCCTGGGCTGATGATGGGTGG + Intergenic
1089526839 11:119102510-119102532 CAGCTGGGGCAGAAGGTGGGTGG - Intronic
1089548962 11:119255246-119255268 ACTCCTGGCCAGAGGGAGGGAGG + Intronic
1089576509 11:119448065-119448087 CTACCTGGGGTGAAGGTGGGTGG + Intergenic
1089587967 11:119522025-119522047 CTTCCTGGGCAGAATCTGTGGGG - Intergenic
1089951906 11:122535904-122535926 CCTCCTAGGCATATGGTGAGAGG - Intergenic
1090137057 11:124209812-124209834 GCTCCTGGGCAGAAGGTGGCGGG - Intergenic
1090361372 11:126175158-126175180 TCTCCTGGGCAGGTGGCGGGGGG - Intergenic
1090514678 11:127412432-127412454 GCTCCTGGGCAGGAGGAGGTGGG - Intergenic
1090939344 11:131373653-131373675 TCTCAGTGGCAGAAGGTGGGCGG - Intronic
1091080537 11:132663222-132663244 GCTCCTGGGTAGAGGCTGGGAGG - Intronic
1091556995 12:1581338-1581360 CCTCCTGGGGAGAGGGTTTGGGG + Intronic
1092065539 12:5587390-5587412 CCTCCTGAGCAGAAGGATGTAGG - Intronic
1092508083 12:9124799-9124821 ACTCCTGGGCAGAAGGGGGCAGG + Intergenic
1093253701 12:16839691-16839713 CCTACTGGGTGGAGGGTGGGAGG + Intergenic
1093493030 12:19726162-19726184 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1094058392 12:26288422-26288444 CCTCCTGGGCAGAGCCTGCGTGG - Intronic
1094447417 12:30546519-30546541 CCTCCTGGCCAGAACTTGGGAGG - Intergenic
1096499481 12:52056224-52056246 CCTCCAGGGCAGAAGCCTGGGGG - Intronic
1096676773 12:53230512-53230534 CCTCCTGGGGAGCAGGCTGGGGG - Intronic
1096751093 12:53759276-53759298 CCTGCTGGGTAGAGGGTGGGAGG - Intergenic
1097078194 12:56410573-56410595 ATTCCTGGGCAGAAGGGGGTGGG - Intergenic
1097572921 12:61356152-61356174 GCTCCTGGGCAGACGGGGGTAGG - Intergenic
1097976965 12:65696779-65696801 TCTCCTGGGCAGAGGCTTGGAGG + Intergenic
1098951574 12:76645308-76645330 GCTCCTGGGCAGAAGGGGGCGGG + Intergenic
1099051812 12:77789929-77789951 TGTCCTGGGCCGAATGTGGGTGG + Intergenic
1100672869 12:96835500-96835522 GTTCCTGGGCAGAAGGGGGCAGG - Intronic
1101448461 12:104755290-104755312 CCTCCAGGCCAGACTGTGGGTGG - Intronic
1101537746 12:105634908-105634930 CATTCTGGGCAGAAAGTGGCAGG + Intergenic
1101561573 12:105862442-105862464 CCTCCAGGGGAGGAGGTGTGGGG - Intergenic
1101687423 12:107038927-107038949 TCTCTTGGGCAGCAGCTGGGAGG - Intronic
1101838400 12:108310951-108310973 TCTCCTGGGCGGGGGGTGGGGGG - Intronic
1102475558 12:113185955-113185977 CCTGGTGGGAAGAAGGTGCGGGG + Exonic
1102815137 12:115859313-115859335 ACTCGTGGGCACAAGTTGGGGGG - Intergenic
1102890834 12:116557568-116557590 TGGCCTGAGCAGAAGGTGGGAGG - Intergenic
1103437442 12:120937701-120937723 CCTCCTTGCCTCAAGGTGGGAGG + Intergenic
1104534563 12:129606725-129606747 CCACTTGGGTAGAAAGTGGGCGG + Intronic
1104595410 12:130117026-130117048 CCAGCAGGGCAGAGGGTGGGCGG + Intergenic
1105069892 12:133227915-133227937 CCCTCTGGGCAGAGGGAGGGGGG + Exonic
1105804834 13:23946779-23946801 CCACCTGGGGAGCATGTGGGTGG + Intergenic
1106248893 13:27969225-27969247 CCTAGTGGGAAGGAGGTGGGAGG - Exonic
1106253535 13:28001894-28001916 GCTCCTGGGCAGAAGGAGTCAGG - Intergenic
1106979139 13:35256523-35256545 GCTCCTGGGCAGAAAGGGGTGGG - Intronic
1107853432 13:44592063-44592085 GCTCCTGGGCAGAAGGGCGCTGG + Intergenic
1108807806 13:54181413-54181435 ACTTGTGGGCAGAGGGTGGGAGG - Intergenic
1109348449 13:61145460-61145482 GCTCCTGGGCAGAAAGAGGTGGG + Intergenic
1109372743 13:61445284-61445306 CCTTCTGGGTAGAGGGTTGGAGG + Intergenic
1109420469 13:62105486-62105508 ACTCCTGGGCAGAAAGTTGGGGG + Intergenic
1112065926 13:95793026-95793048 GCCTCTGGGCAGCAGGTGGGAGG - Exonic
1112571887 13:100600886-100600908 AGTCATGGGCAGGAGGTGGGTGG - Intergenic
1113627286 13:111856617-111856639 CCTCCAGGGCAGCAGCAGGGCGG - Intergenic
1113789242 13:113018843-113018865 CCGCCTGGGCAGTGGGAGGGGGG - Intronic
1113812767 13:113152346-113152368 CCTCCTGAGCCGAAGGCAGGGGG + Intergenic
1113970661 13:114185892-114185914 ACTCCTGGGCAGAAGGGGTCAGG + Intergenic
1116159762 14:41253608-41253630 GCTCCTGGGCAGAAAGGGGCAGG - Intergenic
1117043106 14:51785963-51785985 CCTTGAGGGTAGAAGGTGGGAGG - Intergenic
1119036156 14:71231725-71231747 ACTCCTGGGCAGAAGGGGGCTGG + Intergenic
1120230146 14:81833129-81833151 TCTGGTGGGCAGATGGTGGGAGG - Intergenic
1121238715 14:92412517-92412539 CCTCCTGGGCACAGGGTGTGTGG + Intronic
1121433793 14:93905734-93905756 CCTCCTGGTCAGCACATGGGAGG + Intergenic
1121669105 14:95694379-95694401 CTTCCTGGGTACCAGGTGGGTGG + Intergenic
1121791442 14:96702540-96702562 CAGCCTGGGCAGAATGTGGCAGG + Intergenic
1122619809 14:103049286-103049308 CCTGCTTGGCTGAAGGAGGGTGG + Intronic
1122789669 14:104178957-104178979 CCCCTTGGGCAGTGGGTGGGTGG + Intronic
1122847505 14:104507937-104507959 CTGCCTGGGCAGAAGCTGAGAGG + Intronic
1123672277 15:22671238-22671260 CCTCTGGGGCATAAAGTGGGGGG - Intergenic
1124045793 15:26148754-26148776 GCTCCTGGGGACCAGGTGGGTGG + Intergenic
1124324325 15:28744530-28744552 CCTCTGGGGCATAAAGTGGGGGG - Intergenic
1124369578 15:29096257-29096279 CCTCCTTGGCAGAAGAAGGGAGG - Intronic
1124437906 15:29666259-29666281 CCTGCTGGGATGAAGGTGGCTGG - Intergenic
1124651692 15:31478822-31478844 CCTCCTGGGGTGAGCGTGGGGGG + Exonic
1125436902 15:39655736-39655758 CCTACTGGGAGGAAGGTGCGTGG + Intronic
1125587473 15:40831020-40831042 CTTCCTGAGCAGGAGGAGGGGGG + Intergenic
1125752359 15:42037187-42037209 GCTCCTGGGTAGAAGGGGGTGGG + Intronic
1126181961 15:45794021-45794043 CCCTCTGTGCAGAAGGAGGGAGG + Intergenic
1127017776 15:54708237-54708259 ATTCCTGGGCAGAAGGGGGCGGG - Intergenic
1127256348 15:57296958-57296980 ACCCCTGGACAGAAGGTCGGTGG - Intronic
1128550399 15:68594647-68594669 CCTCCAGGGCAGAAGCCGTGGGG + Intronic
1128860976 15:71071753-71071775 CCACTGGGGCAGAAGTTGGGTGG + Intergenic
1128965254 15:72051857-72051879 GCTCCTGGGCAAAAGGAGGCAGG + Intronic
1129253365 15:74320549-74320571 CCTGCTGGGGAGCAGGTGGAAGG + Intronic
1129785015 15:78304211-78304233 ATTCCTGGGCAGAAGGGGGTAGG + Intergenic
1130137890 15:81197074-81197096 CCTGCTGGGCAGATGGAGAGAGG + Intronic
1130227839 15:82073305-82073327 GTTCCTGGGCAGAAGGAGGTGGG - Intergenic
1130906835 15:88246715-88246737 CTTCCTGGGAAGGAGGTGGCTGG - Intronic
1131005535 15:88974433-88974455 CCTACAGGGCAGACGGTGAGAGG - Intergenic
1131071756 15:89470608-89470630 GCTCCTGGGAAGAAGGGGTGAGG - Intergenic
1131900050 15:97077918-97077940 TTTCCTGGGCAGAAGGTGGGTGG - Intergenic
1132210355 15:100017362-100017384 CCTCCTGGCCAGAACTTGGGGGG - Intronic
1132497926 16:272646-272668 CACCCAGGGCAGCAGGTGGGAGG + Intronic
1132575878 16:663799-663821 CCTCCTGGGCGGAATTGGGGCGG + Intronic
1132585626 16:704889-704911 CCTCCTGGGGATTAGGTGGGTGG - Intronic
1132722096 16:1321399-1321421 TCTCCTGGTCAGGAGGGGGGAGG + Intronic
1132783881 16:1643662-1643684 CCTCCCGGGCAGCAGGTGCGTGG + Intronic
1132934359 16:2473410-2473432 CAGTCTGGGTAGAAGGTGGGAGG - Exonic
1133050249 16:3113349-3113371 GCTCCTGGCCAGAAGCTGGAGGG + Exonic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1133127603 16:3656569-3656591 CCTCCTGGGAAGCAGGAGTGGGG + Intronic
1133239168 16:4404409-4404431 CCTGCAGGGGAGGAGGTGGGAGG - Intronic
1136424761 16:30162289-30162311 CCTCCTGGGGAGACTGTGGCAGG + Intergenic
1136458371 16:30395221-30395243 CCTCCTGGGCTGCAGCTGGGTGG - Exonic
1137334345 16:47533397-47533419 GTTCCTGGGCAGAAGGGGGCAGG - Intronic
1137401652 16:48158422-48158444 GCTCCTGTGCAGAAGGGTGGAGG + Intergenic
1137530704 16:49277137-49277159 CTCCCTGGGCTGCAGGTGGGTGG - Intergenic
1137545014 16:49396692-49396714 CCCCCTGGGCAGATGGGGTGGGG + Intronic
1137592983 16:49705086-49705108 CTTTCTGGGAAAAAGGTGGGAGG + Intronic
1137669229 16:50269664-50269686 CCTCCAGGACAGCAGGAGGGAGG - Intronic
1137842287 16:51651465-51651487 CCTTCTGGGAGGAAGGTGGAGGG - Intergenic
1138011679 16:53386587-53386609 CCTCCTTAGCTGAAGGTGGTGGG + Intergenic
1138033552 16:53580187-53580209 GCTCTTGGGCAGAAGGGGGCAGG - Intergenic
1138243018 16:55444482-55444504 CCTCCTGAGCAGGAGGTGCTGGG + Intronic
1138435249 16:56995228-56995250 ATTCCTGGGGAGGAGGTGGGTGG - Intronic
1138960061 16:62018419-62018441 GTTCCTGGGGAGAAGCTGGGAGG + Intronic
1139138509 16:64233570-64233592 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
1139574615 16:67833216-67833238 CAGCCTGGGCAGAAGTTGGGAGG - Intronic
1139851195 16:69952312-69952334 CCTCCTGAACTGAGGGTGGGGGG - Intronic
1139880174 16:70175224-70175246 CCTCCTGAACTGAGGGTGGGGGG - Intronic
1140103479 16:71938446-71938468 GCTCCTGGGCAGAAAGGGGCAGG + Intronic
1140107382 16:71973180-71973202 CTGCCTGGGCAAAAGGAGGGAGG - Intronic
1140372335 16:74420293-74420315 CCTCCTGAACTGAGGGTGGGGGG + Intronic
1140409769 16:74734614-74734636 CCTGCTGCCCAGAGGGTGGGCGG + Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141652140 16:85398368-85398390 CCTCCTGAGCAGGAGGTGGAGGG + Intergenic
1141683058 16:85555282-85555304 GCGCCTGGGCAGAAGGAGGCAGG - Intergenic
1142029311 16:87830648-87830670 GCTCCTCCGCAGAAGGTTGGTGG - Exonic
1142099074 16:88261992-88262014 CGTCCTGCACAGATGGTGGGAGG - Intergenic
1142151281 16:88513547-88513569 CTTCCTGGGCAGAGGGTGTGTGG + Intronic
1142212152 16:88813376-88813398 CCTCCTGGGCTGGACGTGGACGG - Intergenic
1142395555 16:89829208-89829230 TCTCCTGGGTGGAAGGTGGGGGG + Intronic
1142614719 17:1127591-1127613 CCTCCTGGAGAGGAGGAGGGAGG - Intronic
1142855085 17:2724635-2724657 CCTCGTGGGCAGCAGGCGGGCGG + Intergenic
1143029829 17:3961709-3961731 GCTCCTGGCCACAAGCTGGGTGG - Intronic
1143183742 17:4998722-4998744 CTTCCTGGGCAGAGCATGGGAGG - Intronic
1143540523 17:7565698-7565720 TCACCTGGGGAGAAGATGGGAGG - Exonic
1144702678 17:17349259-17349281 CTCCCTGGGCAGGAGGAGGGAGG - Intergenic
1144829054 17:18121615-18121637 CCTCCTGGCCAGGGGGAGGGTGG - Exonic
1146371566 17:32267779-32267801 ACTCCTGGGCAGCCGCTGGGAGG + Intronic
1149884642 17:60328041-60328063 GCTCCTGGGCAGAAGGGGGCAGG + Intronic
1150124492 17:62627646-62627668 CCTCCCGGGGAGGAGGAGGGAGG - Exonic
1151173634 17:72269086-72269108 CCTTCTGGGGATAAAGTGGGTGG - Intergenic
1151305854 17:73262298-73262320 CCTCATGGGAAGAAGCGGGGAGG - Intronic
1151826656 17:76527676-76527698 GCTGCTGGGCAGCAGGTCGGCGG - Exonic
1152096947 17:78278143-78278165 CCTCCAGGGGAGCAGGTGGGAGG - Intergenic
1152330506 17:79669951-79669973 GCTCCTGGGGAGAAGCTGTGGGG + Intergenic
1152539672 17:80968642-80968664 GGTCTTGGGCAGGAGGTGGGTGG + Intergenic
1152551243 17:81031412-81031434 GCTGCCAGGCAGAAGGTGGGAGG + Intergenic
1152925010 17:83083177-83083199 CCTCCTGGGCAGAGGTGGGTTGG + Intronic
1153379944 18:4427279-4427301 CCACCTTGGGAGAAGGTTGGAGG + Intronic
1153428813 18:4993087-4993109 GCTCCTAGGCAGAAGGAGGTGGG - Intergenic
1153860611 18:9200967-9200989 CTTCCTGGGTAGAAAGTAGGAGG + Intronic
1156481225 18:37437558-37437580 CCTCCAGGACACAAGATGGGTGG - Intronic
1156503104 18:37572202-37572224 CCTCCTTTGTAGGAGGTGGGAGG - Intergenic
1157086163 18:44582085-44582107 CATCCTGGGCAGAATATGAGTGG + Intergenic
1157606954 18:48931905-48931927 CACCCTGGGGGGAAGGTGGGGGG + Intronic
1157700528 18:49759252-49759274 ACTCCAGGGGAGAAGGTGGTAGG + Intergenic
1158023393 18:52869562-52869584 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
1158198096 18:54910590-54910612 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1158371736 18:56814017-56814039 GCTCCTGGGGACAGGGTGGGAGG - Intronic
1158896189 18:61915934-61915956 CCTCTGGGGGAGAAGGTGGGTGG - Intergenic
1159001051 18:62975407-62975429 ACTGCTGGGCAGAAGCTTGGTGG + Exonic
1159766912 18:72502562-72502584 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1159787032 18:72726856-72726878 CCTCCTGTCCAGAACTTGGGGGG + Intergenic
1160217090 18:76941493-76941515 CCACCTGTGCAGTGGGTGGGAGG - Intronic
1160533036 18:79576684-79576706 CCTCCTGGGCGGCTGGTGGTCGG - Intergenic
1160919881 19:1514345-1514367 AGTCCAGGTCAGAAGGTGGGGGG - Intergenic
1161006129 19:1937634-1937656 CTTCCTGGGCAGAGGATGTGCGG + Intergenic
1161062310 19:2221446-2221468 CCTCATTGGCAGAAGCAGGGAGG + Intronic
1161173249 19:2823973-2823995 ATTCCTGGGCAGAAGGGGGTGGG - Intronic
1161316493 19:3619844-3619866 CCTCCTGGGTGGAGTGTGGGAGG + Intronic
1161453733 19:4360239-4360261 GCTCCTGAGCCCAAGGTGGGTGG - Intergenic
1161626143 19:5327970-5327992 TCTCCTGAGGAGAAGGTGAGAGG - Intronic
1163548143 19:17951235-17951257 CCACCAAGGCTGAAGGTGGGTGG + Intergenic
1163819403 19:19487482-19487504 CTTGCTGGGCCGAGGGTGGGTGG + Intronic
1164186169 19:22871582-22871604 CCGCCTGGGAGGGAGGTGGGGGG - Intergenic
1164468037 19:28504947-28504969 CCTCTAGAGCAGAAGGTGGGAGG - Intergenic
1165358780 19:35320719-35320741 CATCCTGGGCAGAGGTTGGGGGG + Intronic
1165527270 19:36366681-36366703 TACCCTGGGCAGTAGGTGGGTGG + Intronic
1165779915 19:38426233-38426255 CCCCCTGGCCTGAGGGTGGGTGG - Exonic
1166667868 19:44692130-44692152 CCTGGTGGGCAGAACTTGGGTGG - Intergenic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167013138 19:46821997-46822019 ATTCCTGGGCAGAAGTTGGTGGG + Intergenic
1167346221 19:48947125-48947147 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167595018 19:50422936-50422958 CCTGCAGGGCTGTAGGTGGGGGG - Exonic
1168109419 19:54183677-54183699 CCAGCTGGGCAGAAGGGGGTGGG + Exonic
1168112341 19:54200495-54200517 GCTACTGGGGAGGAGGTGGGAGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925538979 2:4945970-4945992 CCTCCTGGGCAGAGTCTGTGGGG - Intergenic
925656520 2:6155922-6155944 AATCCTGGGCAGAAGAAGGGGGG + Intergenic
926531306 2:14049665-14049687 CCTTGAGGGCAGAGGGTGGGAGG - Intergenic
926953686 2:18271588-18271610 GCTCCTGGGCAAAAGGGGGTGGG - Intronic
927218286 2:20682584-20682606 CCTCCCTGGCAAAAGGTGGAAGG + Intergenic
927266930 2:21162286-21162308 GCTCCTGGGCAGAAGGAAGGAGG - Intergenic
927533879 2:23836999-23837021 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
927719463 2:25373437-25373459 CCTTCAGGCCGGAAGGTGGGGGG + Intergenic
928272001 2:29864914-29864936 CCTTCAGGGGAGAGGGTGGGAGG - Intronic
928990981 2:37232540-37232562 CCTACTTGGCTGATGGTGGGTGG + Intronic
929922882 2:46185047-46185069 CCTTCTGGTCACCAGGTGGGAGG - Exonic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
930800542 2:55438437-55438459 GTTCCTGGGCAGAAGGGGGCAGG + Intergenic
932214576 2:69958593-69958615 CGTGCTGGGTAGAAGGAGGGAGG - Intergenic
932398293 2:71463042-71463064 GCTCCTGGGCAGAAAGGGGTGGG - Intronic
932404655 2:71505095-71505117 CCTCCTGGGCAACAGGGAGGAGG - Intronic
932644657 2:73488115-73488137 GCTCCTGGGCAGAAAGGGGCAGG - Intronic
934652056 2:96098417-96098439 CCTCCTTGGCAGAACGAGGAAGG + Intergenic
934998486 2:98988856-98988878 CCTTCTGGGAGGGAGGTGGGGGG - Intergenic
935426980 2:102929892-102929914 CGTTCTAGGCAGAAGGGGGGAGG - Intergenic
937913522 2:127087803-127087825 CCTCCTGGTTGGAAGGTGGTGGG - Intronic
938038149 2:128053535-128053557 CCTCCTGGCCAGAATTGGGGCGG - Intergenic
938180682 2:129179304-129179326 GTTCCTGGGCAGAAGGGGGCAGG - Intergenic
938194924 2:129318993-129319015 ATTCCTGGGCAGAAAGCGGGCGG - Intergenic
938613858 2:132977566-132977588 CCTGGTTGGAAGAAGGTGGGAGG - Intronic
938711319 2:133978281-133978303 CCTACTGGGAAGCAGGAGGGAGG + Intergenic
939654393 2:144805393-144805415 CATACTGGGCAAAAGGTGGCAGG - Intergenic
940398729 2:153222526-153222548 CCTGCTGGGCAGAAAGGGGTGGG - Intergenic
940895771 2:159080872-159080894 CCTGCTGGTCAGGAGTTGGGAGG - Intronic
940945769 2:159615947-159615969 CGTCCTGGGTGGGAGGTGGGGGG - Intronic
941432322 2:165427191-165427213 GCTCCTGGGCAGAAAGGGGTGGG + Intergenic
941942610 2:171059058-171059080 CCTTCTTGGAACAAGGTGGGGGG + Intronic
941949045 2:171133940-171133962 GCTACTTGGGAGAAGGTGGGAGG - Intronic
942630527 2:177946490-177946512 CGTCCCGGGAAGGAGGTGGGGGG + Intronic
943526249 2:189020816-189020838 AGTCCTGGGCAGAAGTTGGTGGG + Intergenic
944732920 2:202534957-202534979 CCGCCCGGCCAGGAGGTGGGGGG - Intronic
946197471 2:218043774-218043796 GCTCCTGGGAGGAAGGTGGTGGG - Intronic
946202809 2:218080766-218080788 CCAAGTGGGCAGCAGGTGGGAGG - Intronic
947175897 2:227367217-227367239 CCTCTTGGGGTGGAGGTGGGTGG + Intronic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
948678282 2:239611883-239611905 CCTGGTGGGCAGAAGGAGGCCGG + Intergenic
948712972 2:239836663-239836685 GATCCTGGGCAGAAGGGGGTAGG + Intergenic
948836183 2:240627052-240627074 CCTCCTGGGCAGGAAGTGGAAGG + Intronic
948883704 2:240872841-240872863 ACTCCTGGGGTGGAGGTGGGAGG + Intronic
948903481 2:240967326-240967348 CATCCTGGGCAGAAGGACTGAGG - Intronic
949019497 2:241733446-241733468 TCACCTGGGAAGAAGGTGAGTGG + Intergenic
1170255193 20:14334642-14334664 CCTCTGGGGCAAAAGGTGGGGGG + Intronic
1170843786 20:19945328-19945350 TCACATGGGCAGGAGGTGGGTGG + Intronic
1171215128 20:23346818-23346840 CCTCCTGGGCAGCAGAGGGGTGG + Intergenic
1171236923 20:23534938-23534960 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1171486474 20:25489812-25489834 CCTGCTGGGCAGAGTGGGGGTGG - Intronic
1172199325 20:33114100-33114122 CCTCCTGAGGAAAGGGTGGGAGG - Intergenic
1172448253 20:35004181-35004203 CCAGCAGGGCAGAAGGTGTGAGG + Intronic
1172632169 20:36385884-36385906 CCTCCTGGGCTGAAGTGGGGAGG - Intronic
1172676664 20:36677286-36677308 AGTCCTGGGCAGAAGGGGGCAGG + Intronic
1173697564 20:45032418-45032440 CCTTGAGGGCAGAGGGTGGGAGG - Intronic
1173704603 20:45100790-45100812 CCTCCTTGGCGGGGGGTGGGGGG + Intronic
1173751545 20:45480493-45480515 CCTCCTGAGTAGCGGGTGGGTGG - Intronic
1173884585 20:46446012-46446034 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1174037447 20:47677019-47677041 CTTCCTGGGCAGAGGGAGGGAGG + Intronic
1174392532 20:50226754-50226776 CCTCCTAGGGAGCAGGTGGGTGG + Intergenic
1174459199 20:50670886-50670908 CCTCCTGGCCTGAGTGTGGGTGG + Intronic
1175065089 20:56277436-56277458 GCTCCTGGGCAGAAGGAAAGGGG + Intergenic
1175142591 20:56872074-56872096 CCCCCTGGACAGAGTGTGGGCGG - Intergenic
1175525255 20:59629312-59629334 CTTCCTGGGAAGAAGGGAGGTGG - Intronic
1175554134 20:59835789-59835811 CCGTCTGGGCTGATGGTGGGAGG + Intronic
1175720325 20:61281741-61281763 CCTCCAGGGGAGGAGGTGGCGGG - Intronic
1175837975 20:62008488-62008510 TCCCCTGGCCGGAAGGTGGGAGG - Intronic
1176008754 20:62880722-62880744 CCACCAGGACAGAAAGTGGGGGG - Exonic
1176022333 20:62968163-62968185 CCCCCAGGGCAGTGGGTGGGTGG + Exonic
1176052775 20:63129286-63129308 CCTCCTGAGGAGCAGGTGGACGG - Intergenic
1176235390 20:64051308-64051330 CCTCCTGGGCAGCTGGCAGGAGG + Intronic
1176973290 21:15290191-15290213 GCTCCTGGGCAGAAAGGGGCAGG - Intergenic
1176976475 21:15327079-15327101 GCTCCTGGGCAGAAGAGGGTAGG + Intergenic
1177344657 21:19853958-19853980 GCTCCTGGGCAGAAAGGGGCGGG - Intergenic
1177344914 21:19855568-19855590 GCTCCTGGGCAGAAAGGGGTAGG - Intergenic
1178467104 21:32858787-32858809 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1178613719 21:34111327-34111349 CCTCCTTGGCAGGAAGCGGGTGG - Intronic
1179097961 21:38332493-38332515 CCCCCATGGCAGAAGGTGGAAGG + Intergenic
1179277360 21:39904551-39904573 GCTCCTGGGCACAGGGTGGCTGG + Intronic
1179371486 21:40810025-40810047 CTTACTGGGCAGCAGGTGGTGGG - Intronic
1179981986 21:44900472-44900494 CCTCCTGAGAAGAAGGCGTGGGG + Exonic
1180763850 22:18231037-18231059 CCTGCAGGCCAGAAGGTGGTGGG - Intergenic
1180771796 22:18393505-18393527 CCTGCAGGCCAGAAGGTGGTGGG + Intergenic
1180803175 22:18643119-18643141 CCTGCAGGCCAGAAGGTGGTGGG + Intergenic
1180974716 22:19842024-19842046 CCTGATGAGCAGGAGGTGGGAGG - Intronic
1181036945 22:20174291-20174313 TCACCTGGGCAGAGGGTGGGAGG + Intergenic
1181218542 22:21352141-21352163 CCTGCAGGCCAGAAGGTGGTGGG - Intergenic
1181419333 22:22786907-22786929 CCTCTTGGGGAGGAGGGGGGAGG - Intronic
1181583583 22:23841200-23841222 GCTCGTGGGGAGAAGGTGAGGGG + Intergenic
1181885621 22:26019993-26020015 CCTACTGGGCAGAAGGCTGACGG - Intronic
1182124086 22:27803966-27803988 CCTCCTGGACAAAAAGCGGGAGG + Intergenic
1182315912 22:29447139-29447161 CTTTCTGGGGTGAAGGTGGGTGG - Intergenic
1182907429 22:33950258-33950280 TCTCCAGGGGAGAAGCTGGGTGG - Intergenic
1183316888 22:37141837-37141859 CAGCCTGGGCAGAAGGAGGCGGG + Intronic
1184066403 22:42124167-42124189 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184068871 22:42136319-42136341 CCTGCTGAGCAGGAGGTGGCAGG + Intergenic
1184892984 22:47390741-47390763 CCTGCTGAGCAGCAGGTGGAGGG - Intergenic
1185193680 22:49454803-49454825 CCGCCCGGGCAGCAGCTGGGAGG - Intronic
1203233633 22_KI270731v1_random:134496-134518 CCTGCAGGCCAGAAGGTGGTGGG + Intergenic
949201043 3:1379687-1379709 CTTCCTGAGGAGGAGGTGGGGGG + Intronic
950240485 3:11365683-11365705 CCTAGCTGGCAGAAGGTGGGTGG - Intronic
950408097 3:12816990-12817012 CCTGCACGGCAGACGGTGGGAGG - Exonic
950903929 3:16520549-16520571 AATCCTGGGCACAGGGTGGGCGG + Intergenic
951264735 3:20552543-20552565 GCTCCTGGACAGAAGGGGGCAGG - Intergenic
951562480 3:23982283-23982305 GTTCCTGGGCAGAAGGAGGCGGG - Intergenic
952223300 3:31346905-31346927 CCTCTTGGGAAGAAGGTGAAAGG + Intergenic
952283817 3:31948473-31948495 GCTCTTAGGCAGAAGGTAGGTGG - Intronic
953766539 3:45747388-45747410 GCTCCTGGGCAGAAAGGGGCGGG + Intergenic
954292891 3:49659029-49659051 TTTCCTGGGCAGAATGTGGGAGG + Intronic
954447963 3:50556861-50556883 GCTAGAGGGCAGAAGGTGGGTGG + Intergenic
954737002 3:52715046-52715068 GCTACTGGGCAGAAGGGGGCGGG + Intronic
954786093 3:53093583-53093605 CCTCATGTGCAGAATCTGGGTGG - Intronic
955520486 3:59770873-59770895 CCTCCTGGGCAGAAGCAGAGTGG - Intronic
955542706 3:59994781-59994803 CCTCCTTGGCCCATGGTGGGTGG - Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
956636110 3:71367161-71367183 ACTTCTGTGCAGAAGGAGGGAGG + Intronic
957426996 3:80051677-80051699 GCTCCTGGGCAGAAGGAGGCTGG + Intergenic
957703769 3:83753358-83753380 CCACCATGGCAGAAGGTGGAAGG + Intergenic
958636214 3:96750427-96750449 ATTCCTGGGCAGAAGGGGGAGGG + Intergenic
960634257 3:119768189-119768211 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
961067091 3:123884570-123884592 ACTCCGAGGCAGAAGGCGGGTGG - Intergenic
961451714 3:127005197-127005219 CCTCCCGGGCGGAGGGTGAGCGG - Exonic
961479531 3:127171078-127171100 CCTCCTGGACAGCAGGGGTGGGG + Intergenic
961667565 3:128503274-128503296 CCTCCTGCCCACAAGGTGGCAGG - Intergenic
961911450 3:130321044-130321066 TCTCCTGGGCAGATGATGGGAGG - Intergenic
962249509 3:133827097-133827119 CCTCCTAGGCAGAGGGTGTGTGG + Exonic
963509657 3:146231014-146231036 TCTGGAGGGCAGAAGGTGGGAGG - Intronic
963730062 3:148962659-148962681 CCTCCTGGGTAGAGGAGGGGAGG - Intergenic
963805127 3:149714675-149714697 GCTCCTGGGCAGAATGGGGTGGG + Intronic
965489978 3:169323624-169323646 CCTCCTGGGCAGAAAGACTGTGG - Intronic
965542033 3:169880222-169880244 ATTCCTGGGCAGAAGGGGGCAGG + Intergenic
967147517 3:186618538-186618560 CCACATAGGTAGAAGGTGGGAGG - Exonic
967444854 3:189554918-189554940 GCTCCTGGGCAGAAGGGAGCAGG - Intergenic
967582276 3:191173114-191173136 CCTCCAGGGTGGAAGGTAGGAGG - Intergenic
967825918 3:193877288-193877310 GCCCCTGAGCAGAAAGTGGGAGG + Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968764372 4:2460337-2460359 CTTCCTGGGCAGGAGGGTGGTGG - Intronic
968771562 4:2510808-2510830 GCACTTGGCCAGAAGGTGGGAGG + Intronic
969499074 4:7542147-7542169 CCTCATGGGCGGAGGGTTGGGGG + Intronic
969585686 4:8090121-8090143 GCTCCTGGGCAGTGGATGGGAGG - Intronic
969680652 4:8641518-8641540 CTTCCTGGGAGAAAGGTGGGCGG + Intergenic
970040071 4:11786709-11786731 CTTCATGGGGGGAAGGTGGGAGG - Intergenic
970154806 4:13131010-13131032 ACTCCTGGGGAGGAGGTGGCGGG + Intergenic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
972370072 4:38414975-38414997 CTTCCTGGGCTGACAGTGGGTGG - Intergenic
973219769 4:47711811-47711833 GTCCCTGGGAAGAAGGTGGGTGG + Intronic
974216031 4:58848781-58848803 CACCCTGTGCAGAAGGTGGAAGG - Intergenic
975040884 4:69743547-69743569 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
976347769 4:84025077-84025099 CGTCTTGGGTAGACGGTGGGTGG + Intergenic
976700770 4:87966595-87966617 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
978726760 4:111977972-111977994 CCTCCTGGCCAGAACTTGGGAGG - Intergenic
978947570 4:114516763-114516785 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
979010776 4:115365815-115365837 GCTCCTGGGCAGAAAGAGGTGGG + Intergenic
979197858 4:117941693-117941715 CTTCCTGGGCAGGAGAAGGGTGG - Intergenic
979448225 4:120839711-120839733 GCTCCTGGGCAAAAGGGGGCAGG - Intronic
982074411 4:151724333-151724355 CCTCCTGGCCAGGTGGTGAGTGG - Intronic
982209437 4:153022598-153022620 CCTCCTGGGCAGCAGAATGGTGG + Intergenic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
984806733 4:183758213-183758235 TCGCCTGGGCAGAAGTTAGGTGG - Intergenic
985653001 5:1115714-1115736 CCTGCCAGGCAGAAGGCGGGTGG - Intergenic
985835554 5:2269569-2269591 CCTCCTGTGCCTAAGCTGGGTGG + Intergenic
985927923 5:3032221-3032243 CTTCATGGGCACACGGTGGGTGG - Intergenic
986206606 5:5630528-5630550 GCTCCTGTGCATAAGGTCGGAGG - Intergenic
986468845 5:8053413-8053435 CATCCAGGGCAGGAGGAGGGCGG - Intergenic
986503886 5:8429808-8429830 GTTCCTGGGCAGAAGGGGGCAGG - Intergenic
987910628 5:24139368-24139390 CCTCCACAGCAGAAGGTGAGGGG - Intronic
988596298 5:32594601-32594623 CCTCCTGCACAGGAGGTGAGCGG + Intronic
988940372 5:36139433-36139455 GCTCCTGGGCAGAAGTGGGCAGG + Intronic
989293357 5:39794633-39794655 CCTCTTGGGAAGCAGCTGGGTGG + Intergenic
989799410 5:45518380-45518402 GCTCCTGGGCAGAAGCATGGTGG + Intronic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
993034313 5:82740323-82740345 CCTCCTTTGGAGAAGGTTGGGGG - Intergenic
994449969 5:99929536-99929558 TCTCCTGGGCAGAAGGGGGCAGG - Intergenic
994891288 5:105639707-105639729 CCTCCTGGCCAGAAAGGGGCGGG + Intergenic
995386592 5:111595961-111595983 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
995514091 5:112937113-112937135 CCCACATGGCAGAAGGTGGGAGG - Intergenic
995742402 5:115368793-115368815 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
996289001 5:121829347-121829369 ACTCCTGGCCAGAACTTGGGAGG - Intergenic
997445974 5:133940665-133940687 CATCCTTGGCAGGGGGTGGGGGG - Intergenic
997955532 5:138275739-138275761 CCCCCTGGGCAGGAGAAGGGAGG - Intergenic
998184640 5:139968858-139968880 CCTCCTGGGCTGAGGCTGGGAGG - Intronic
998187479 5:139992806-139992828 ACTCTTGGGCAGAAGGAAGGAGG - Intronic
999182459 5:149679745-149679767 CCTTCTGGGAAGAAGGGGAGAGG + Intergenic
1000103368 5:158037089-158037111 CCTTCTGGGAGGGAGGTGGGGGG - Intergenic
1000854252 5:166379425-166379447 GCTCCTGGGCAGAAAGGGGCTGG - Intergenic
1001565666 5:172697627-172697649 GCTCCTCGGCAGAAGGCGCGGGG + Intergenic
1001663065 5:173411080-173411102 CCTCCTGGCCAGATGGTGAATGG + Intergenic
1001820401 5:174705644-174705666 CCTCCAGGGAAGAAGGAGGCTGG + Intergenic
1002527662 5:179823883-179823905 CCTCCTGAGCACACGGTGGGCGG - Exonic
1003096817 6:3148652-3148674 CCACCTGAGCAGCAGCTGGGAGG - Intronic
1003195004 6:3906579-3906601 CCTCTTGGGGTCAAGGTGGGTGG + Intergenic
1004525551 6:16404129-16404151 CATGCGGGGCAGGAGGTGGGGGG + Intronic
1004874549 6:19939952-19939974 CCGCCTGGGAGGGAGGTGGGGGG + Intergenic
1005669527 6:28091139-28091161 CATCCTGGCCGGAAGATGGGCGG - Intergenic
1005942134 6:30568540-30568562 CAACCTGGGCGGGAGGTGGGAGG - Intergenic
1006225853 6:32535530-32535552 TCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1006230770 6:32584505-32584527 GCTCCTGGGCTGCAGGTGGTGGG - Intronic
1006694744 6:35921209-35921231 CCTCCTCGGGAGCAGGTGGTAGG - Exonic
1006727499 6:36210514-36210536 TCTCCTGGGAAGACGGTGAGAGG + Exonic
1007442944 6:41879589-41879611 GCTGCTGGGCAGAGGATGGGAGG + Intronic
1007636671 6:43303865-43303887 TCTCCTGGCCTGAAGGTGGGTGG + Intronic
1007697024 6:43740524-43740546 CCTGCTGGGGTGTAGGTGGGAGG - Intergenic
1007781001 6:44254704-44254726 TCTCCTGTGCAGAAGGTTTGAGG - Exonic
1007784838 6:44273582-44273604 CTCCCTGGGGGGAAGGTGGGAGG + Intronic
1007949477 6:45858616-45858638 GCTCCAGGGCAAAAGGTGAGAGG - Intergenic
1008184625 6:48373639-48373661 GCTCCTGGGACGAATGTGGGTGG + Intergenic
1009412511 6:63382471-63382493 ACACCTGGGCAGAAGATGAGAGG - Intergenic
1011525813 6:88263763-88263785 GCTGCAGGGCAGAAGGAGGGAGG + Intergenic
1013375491 6:109510049-109510071 ATTCCTGGGCAGAAGGGGGTGGG + Intronic
1013633591 6:112008345-112008367 TCTCCTGGGCACAAGGTGTGGGG - Intergenic
1014079750 6:117272354-117272376 CCTACAGGGAAGAAGGTGGGCGG - Intronic
1014805111 6:125820730-125820752 GCTCATGGGCTGAAAGTGGGAGG - Intronic
1015849855 6:137560463-137560485 CCTCCTGGCCAGAACCTGGTGGG - Intergenic
1016469720 6:144362306-144362328 GGTCCTGGGCAGATGGGGGGTGG - Intronic
1017162059 6:151374354-151374376 CCTTCTAGCCAAAAGGTGGGAGG + Intronic
1017660673 6:156670378-156670400 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
1017665932 6:156720163-156720185 CCTCCTGGGCCGGTGCTGGGCGG - Intergenic
1019104898 6:169660119-169660141 GCTCCTGGGCAGAAAGAGTGCGG + Intronic
1019260735 7:80560-80582 CCTCCCGGGCAGCCGGTTGGAGG - Intergenic
1019586893 7:1809912-1809934 CCTCCTGGGCAGAGGGACAGAGG - Intergenic
1019897959 7:3997814-3997836 ACTCCTGGGCAGAAGAAGGTGGG - Intronic
1020845953 7:13283981-13284003 CCTACTGGGAAGAAGGTATGTGG - Intergenic
1021270059 7:18574547-18574569 GCTCCTGGGCAGAAAGGGGAGGG - Intronic
1021672198 7:23045929-23045951 CCGTCTGGGAGGAAGGTGGGGGG - Intergenic
1022113635 7:27245661-27245683 CCACCTGGGCAGAAGGAAGGAGG + Intronic
1022161239 7:27713365-27713387 AATCATGGGCAGAAGGTGAGAGG + Intergenic
1022423466 7:30246075-30246097 GCTCCTGGGCAGAAGGGGTTGGG - Intergenic
1022854073 7:34298368-34298390 CTTTGTGGGAAGAAGGTGGGAGG - Intergenic
1024254769 7:47532205-47532227 AGTCCTGGGCAGAAGGGGGTGGG + Intronic
1025803592 7:64809498-64809520 CATCCTGGGAGGGAGGTGGGGGG - Intronic
1026968471 7:74454383-74454405 CCTCCCGGGCAGGTGGGGGGCGG - Intronic
1027299679 7:76818307-76818329 TGTGCTGGGCAGAAGGTGGGGGG + Intergenic
1027349660 7:77298021-77298043 ACTATTGGGGAGAAGGTGGGGGG + Intronic
1027924188 7:84439256-84439278 CTTCCTGGGCTTAAAGTGGGAGG - Intronic
1028339725 7:89703819-89703841 GATCCAGGGCAGAAGGTGGTGGG + Intergenic
1028748469 7:94354854-94354876 CATGCTGGGCAAGAGGTGGGAGG - Intergenic
1029413280 7:100428694-100428716 CCTCATTGGCAGAAGCTGGGGGG + Intronic
1029446025 7:100613118-100613140 CCTCCGGGGCAGAAGGCAGAGGG + Intronic
1030180815 7:106707124-106707146 CCAGCTGGGCAGAAGATGGGAGG - Intergenic
1030981124 7:116186386-116186408 GCTCCTGGGCAGAAAGGGGCAGG - Intergenic
1031443881 7:121827066-121827088 CATCCATGGCAGAAGGTGAGAGG - Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1032470054 7:132171662-132171684 CCTCCTGGGAAGCAGGTCTGGGG + Intronic
1033227114 7:139571097-139571119 TCTAGTGGGCAGAAGGTTGGAGG - Exonic
1033628997 7:143139053-143139075 CCTGGTGAGGAGAAGGTGGGAGG - Exonic
1034210429 7:149358235-149358257 GCTCCTGGGCAGAAAGGGGCAGG - Intergenic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1039029864 8:33297841-33297863 CCTCCAGGGAAGAATGTGGCAGG + Intergenic
1039571766 8:38592697-38592719 CCTTCTGGCCAGAACCTGGGGGG + Intergenic
1039915779 8:41859209-41859231 CCCCCTGGGCGGCAGGTGGGAGG + Intronic
1040610658 8:48978337-48978359 CGAGCTGGGCAGAAGTTGGGAGG - Intergenic
1040661818 8:49583149-49583171 GCTCCTGGGCAAAAGGGGGTGGG + Intergenic
1040797222 8:51299572-51299594 GCTCATAGGCAGAAGGTGAGAGG - Intergenic
1041274397 8:56142422-56142444 GCTCCTGGGCGGAAGGAGGCAGG + Intergenic
1042004906 8:64169382-64169404 TTTCCTGGGCAGAAGGGGGCAGG + Intergenic
1042156922 8:65854151-65854173 ACTCCGGGGGAGGAGGTGGGAGG + Intergenic
1042337070 8:67640223-67640245 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1042643099 8:70956542-70956564 GTTCCTGGGCAGAAGGGGGAAGG - Intergenic
1042896870 8:73680115-73680137 TTTCCTGGGCAGAATCTGGGTGG + Intronic
1043568141 8:81570942-81570964 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1043735033 8:83731000-83731022 GCCCCTGGGCAGAAGGAGGTGGG - Intergenic
1043958502 8:86389836-86389858 CCATCTGGGAAGGAGGTGGGGGG - Intronic
1044486188 8:92757162-92757184 CCTCCTGGGGAAGAGGTGGTAGG + Intergenic
1045062844 8:98423939-98423961 CCTGCTGGGAAGATGGTGAGGGG - Intronic
1046350893 8:113010146-113010168 TCTGCTGTGCACAAGGTGGGCGG - Intronic
1046395297 8:113632869-113632891 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1046775358 8:118158574-118158596 GCTCCTGGACAGAAAGTGGCAGG + Intergenic
1046854444 8:119015305-119015327 CCTAATGGGCAGACAGTGGGAGG - Intronic
1047237749 8:123057240-123057262 CCCCCTGGGCAGAAGGCTGTGGG - Intronic
1047687284 8:127316463-127316485 CCGTCTGGGAGGAAGGTGGGGGG + Intergenic
1047995268 8:130329071-130329093 ACTCCTGACCAGATGGTGGGTGG + Intronic
1048280388 8:133101429-133101451 CCTCCTTGGCTGATGGTGGTTGG - Intronic
1048297200 8:133223172-133223194 CCTCCTGGGGAGGTGGTGGTGGG - Intronic
1048339144 8:133525536-133525558 GCTCCTGGGCAGAAAGGGGCAGG - Intronic
1049591371 8:143464460-143464482 CCTCCTGGGAAGTGGGTGTGAGG + Intronic
1049592184 8:143467771-143467793 CTGCCTGGGCAGAGGGCGGGAGG - Intronic
1049635773 8:143688367-143688389 CCTGCTGTGCTGGAGGTGGGAGG + Intronic
1049788648 8:144463004-144463026 CCGCCCCTGCAGAAGGTGGGCGG + Intronic
1050182310 9:2934375-2934397 GCTCCTGGGCAGAAGGGGACGGG + Intergenic
1050353700 9:4763467-4763489 CCTCCTAGGAGGAAGGCGGGGGG + Intergenic
1051422893 9:16906014-16906036 CCTCCTTTGCAGAAGCTGGCTGG - Intergenic
1051777326 9:20650208-20650230 CCTGGAGGGCAGAAAGTGGGAGG + Intergenic
1051785984 9:20744137-20744159 CTTCATGGTCAGACGGTGGGTGG + Intronic
1052633590 9:31071757-31071779 ATTCCTGGGCAGAAGGAGGCAGG - Intergenic
1052652405 9:31321428-31321450 GCTCCTGGGCGGAAGGAGGTGGG - Intergenic
1052707541 9:32011063-32011085 GTTCCTGGGCAGAAGGGGGCAGG + Intergenic
1052804759 9:33002875-33002897 CCTTCAAGACAGAAGGTGGGAGG + Intronic
1055275906 9:74615398-74615420 GCTCAGGCGCAGAAGGTGGGAGG - Intronic
1055382540 9:75724614-75724636 TCACATGGGCAGGAGGTGGGTGG + Intergenic
1056151084 9:83789404-83789426 ACTACTGGGCATAAGGTGAGTGG + Intronic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1056986083 9:91364561-91364583 ACTCCTGGGCAGAAGGGGGTGGG + Intergenic
1057551522 9:96054106-96054128 CTTCCAGGGCAGAAGGGGGCTGG + Intergenic
1057796723 9:98163030-98163052 CCTGCTGGGCACAAGGCGGGAGG + Intronic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059434143 9:114266326-114266348 CCCCCTGGGCTTTAGGTGGGTGG + Intronic
1059541165 9:115131967-115131989 CAGCCTAGACAGAAGGTGGGTGG - Intergenic
1060045556 9:120337393-120337415 CCTCTGGGGCACATGGTGGGGGG - Intergenic
1060583095 9:124770163-124770185 CCTGCCGGGCAGAAGCCGGGAGG + Intronic
1060724438 9:125997735-125997757 CCTCTTGGGCAGAGTCTGGGAGG - Intergenic
1061267336 9:129514424-129514446 CTTCCTGGGCAGAAGGGGGTGGG + Intergenic
1061291638 9:129653754-129653776 CCTCCTGGGGCAAAGGAGGGAGG + Intergenic
1061299088 9:129694526-129694548 CCTCCTGGGGAGAAGGTGAAGGG + Intronic
1061368563 9:130185421-130185443 CCTCCTGGGCTGGGGGAGGGGGG + Intronic
1061510993 9:131060930-131060952 CATCCCGGGCAGAAGTGGGGTGG - Intronic
1061679419 9:132235705-132235727 CCTCCCGTGCAGAAGGTATGGGG + Intronic
1061681565 9:132245055-132245077 CCCCTGGTGCAGAAGGTGGGCGG + Intergenic
1061931372 9:133834728-133834750 CCTCCTGGTGGGCAGGTGGGAGG + Intronic
1062149439 9:135009960-135009982 CCTCCTGCCCTGAAGGTGTGGGG + Intergenic
1062188255 9:135230063-135230085 CCTCCTGGCCACCAGCTGGGAGG + Intergenic
1062197586 9:135282823-135282845 CCTCCTTGGCAGAAGGAGGTTGG + Intergenic
1062395386 9:136350643-136350665 CCTCCTGGTCAGGGGCTGGGAGG + Intronic
1062712949 9:137986630-137986652 CTTCCTGGTGGGAAGGTGGGTGG - Intronic
1186805810 X:13139320-13139342 GTTCCTGGGCAGAAGGGGGTGGG + Intergenic
1187257914 X:17657974-17657996 CTTCCTGGTCAGCAGGAGGGTGG + Intronic
1188859893 X:35244185-35244207 GCTCCTGGGCAGAAGGGGCCAGG - Intergenic
1189360168 X:40343885-40343907 AGTCCTGGGCAGAAGGGGGTGGG + Intergenic
1190160362 X:48027668-48027690 CCCCCTGGGCAGAATGGCGGTGG + Intronic
1192252223 X:69422342-69422364 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1193362337 X:80591506-80591528 CCTTCTGGGAGGGAGGTGGGGGG + Intergenic
1196196215 X:112840808-112840830 GCTCCTGGGCAAAGGATGGGAGG + Intronic
1196675812 X:118419176-118419198 CCTCCTGGCCAGAAGGGGGAGGG - Intronic
1197367159 X:125578406-125578428 CTTCCATGGCAGAAGGTGGGAGG + Intergenic
1197708486 X:129650360-129650382 CCTCTTGGGCCAAAAGTGGGTGG + Intronic
1197736022 X:129850808-129850830 CCGTCTGGGAAGGAGGTGGGGGG + Intergenic
1197977129 X:132177906-132177928 GCGCCTGGTCAGAAGGTGGAGGG + Intergenic
1198189470 X:134288015-134288037 GCTCCTGGGCAGAAAGGGGCAGG + Intergenic
1198957575 X:142149167-142149189 GCTCCAGGGCTGACGGTGGGTGG + Intergenic
1199198246 X:145057591-145057613 TCTGTTGGCCAGAAGGTGGGTGG - Intergenic
1199861130 X:151801279-151801301 ATTCCTGGGCAGAAGGGGGCGGG - Intergenic
1200553574 Y:4607401-4607423 ACGCCTTGCCAGAAGGTGGGGGG + Intergenic