ID: 956467667

View in Genome Browser
Species Human (GRCh38)
Location 3:69535641-69535663
Sequence CCGCCCCTGCCTCCGGCCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 676
Summary {0: 1, 1: 0, 2: 8, 3: 76, 4: 591}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956467667 Original CRISPR CCGCCCCTGCCTCCGGCCCT AGG Intronic
900137834 1:1125912-1125934 CGGACCCTGCTTCCAGCCCTGGG + Intergenic
900142814 1:1145627-1145649 CTGCCCCTGCCCCCAGCCCTCGG - Intergenic
900162654 1:1231788-1231810 CCGCCGCCGCCTCCCGCCTTGGG - Intronic
900178704 1:1302137-1302159 CCGCCCCTGCATCTGGGCCTGGG - Intronic
900349260 1:2227251-2227273 CCGCCCCGCCCGCCGGCCCCTGG - Intergenic
900412672 1:2520026-2520048 CCGCGCGTGCCTCCTGCCATGGG - Intronic
900522814 1:3113764-3113786 CAGCCTCTGCCTCTGGCCCAGGG - Intronic
900671314 1:3856839-3856861 CCGCTCCCCACTCCGGCCCTGGG + Intronic
902250632 1:15152760-15152782 GCGGCTCTGCCTCCGCCCCTTGG - Exonic
902690561 1:18108026-18108048 GCGCTCCTGCCTCCGGCCACTGG - Exonic
902760894 1:18580194-18580216 CTGCCCCTGCCTGAGGCCCCAGG - Intergenic
902873080 1:19325847-19325869 CCTCCTCTGTGTCCGGCCCTGGG + Intronic
903135940 1:21309214-21309236 CCTCCCCTGACTCCAGCCCAGGG - Intronic
903244442 1:22005559-22005581 CTGTCCCTGCCTGTGGCCCTGGG + Intronic
903296968 1:22350197-22350219 CCGCCTCTGCCTTCCGCACTGGG + Intergenic
903883703 1:26529600-26529622 CCGCCCCTGCCGCGAGCCCCCGG - Intergenic
904237373 1:29123949-29123971 CCGGCCCCGCCTCCAGCCCCCGG + Intergenic
904285034 1:29448614-29448636 CCCCTGCTGCCTCCAGCCCTGGG - Intergenic
904461861 1:30685400-30685422 CCGCCCCCTCCCCCGGCCCTGGG + Intergenic
904528772 1:31154949-31154971 CCGCCCCCGCCCCCGCCCCAAGG - Intergenic
904749167 1:32730261-32730283 CTGCCCCTCCCTCCGACCCTGGG + Intergenic
905028946 1:34868789-34868811 CCGCCCCCACCCCCGGCCCTGGG - Exonic
905037820 1:34929334-34929356 ACGCCCCGGGCTCCGGCGCTCGG - Intronic
905865167 1:41372502-41372524 ACTCCCCTGCCCCAGGCCCTGGG - Intronic
905870992 1:41404588-41404610 CCCTCCCTGCCTCCGTGCCTTGG + Intergenic
906056902 1:42924704-42924726 TCGCAGCTGCCTCCCGCCCTGGG - Intergenic
906315850 1:44786110-44786132 TCGCCCGTCCCTCCGGGCCTGGG + Exonic
906325596 1:44843417-44843439 CCGCGCCTCCCTCCCGCCCGCGG + Intergenic
906727179 1:48052500-48052522 CCTCCTCTGCCCCCTGCCCTTGG - Intergenic
907012668 1:50978051-50978073 CCGCTCCCGCCTCCTGCCCGCGG - Intergenic
907085780 1:51672492-51672514 CAGCCCCAGCCCCCGGCCCCAGG + Intronic
907243492 1:53093270-53093292 CCAGGCCTGGCTCCGGCCCTGGG - Intronic
907319808 1:53595094-53595116 CAGCCTCTGCCTCCTGCCCTGGG - Intronic
907929167 1:58982923-58982945 CCGCCCTTGCCTCTGGACTTGGG + Intergenic
912539962 1:110407416-110407438 CCGCCCCGCCCTGCGGCCTTGGG + Intronic
915146172 1:153796835-153796857 CCGCCCTTACCTCCTGACCTTGG - Intergenic
915359700 1:155278394-155278416 CCGCCCCCGCCTTCAGCACTAGG - Intronic
915473601 1:156139693-156139715 CCACCCCTGCCCCCAGCCCCGGG + Exonic
915474882 1:156147469-156147491 CCGCCCCTCCCTCCCACCCCAGG - Intronic
916484164 1:165243356-165243378 AAGCCCCTGCCTCCGCCCCCAGG + Intronic
919303929 1:195805947-195805969 CAGCACCTGCCTCCAGACCTAGG + Intergenic
919639765 1:200036509-200036531 CCGCCCCTGCCTCTGCCTCTTGG + Intronic
919972725 1:202591381-202591403 GCCCCCCTGCCTGCGGCCCCTGG - Exonic
919972949 1:202592383-202592405 CCACCCCTGCCTCCTCCCATCGG - Exonic
920234683 1:204494807-204494829 CCGCCCCGCCCTCCGGCTCGCGG - Intergenic
920252188 1:204629120-204629142 CCGCCCTTGCCTCTGTCCCAGGG - Intronic
920398258 1:205661700-205661722 CAGCCCAAGCCTCTGGCCCTGGG + Intronic
920528446 1:206685166-206685188 CCGCCCCCTCCTCCGGCTCCGGG - Exonic
920699274 1:208205379-208205401 CCTCCCCTACATCTGGCCCTAGG + Intronic
921389803 1:214606357-214606379 CCTCCCCTACCTCCGCCCCAGGG - Intronic
922753423 1:228081733-228081755 CAGGCCCTGCCCCCGGGCCTCGG + Intergenic
1062838310 10:650625-650647 GCTTCCCCGCCTCCGGCCCTCGG - Intronic
1063112007 10:3046037-3046059 CCGGCCCTGCCTCCCGCTCCAGG - Intergenic
1063338948 10:5244863-5244885 CAGGCCCTGCCTCCAGCACTGGG - Intergenic
1063418105 10:5889887-5889909 CCGCCCCAGCCTCCAGCCCCTGG + Exonic
1063713940 10:8508885-8508907 CCGCCCCAGAGTCCAGCCCTGGG - Intergenic
1064274203 10:13891779-13891801 CCGCCCCCGCCGCGGGCCCTCGG + Intronic
1064618700 10:17192034-17192056 CCCCACCTGCCTCCTGGCCTGGG - Intronic
1065024204 10:21526066-21526088 CCGCCCCCGCCGCCAGCCCCGGG + Intergenic
1066061058 10:31723989-31724011 CCACCTCTGCCTCCAACCCTAGG + Intergenic
1067077196 10:43194919-43194941 CTGCCCATGCCTCTGGTCCTGGG - Exonic
1067096542 10:43305058-43305080 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
1067116059 10:43436567-43436589 CAGCCTCTGCCGCCGGCTCTTGG - Intergenic
1067217746 10:44316729-44316751 CTGCCCCTCCCACCAGCCCTGGG + Intergenic
1067266543 10:44750331-44750353 TCACCCCTCCCTCCAGCCCTTGG - Intergenic
1067375779 10:45727003-45727025 GCGCCGCTGCCTCGGGCCTTGGG + Intergenic
1067433956 10:46264441-46264463 CCACCCCTGCCTCCTGGCCCAGG + Intergenic
1067439737 10:46301868-46301890 CCACCCCTGCCTCCTGGCCCAGG - Intronic
1067883489 10:50067691-50067713 GCGCCGCTGCCTCGGGCCTTGGG + Intergenic
1069142085 10:64839561-64839583 CCCCCCATACCTCTGGCCCTGGG + Intergenic
1069625123 10:69863050-69863072 CCTCCCGTGCCTCAGTCCCTAGG - Intronic
1069769351 10:70887921-70887943 CCGCCCCCGCCCCCGCCCCGGGG + Intronic
1069837626 10:71319270-71319292 CCGCCGCTGCCTCCGGCGCACGG - Exonic
1070257571 10:74825365-74825387 CCGCCCCAGTCTCCGCCCCGGGG - Intergenic
1070788802 10:79177579-79177601 CGGACCCTGCCTCCTGCCCCGGG + Intronic
1071784110 10:88880211-88880233 CCTCCCCTGCCCCGGCCCCTGGG - Exonic
1072511518 10:96130490-96130512 CCGCCCCTTCCTCCGGGGTTCGG - Intronic
1072623976 10:97099167-97099189 CTGCCCCTCCCTCAGGCCATTGG + Intronic
1072926579 10:99621335-99621357 CCTCCCCCGCCTTCGGCTCTTGG - Intergenic
1073185125 10:101611259-101611281 CCACCCCTGCCTCTGGGCCAGGG - Exonic
1073294809 10:102432496-102432518 CCCCTCCTGCCCCCGGCCCAGGG - Intronic
1073379216 10:103065348-103065370 CCGACTCTGGCTCCGGCCCTCGG - Intronic
1074088357 10:110225917-110225939 CCGCCCCTGCCTCTGCCCCCTGG - Intronic
1074585886 10:114767901-114767923 CTTCCCCTGCCCCCGGCCCCCGG + Intergenic
1074831999 10:117255704-117255726 CCACCCCTGCCTCCAGCACGCGG - Intronic
1074866110 10:117545299-117545321 CCTCCCCTGCCTCCAGCGCCCGG + Intronic
1075492140 10:122880198-122880220 CCGCTCATGCCTCGGGGCCTCGG - Intergenic
1076035579 10:127196424-127196446 CCGCCCCCGCCTCCTGGCCCTGG - Intronic
1076279784 10:129236628-129236650 CCGCCGCTTCCTCCGGCGCTGGG - Intergenic
1076334533 10:129696720-129696742 CCAACTCTGCCTCCAGCCCTCGG - Intronic
1076491140 10:130862350-130862372 GCTCCCCTCCCTCCAGCCCTGGG + Intergenic
1076738466 10:132468958-132468980 CAGCCCCTGCCCCCTGCCCAGGG + Intergenic
1076752135 10:132548609-132548631 CAGTCCCTGCTCCCGGCCCTGGG + Intronic
1076804012 10:132846252-132846274 CCGCCCAGGCCTCGGGCCCCTGG - Intronic
1076849946 10:133087874-133087896 ACGCGCCTGCCTCCGGCCCCGGG + Intronic
1076870353 10:133189839-133189861 CCAGCCCTGCCCCCAGCCCTCGG + Intronic
1076889539 10:133276937-133276959 CCGCCCCTCCCACCGGCCGAGGG - Intergenic
1076919112 10:133442108-133442130 CCTCCCCTGCCTCTGTGCCTGGG + Intergenic
1077081448 11:726241-726263 CTGCCCCCGCCCCCGGCCCAGGG - Intronic
1077111515 11:864166-864188 CCTCCCCTGCCCCCATCCCTGGG - Intronic
1077131478 11:975098-975120 CCGTCCCTACCTCTGGCCCTAGG - Intronic
1077143995 11:1036768-1036790 CCGCACCTGCCTGCGCCCCGCGG + Intergenic
1077173369 11:1178212-1178234 TTGCCTCTGGCTCCGGCCCTCGG + Intronic
1077196954 11:1285936-1285958 CCGCACCTGCCCTAGGCCCTGGG + Intronic
1077204937 11:1337495-1337517 CCGCCCCCGCCTCGGGCCCCCGG - Intergenic
1077356417 11:2120961-2120983 CTCCTCCTGCCTCAGGCCCTGGG - Intergenic
1077600692 11:3572483-3572505 CTGGCCCTGGCTCCTGCCCTGGG + Intergenic
1078167900 11:8906004-8906026 CAGCTCCTGCCTCTGGTCCTAGG - Intronic
1078618433 11:12885916-12885938 CGGCCACAGCCTCCGCCCCTGGG + Intronic
1078659865 11:13278002-13278024 GCGCCCCTGCCGCCGCCCCGGGG + Intronic
1078771853 11:14358906-14358928 CCGCCGCTGCCGCCCGCCCTAGG + Exonic
1080609647 11:33892894-33892916 CTGGCCCTGCCTCTGACCCTGGG + Intergenic
1081402791 11:42662201-42662223 CCTCTCCTGCCTCTGGCCCATGG + Intergenic
1081873007 11:46391705-46391727 CCGTCCCCGCCCCCGGCCCTCGG - Intergenic
1082005306 11:47415809-47415831 CCGCCCCAGCCTTGGCCCCTAGG - Exonic
1082159945 11:48880087-48880109 CCGCCCACGCCTCAGGCCCCCGG + Intergenic
1083212039 11:61194168-61194190 CCTCCCCTGCCTCTGAGCCTTGG - Intergenic
1083265853 11:61546560-61546582 CCGCCCCTGCCCCAGGCGGTGGG - Intronic
1083436565 11:62647306-62647328 AGCCTCCTGCCTCCGGCCCTGGG - Exonic
1083478208 11:62927239-62927261 GCGCCCCTGCCGCGGCCCCTAGG + Intergenic
1083583318 11:63839101-63839123 CCGCCACCACCGCCGGCCCTCGG - Exonic
1083593833 11:63909812-63909834 CCGCCCAGGCCTCCAGCCCAGGG - Exonic
1083613446 11:64015169-64015191 CCTCCCCTGCCCCTCGCCCTCGG - Intronic
1083661631 11:64254171-64254193 CCTCACCTCCCTCTGGCCCTAGG - Intronic
1083663363 11:64262295-64262317 CCGCCCCTGACCCTGGACCTTGG + Intronic
1083755946 11:64791837-64791859 CCCTCCCTGCCTCCCTCCCTCGG + Intronic
1083860743 11:65418680-65418702 CCTCTCCTGCCTCCTGACCTGGG + Intergenic
1083894763 11:65614259-65614281 CCACCTCTGCCTCCCGCCCCCGG - Intronic
1084021343 11:66420067-66420089 CCGCCCCCGCCCCCGGCCCGCGG + Intergenic
1084112590 11:67023524-67023546 CAGCCCCCTCCTCGGGCCCTGGG + Intronic
1084162331 11:67356605-67356627 ACCCCCCTTCCTCAGGCCCTTGG + Intronic
1084186642 11:67476190-67476212 CCGGCCCGCCCGCCGGCCCTGGG + Intergenic
1084187302 11:67481164-67481186 ACCCCCCTGCCCCCAGCCCTTGG + Intergenic
1084446862 11:69208894-69208916 ACGCCTCTGCCTCAGGCTCTGGG + Intergenic
1084764721 11:71300827-71300849 AGGCCCCTGCCTCCTTCCCTGGG - Intergenic
1084816177 11:71648262-71648284 CCGGCCCTGGCTCCTGCCCCAGG - Intergenic
1085053633 11:73392124-73392146 CCCCCACTGACTCGGGCCCTGGG + Intronic
1085650391 11:78262612-78262634 CAGCCCCTGCCTCCAGTCCCGGG + Intronic
1086158250 11:83692469-83692491 CACCCCCTACCTCCAGCCCTAGG - Intronic
1086697987 11:89865599-89865621 CCGCCCACGCCTCCGGCCGCCGG - Intergenic
1086708175 11:89978889-89978911 CCGCCCACGCCTCCGGCCGCCGG + Intergenic
1088604456 11:111514675-111514697 CAGCCCCTGCCGGCTGCCCTCGG - Intergenic
1088797438 11:113275193-113275215 TCGCCCCTGCATCCAGGCCTTGG - Intronic
1089494987 11:118903299-118903321 CCGCCCCCGCCCCCGCCCCCAGG + Exonic
1090000460 11:122952131-122952153 CCCCCTCCGCCTCCAGCCCTAGG - Intronic
1090078615 11:123595366-123595388 CCGCCCCTGCCCCCAGCCCCTGG + Intronic
1090080567 11:123609640-123609662 CCCACCCTCCCCCCGGCCCTCGG + Intronic
1090190072 11:124761566-124761588 CCCCTCCTGCTTCCTGCCCTGGG - Intronic
1090243522 11:125200265-125200287 CCTCCCCTGCCTCTAACCCTTGG - Intronic
1090498156 11:127234628-127234650 CCACCCCAGCCACCAGCCCTGGG - Intergenic
1091268612 11:134289974-134289996 CCGCCCCGGCCTCCAGCCAGAGG - Intronic
1091630674 12:2158326-2158348 CCGCCTCTGCCTCTGGTACTGGG - Intronic
1091750506 12:3018954-3018976 CCGCCCCTGCCGACTCCCCTGGG - Intronic
1091771807 12:3156887-3156909 CAGCCCTTGCCCCCTGCCCTGGG - Intronic
1092743102 12:11649314-11649336 CCTCCCCTGGCTCCGTCTCTTGG - Intergenic
1092821410 12:12357005-12357027 CCGCCCCTCCCTCGGGCCGGGGG + Intergenic
1093547960 12:20369662-20369684 CAGCCCCTGGCTGCAGCCCTCGG + Exonic
1093653905 12:21674179-21674201 CTGCCCCTGCCCCTGCCCCTTGG + Intronic
1093883612 12:24434560-24434582 CAGGCCCTACCTCCAGCCCTAGG - Intergenic
1094446511 12:30536555-30536577 TCGCCCCTGCCTCGGGTCTTTGG - Intergenic
1094703997 12:32896964-32896986 CCGCCCCCGCCCCCGCCCCCGGG - Intergenic
1095097948 12:38158024-38158046 CAGCCCCTGCGTCAGGCCCGGGG + Intergenic
1096325111 12:50653444-50653466 CCGCCCCTACCCCCAGCCCTGGG + Intronic
1096336946 12:50764058-50764080 CCGCCCCCGCCCCCGCCCCCAGG + Intronic
1096346248 12:50849539-50849561 CTGCCCCTGCATCCAGCCCTTGG + Intronic
1097194452 12:57235915-57235937 GTACCCCTGCCTCCTGCCCTGGG + Intronic
1097280888 12:57845201-57845223 CCGCCCCAGCCTCCGGGGCCAGG + Intronic
1097282343 12:57852727-57852749 TCGCCCCACCCTCCGGTCCTGGG + Intergenic
1098255151 12:68609184-68609206 CCGCCCCCACCTCCCACCCTCGG - Intergenic
1098819009 12:75207198-75207220 CCCCCCATGCCTGAGGCCCTGGG + Intronic
1099951393 12:89308414-89308436 CCGCTCCTGCCTCAGACTCTAGG - Intergenic
1101605786 12:106247247-106247269 CGGCTCCCGCCTCCGGGCCTGGG + Intronic
1102136865 12:110582940-110582962 CCGCCGCCGCCGCCGGCCCTGGG + Exonic
1102243709 12:111341856-111341878 CAGCCCCTGCCTGCAGCCCCAGG + Exonic
1102389332 12:112536901-112536923 CAGCCTCTGCCTCCAGCACTTGG - Intergenic
1102453346 12:113057042-113057064 TCGTCTCTGCCTCCCGCCCTGGG - Intronic
1102471400 12:113161797-113161819 CCGCCCCCGCCCCCGCCCCCAGG + Intronic
1102475442 12:113185555-113185577 TCGCCAGTGCCTGCGGCCCTCGG + Exonic
1102569424 12:113818477-113818499 CCGCCCCAGCCTCTGGACGTGGG + Intronic
1102750944 12:115293697-115293719 TCTCCCCTGCCTCCAGCCCTTGG - Intergenic
1103400722 12:120641163-120641185 TCGCCGCTGCCGCCGGCCCGCGG + Exonic
1103533705 12:121620315-121620337 CCATCCCTGCCTCCTGCCCCAGG - Intergenic
1103700394 12:122846173-122846195 CAGCCCCTGCCTCCTGCCCTGGG + Intronic
1103845179 12:123897005-123897027 TCGCCCCTCCCTCCAGCCCCTGG + Intronic
1104866965 12:131961475-131961497 CCGCCGCTGCCCCGGCCCCTGGG + Exonic
1104885514 12:132104843-132104865 CCGCCGCTGCCCCGGCCCCTGGG + Exonic
1104893490 12:132151159-132151181 GCGCCCCTTCCTCCCGCCCAGGG - Intronic
1104949659 12:132433735-132433757 CAGCGCCTGCCTGGGGCCCTGGG - Intergenic
1104972501 12:132538319-132538341 GCACCCCTGCCTCTGGCCCCAGG - Intronic
1104975858 12:132551720-132551742 CCGCCCCCTCCCCTGGCCCTTGG + Intronic
1104977738 12:132559860-132559882 CCGCGCCCGCCGCCGGCCCGGGG - Intronic
1105988256 13:25590845-25590867 CTCCCCCTGCCTCCTGCCCTTGG - Intronic
1106161289 13:27203396-27203418 CCACTCCTGCCTCCACCCCTCGG - Intergenic
1109994641 13:70107777-70107799 CCGCCTCTTCCTCCGCCCCCGGG - Exonic
1111653653 13:91126052-91126074 CTACCCCTGCCTCCAGCCCTTGG + Intergenic
1111934969 13:94549099-94549121 CCGGCCCTGGGTCTGGCCCTGGG - Intergenic
1112507811 13:99985445-99985467 CCGCCGCTGCCGCCGCCGCTGGG - Exonic
1112752476 13:102596939-102596961 TCGCCCCCGCCTCCGGCCCGAGG + Intergenic
1112771558 13:102799526-102799548 CGGCCCCTGCCCCCCGCCCCGGG - Intronic
1113378128 13:109782938-109782960 CCGCCACCGCCGCCGGCCCCGGG - Exonic
1113473285 13:110561769-110561791 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
1113523011 13:110953910-110953932 GCACCCCCGCCTCCTGCCCTGGG + Intergenic
1113697100 13:112354468-112354490 CCGACCCGGCCTCCCTCCCTGGG + Intergenic
1113702358 13:112396899-112396921 GCACCCCCGCCTCCTGCCCTGGG - Intronic
1113769237 13:112897985-112898007 CCGGCCCCGGCCCCGGCCCTGGG + Intronic
1114073234 14:19131903-19131925 CTGCCCCTGACGCTGGCCCTTGG - Intergenic
1114089032 14:19268080-19268102 CTGCCCCTGACGCTGGCCCTTGG + Intergenic
1114415302 14:22538893-22538915 CAGCCCCTGGCTCCCGCCCCTGG + Intergenic
1114549579 14:23525258-23525280 TCCCCCCTGCCTCAGGCTCTGGG + Exonic
1115851235 14:37591948-37591970 CCGCCCCCGCCGCCGGCCCCCGG + Exonic
1116286404 14:42978218-42978240 CCTCCCCTGCTCCCAGCCCTTGG + Intergenic
1116310999 14:43326703-43326725 CGGCCGCCGCCACCGGCCCTGGG + Intergenic
1117253658 14:53957039-53957061 ACGCCGCTGCCTCCAGCTCTGGG + Intronic
1118009174 14:61592070-61592092 CAGCCCCTCCCTCCAGGCCTGGG + Intronic
1118854123 14:69608145-69608167 CCTTCCCTGCCTCCCTCCCTAGG - Intergenic
1119759734 14:77141836-77141858 CCACCCCTCCCTCCGCTCCTGGG + Intronic
1120720689 14:87887327-87887349 CAGCCCCTGCTTCCAGCCCTTGG + Intronic
1121106531 14:91283510-91283532 CCTCTTCTGCCTCAGGCCCTGGG - Exonic
1121871485 14:97412079-97412101 CTGCCCCCACCTCCGGCCCTGGG + Intergenic
1122324429 14:100874227-100874249 CCTCCCCATCCTCCGTCCCTTGG + Intergenic
1122550014 14:102544635-102544657 CCGCCGCGGCCCCCGGCCCCCGG - Intergenic
1122627895 14:103093661-103093683 CCGTCCCTGCCCTCAGCCCTAGG + Intergenic
1122787077 14:104168766-104168788 CTTCCCCTGCCCCCGGGCCTTGG - Intronic
1122843797 14:104479702-104479724 CCCCACCTGCCCCCTGCCCTGGG + Intronic
1122922689 14:104886507-104886529 CCACCCCTGGCTCGGGGCCTCGG - Exonic
1122935576 14:104954505-104954527 CCGGCCCTGCCTTCTGCTCTTGG + Exonic
1123037991 14:105479075-105479097 CCGCCCCCGCCCCCGCCCCGGGG + Intronic
1124121741 15:26894087-26894109 GCGCTCCAGCCTCCGGCCCTTGG - Intronic
1124291730 15:28457535-28457557 CCGCCCTTCCCCCCGGCCCCCGG + Intergenic
1124338727 15:28876344-28876366 CCTCCCCTGCCTCGGAGCCTAGG + Intergenic
1124411114 15:29438085-29438107 CGCATCCTGCCTCCGGCCCTGGG + Intronic
1124859330 15:33423158-33423180 CCATCCCTGCCTCCAGCCCCTGG + Intronic
1124983423 15:34583877-34583899 CGGCCCCTGGCCCCGGCACTGGG + Intronic
1125685166 15:41559435-41559457 CCGCCCCGGGCTCCGACCCCCGG - Intronic
1126777609 15:52112809-52112831 CCGCCCCGGCCCCCGGCCCCCGG + Intergenic
1128627254 15:69222315-69222337 CCACCCCTGCCTCCCACCCATGG - Intronic
1129167627 15:73787734-73787756 GCGGCTCTGCCTCCTGCCCTAGG + Intergenic
1129228657 15:74184444-74184466 CTGCCCCTTCCACCTGCCCTGGG + Intronic
1129333175 15:74838164-74838186 CAGCTCCCGCCTCCGGCCCGGGG + Exonic
1129470289 15:75750013-75750035 CCTCCCCTGCATCCAGCCCTGGG + Intergenic
1129539103 15:76336702-76336724 CCGCCCCCAGCTCCGGCCCGGGG + Exonic
1129606743 15:77028683-77028705 CCCCCACTGCCCCCAGCCCTGGG - Intronic
1129734726 15:77953102-77953124 CCGCCCCTGCATCCAGCCCTGGG - Intergenic
1129840864 15:78742889-78742911 CCGCCCCTGCATCCAGCCCTGGG + Intergenic
1130040721 15:80403996-80404018 CCGCCCTGGCCTCCTGGCCTGGG + Intergenic
1131174504 15:90201453-90201475 GGGCCCCCGCCTCCGGACCTGGG - Exonic
1131830527 15:96352111-96352133 CCGCGCCTGGCCCCTGCCCTGGG + Intergenic
1132223601 15:100123820-100123842 CTGCCCCTGCCTCTGCCTCTGGG + Intronic
1132357091 15:101179774-101179796 CCAACCCTGCCTCCGCCCCGTGG + Intronic
1132362778 15:101231427-101231449 CTTCCTCTGCCTCCGGCCCCTGG - Intronic
1132498458 16:274656-274678 CAGCCCCTCCCTCAGGACCTGGG + Intronic
1132500280 16:281904-281926 GGGCCCCTGCCACCGGCCGTGGG + Exonic
1132585024 16:702347-702369 TCGCCCCTGCCTCCTGCTCCGGG + Intronic
1132607591 16:800046-800068 CCCCACCAGCCTCAGGCCCTGGG - Intronic
1132654917 16:1037733-1037755 CAGCCTCTGCCTCCTGACCTGGG + Intergenic
1132794529 16:1712864-1712886 CCGCCCCTGCCTGGGGAGCTGGG + Intronic
1132880399 16:2159543-2159565 CAGCCCCTGCCTCAGCCCCCTGG - Intronic
1132938876 16:2497144-2497166 CTGCCCCAGCCCCCGACCCTGGG - Intronic
1132999642 16:2842396-2842418 CCGCCTCTGCCCCTGGCCCTGGG - Intergenic
1133166225 16:3949554-3949576 CAGCCCCTTCCTCCCGCCCTTGG + Intergenic
1133784495 16:8963743-8963765 CCGCCGCTCCCGCCGGCCCCAGG - Intronic
1134135157 16:11672724-11672746 CTGCCCATGCCTCCTGGCCTGGG + Intronic
1135526191 16:23215344-23215366 TTGCACCTGCCTCCAGCCCTAGG + Exonic
1136316183 16:29455742-29455764 CCGCACGTGCCTCTGGCCTTCGG + Exonic
1136430760 16:30195084-30195106 CCGCACGTGCCTCTGGCCTTCGG + Exonic
1136462197 16:30418433-30418455 TCGCCCCGGCCTCCGGGTCTGGG + Exonic
1136497793 16:30654681-30654703 ACGCCCCCGCCTCAGTCCCTGGG + Exonic
1136519453 16:30786700-30786722 CCGCCCCTGCCCCGGCCCCCGGG + Intronic
1136707053 16:32200135-32200157 CCGCCCCTCCCCCCGGCCCCTGG - Intergenic
1136760857 16:32729282-32729304 CCGCCCCTCCCCCCGGCCCCTGG + Intergenic
1136807246 16:33141104-33141126 CCGCCCCTCCCCCCGGCCCCTGG - Intergenic
1138178593 16:54928373-54928395 CCGCCCCCGCCCCCGCCCCGTGG - Intergenic
1138186575 16:54982044-54982066 CCACACCTGCCCCCGGCTCTAGG - Intergenic
1138477241 16:57278905-57278927 CCGGCTCTGTCTCCGGCCCCAGG - Intronic
1138551642 16:57751924-57751946 CCTGCCCTGCCTCCAGCTCTGGG + Exonic
1138681131 16:58684410-58684432 CCGCCCCGGCCTCCTGGCCCGGG - Exonic
1139302776 16:65959602-65959624 CCTCCCCTGTCTGCGGACCTAGG + Intergenic
1139352888 16:66348327-66348349 CCAGCCCTGCCTCAGGCCCACGG - Intergenic
1139465042 16:67149989-67150011 CCGCCCGAGCCTGCGCCCCTGGG + Exonic
1139593159 16:67944174-67944196 CCGTCCCTCCCACTGGCCCTAGG - Exonic
1139952165 16:70677752-70677774 CTGCCCCTGGCCCTGGCCCTTGG + Intronic
1140023583 16:71262759-71262781 CCGGCACTGCCTCAGGTCCTGGG - Intergenic
1141079205 16:81035959-81035981 CCGCCGCCGCCTCGGGCCCGTGG + Exonic
1142136339 16:88453529-88453551 CCGCTCATGCCCCCGGCCCCCGG - Exonic
1142173606 16:88634998-88635020 CCTCCCCGGCCTCCCTCCCTCGG - Intergenic
1142244456 16:88963153-88963175 CCTTCTCTCCCTCCGGCCCTGGG - Intronic
1203063009 16_KI270728v1_random:989596-989618 CCGCCCCTCCCCCCGGCCCCTGG + Intergenic
1203120209 16_KI270728v1_random:1529629-1529651 CCCCCCCCACCCCCGGCCCTGGG - Intergenic
1142670628 17:1485933-1485955 CCGCCCCCGCCCCCGGCCCGCGG - Intronic
1143010168 17:3861872-3861894 CTGCCTCTGCCTCCTGCCCCAGG + Intronic
1143036929 17:4004803-4004825 CCGCCTCTGTCTCCGGCCACCGG - Exonic
1143487153 17:7261431-7261453 CCGCACCGCCCTTCGGCCCTCGG + Intronic
1144099933 17:11934178-11934200 CAGCCCCTGCCTGCAGCCCATGG - Intronic
1144837260 17:18163169-18163191 CAGCCCTTGTCTCCTGCCCTGGG - Intronic
1144854081 17:18258501-18258523 CCGCCCCGGCCGCAGTCCCTGGG + Intronic
1145905030 17:28511558-28511580 GTGCCCCTGCCTCCTCCCCTGGG - Intronic
1146293588 17:31630797-31630819 CCGTCCCTGCCCCCAACCCTGGG - Intergenic
1146445292 17:32928087-32928109 GCGCCCCGGCCCCCGGCCCCCGG - Exonic
1147168561 17:38605582-38605604 CCGCCCCCGCCCCCGGCCGAGGG + Intronic
1147315286 17:39617489-39617511 GCGCTCCAGCCTCTGGCCCTTGG + Intergenic
1147608051 17:41785462-41785484 CGGCCCCTACCTCAGGCCCCTGG + Intronic
1148342422 17:46881225-46881247 CCACCTCTGCCTCCCGCCCTGGG - Intronic
1148647943 17:49230081-49230103 CTGCCCCTGCCCCTGCCCCTAGG - Intronic
1149491257 17:57086205-57086227 CCGGCCCCGCCTGCGGCCCAGGG + Intronic
1150060623 17:62065443-62065465 GCCCTCCCGCCTCCGGCCCTCGG - Intergenic
1150273668 17:63882465-63882487 CCGCCCCCGCCCCCGCCCCAAGG - Intergenic
1150398213 17:64837196-64837218 CCGGCCCTGCCCCCGGCCCGCGG + Intergenic
1151227576 17:72658249-72658271 CTGCCCCTGCATCCAGCCCACGG - Intronic
1151666289 17:75546885-75546907 CCGCTCCAGGCTCCAGCCCTGGG - Intronic
1151747858 17:76021439-76021461 CCGCCCCTGCCGCCTGCCCGAGG + Intronic
1151785407 17:76272660-76272682 CTGCCTCTGCCTCCTGCCCGGGG + Intergenic
1152029249 17:77831381-77831403 ACGCCCCTGCCTGTGCCCCTGGG + Intergenic
1152175168 17:78782369-78782391 CGCCCCCTGCCCCCGGCCCGAGG + Intergenic
1152189560 17:78880112-78880134 CCGCCCCTCCGGCCAGCCCTTGG - Intronic
1152209470 17:78995359-78995381 CCGCACCTGGCTCCCGCCCAGGG + Intronic
1152362939 17:79840699-79840721 GCGCCCCTGCCCCTGCCCCTCGG - Intergenic
1152368581 17:79871266-79871288 CCGCCGCAGCCTCCGCCCCTCGG + Intergenic
1152375482 17:79916718-79916740 CCCCTCCTGCCGCCGCCCCTGGG + Intergenic
1152586889 17:81193216-81193238 CCTCCCCTGCCTCCGGCCTGAGG + Intronic
1152656036 17:81519604-81519626 CCGCTCCTCCCTCCGCCACTGGG + Intronic
1152781986 17:82230751-82230773 CCGCCCCTGCCCCAGGGCCCGGG - Intronic
1153457231 18:5295278-5295300 CCGCCCCCGCCCCCGGCCGCGGG - Intronic
1154298892 18:13175448-13175470 CCGCCCCTTCCTCCAGGCGTGGG - Intergenic
1156008527 18:32470736-32470758 CCGCCTCCTCCTCTGGCCCTGGG + Intergenic
1156334980 18:36162221-36162243 CCCCTCCTGCCTCCATCCCTAGG + Intronic
1156350375 18:36297492-36297514 CCGCCTCCGCCGCCGGCCTTTGG + Intergenic
1157339903 18:46769574-46769596 CCGACCCTGCCTCTGGCCCTGGG - Intergenic
1157440287 18:47706286-47706308 CAGGCCCTGCCTCCAGCACTGGG + Intergenic
1157519904 18:48338285-48338307 CTGCTCATGCCTCAGGCCCTGGG + Intronic
1157879356 18:51305189-51305211 CCACCACTGCCTCAGGCCCATGG - Intergenic
1158579803 18:58671538-58671560 CCGCCCCTGCCTCCGCGGCTCGG + Exonic
1159516543 18:69466170-69466192 CCGCCCCTCCCTCCAGCCCTTGG + Intronic
1160201843 18:76802259-76802281 CAGCCCCAGCCTCCTACCCTGGG - Intronic
1160291962 18:77603097-77603119 CAGGCCCTACCTCCGGCTCTGGG + Intergenic
1160510775 18:79452237-79452259 CCATCCCTGCCTCCGACCCCAGG - Intronic
1160567997 18:79798690-79798712 GCGCCCCGTCCTCCGGCCCGGGG + Intergenic
1160720993 19:596835-596857 CCTCTCCTGCCTCTCGCCCTGGG - Intronic
1160808265 19:1001787-1001809 CCGCCTCTCCCACCAGCCCTAGG - Intronic
1160836768 19:1128286-1128308 CCGCCCCTGCCTCCGGCACAGGG - Intronic
1160843103 19:1155162-1155184 CCTCCCCTTCCTGCCGCCCTCGG - Intronic
1160863722 19:1248452-1248474 CCGCCCCTGCCTGCCGGCCCTGG - Intergenic
1160941419 19:1622025-1622047 CACCCCCTGCCCCCTGCCCTGGG + Intronic
1160948265 19:1653252-1653274 CCGACTCTGGCTCCGGCTCTGGG + Intergenic
1160986398 19:1840939-1840961 CTGCCCCTGCTTCCGGCCTCAGG - Intronic
1161022138 19:2015536-2015558 CCGCCGCCGCCGCCGCCCCTGGG - Exonic
1161038791 19:2099193-2099215 CACCCCCTGCCTCCCTCCCTGGG - Intronic
1161065650 19:2236102-2236124 CGGCCCCGGCCTCCCGCCCCTGG + Intronic
1161153755 19:2721908-2721930 CCGCCCCTGCCCAGGCCCCTGGG - Intronic
1161210189 19:3061974-3061996 CCCCTCCTGCCGCCGGCCCCCGG - Intronic
1161215784 19:3094527-3094549 CGGCCTCGGCCACCGGCCCTCGG - Exonic
1161256938 19:3314882-3314904 CCCCTCCTGCCCCCGGCCCCGGG - Intergenic
1161345658 19:3767667-3767689 TCCCCTGTGCCTCCGGCCCTTGG + Intronic
1161507057 19:4649801-4649823 CCGCCCCTGCCCTCCGACCTCGG - Intronic
1161619976 19:5292816-5292838 CCGCGCCTGGCTCCGCCCCCGGG + Intronic
1162030208 19:7914060-7914082 CCTCCCCTGCATCCAGCCATGGG + Exonic
1162079408 19:8209447-8209469 CCAGCCCCGCCGCCGGCCCTCGG + Exonic
1162386366 19:10362521-10362543 CAGCCCCAGCCCCCAGCCCTGGG + Intronic
1162744321 19:12790284-12790306 CCGGCCCTGTCTCCGTCACTCGG - Intronic
1163018946 19:14472645-14472667 CCGCCCTTGGCTCCGGCCCTCGG + Exonic
1163158042 19:15449683-15449705 CCGCCCCCGCCCCCGCCCCGGGG + Intronic
1163296358 19:16415414-16415436 CAGACCCTGCCTCCTGCCCAGGG + Intronic
1164650736 19:29889817-29889839 CCTTCCCTGCCTCCAGCCCCAGG + Intergenic
1164834701 19:31349716-31349738 CTGCCCCGGCCCCCGCCCCTAGG + Intergenic
1164834757 19:31349901-31349923 GCGCCCCCGCCCCCGGCCCCAGG + Intergenic
1165092165 19:33393134-33393156 CCGCCCCCACCTCAGCCCCTAGG - Intronic
1165218790 19:34297497-34297519 CCGCGGCTGCCTCTGGCTCTAGG - Intronic
1165224130 19:34342173-34342195 CCGCCCCAGCCTCGGGCACCTGG + Exonic
1165300324 19:34964255-34964277 CCGCCGCCGCCTGCAGCCCTCGG + Intergenic
1165311023 19:35029775-35029797 CCGTTCCTGCCTCAGGGCCTTGG - Intergenic
1165363352 19:35350201-35350223 CCGCTCCTTCCTCCAGCCCTGGG + Intergenic
1166255201 19:41599372-41599394 CCGCCCCCACCCCTGGCCCTGGG + Intronic
1166259361 19:41627104-41627126 CCGCCTCTGCCCCTGGCCCTGGG - Intronic
1166303779 19:41926573-41926595 CCTCCCGTGGCTCTGGCCCTGGG + Intronic
1166499714 19:43331536-43331558 CCGCCCCTGCCCCTGGCCCTAGG - Intergenic
1166704842 19:44903086-44903108 CTGCCCCTGACACTGGCCCTTGG + Exonic
1167103695 19:47418925-47418947 CTGCCCCTCCCTCCGCCCCTGGG - Intronic
1167114448 19:47480484-47480506 CCGCCCCTCCCTGTAGCCCTGGG + Intronic
1167347298 19:48954758-48954780 CCGCACCTGCCTCGCTCCCTCGG - Intergenic
1167548535 19:50143865-50143887 CTGCCTCTGCCTCCTGCCCCTGG + Intergenic
1167660803 19:50794901-50794923 CCGGCCCGGCCTCCCGCCCATGG + Exonic
1167748783 19:51367846-51367868 CCGCCCCTGCCTGCCCGCCTGGG + Intronic
1167877844 19:52429092-52429114 CCGGCCCTGCCCTCGGCCCCGGG + Intergenic
1168059249 19:53882236-53882258 CCGCCCGTGCCTCCGGCTGCCGG + Exonic
1168240487 19:55086641-55086663 CCGCCCCGCCCTCTGGCCCCAGG + Intronic
1168337451 19:55604666-55604688 AAGCCCCGGCCCCCGGCCCTCGG - Intergenic
1168339174 19:55613988-55614010 CCGCCCCTGCCGCCCGCCTTCGG + Exonic
1168445033 19:56404312-56404334 CGGCCCCTGCGGCCTGCCCTAGG + Exonic
925034535 2:675705-675727 AGGCCCCTGCCTCCTGCGCTGGG - Intronic
925160191 2:1678069-1678091 CCGCCCCAGCCTCCTGACCCGGG - Intronic
925371201 2:3346921-3346943 CAGGCCCTGCCTCCAGCACTGGG - Intronic
925385619 2:3459780-3459802 CCTCCCCTGCCTCCCGACCATGG - Intronic
926152524 2:10432883-10432905 CCTCCCCAGCCTCCTGCCCCAGG - Intergenic
927712201 2:25332896-25332918 CCTCCCCTGCCTCCAGGCCGTGG + Intronic
927713951 2:25341205-25341227 CCGCCCCTCCCCCCGGCGCCCGG - Intronic
927809233 2:26172805-26172827 CCGCCCCTGCCCCCGCTCCCCGG - Intergenic
927868125 2:26606027-26606049 CCGCGCCTCCCCCCTGCCCTTGG - Intronic
932406156 2:71513651-71513673 CTGCCCCTGCCCCTGCCCCTGGG - Intronic
932725725 2:74178555-74178577 CCGCCCCCGCCTCGGCCCCCAGG + Intronic
932737028 2:74261394-74261416 CAGCCCCTGCCTGTGGCCTTGGG - Intronic
933762738 2:85683912-85683934 CCACCCCTTCCTCCTTCCCTAGG - Intergenic
936151348 2:110023959-110023981 CAGCCCCTGCCTCTGCCCCAGGG - Intergenic
936193327 2:110347410-110347432 CAGCCCCTGCCTCTGCCCCAGGG + Intergenic
936580375 2:113695116-113695138 CCGCCCCTCCCTCCAGCCTCTGG - Intergenic
938087561 2:128411507-128411529 CCGACCCTGCCCCAGGCCCCCGG + Intergenic
938227514 2:129628495-129628517 CCAGCCCTGCCTCCAGCCCTGGG - Intergenic
938418424 2:131123779-131123801 CCCCCCCCGCCCCCCGCCCTCGG + Intronic
938487159 2:131723267-131723289 CTGCCCCTGACACTGGCCCTTGG - Intronic
940711436 2:157167141-157167163 CCTCCCATCCCTCCTGCCCTTGG + Intergenic
942462610 2:176178645-176178667 CCAGCCCTGCCGCCTGCCCTCGG + Intergenic
943767581 2:191678747-191678769 GCGCCCCTGTCTCCCGCCCCGGG - Intronic
946185499 2:217978563-217978585 CCGCCCCTGCCCCCGCCCCCGGG + Intronic
946322010 2:218959858-218959880 CCCGCCGGGCCTCCGGCCCTTGG - Exonic
946528720 2:220548485-220548507 CCTCACCTGCCTCCAGGCCTTGG - Intergenic
948046633 2:234951057-234951079 GCGCCACTGCCTGGGGCCCTCGG - Intergenic
948806459 2:240455416-240455438 CCACCCCTCCCTCTGGCCCTGGG - Intronic
949014362 2:241701488-241701510 CTGCCCCTCCCTCAGGGCCTGGG - Intergenic
1169211361 20:3767785-3767807 ACGCCCCCGCCTCCGCCCATTGG + Intronic
1169367292 20:5001588-5001610 CCGCCCCCGACCCCTGCCCTCGG + Intronic
1169503461 20:6183866-6183888 CCACCCCTGCCTCCAACTCTGGG - Intergenic
1170101809 20:12709579-12709601 CCTCCCCTTCCTCCTGCCCTTGG + Intergenic
1170606682 20:17879975-17879997 CCTCCTTTGCCTCTGGCCCTGGG - Intergenic
1170613157 20:17930040-17930062 CCTGCCCAGCCTCCTGCCCTTGG - Intergenic
1170697698 20:18674740-18674762 CTGCCCCTGCCTCTGCCCCTGGG + Intronic
1171150898 20:22825741-22825763 CCGCCCCTGCCTCAGCCTCAGGG - Intergenic
1171312399 20:24155162-24155184 CAGCCTCTGCCTGTGGCCCTGGG - Intergenic
1171908888 20:30922431-30922453 GCGCGCCCGCCTCCGGCTCTCGG + Intergenic
1171974869 20:31587940-31587962 CCGCCCCGGCTTCCCGCACTCGG - Intergenic
1172109368 20:32536363-32536385 CCACCTCTTCCCCCGGCCCTGGG - Intronic
1173123176 20:40312556-40312578 CTTCCCCTGCCTCAGGTCCTCGG + Intergenic
1173852403 20:46227455-46227477 CCGCCCCTGGCCCCGCCCCACGG + Intronic
1174171848 20:48622631-48622653 CTGCTCCTGCCTACGGCCCCAGG + Intergenic
1175218245 20:57402704-57402726 CCGCCCCGGCCGCAGGCCCAAGG - Intronic
1175219581 20:57409149-57409171 CCCCCGCTGCCCCCCGCCCTCGG - Exonic
1175727815 20:61331646-61331668 CCGCCCCAGCCACCTGCCCCAGG + Intronic
1175965683 20:62658963-62658985 CCTGCCCTGCCTCCTGCCCTGGG - Intronic
1176016981 20:62938857-62938879 CCGCCACCGCGCCCGGCCCTAGG - Intronic
1176077408 20:63254629-63254651 CCACCCCCGCCTGCGGCCCCTGG + Intronic
1176092842 20:63326568-63326590 CCTCCCCTGCCTCCAGGCCCTGG - Intronic
1176274456 20:64255880-64255902 CCGCCGCCGCCGCCGCCCCTCGG + Intronic
1176368158 21:6045980-6046002 TCCCCCCTGCCTCGGGACCTTGG + Intergenic
1176424959 21:6542898-6542920 CCGCCCCGGTCTCCAGCCCTGGG + Intergenic
1178619252 21:34159460-34159482 CCACTCCTGTCTCCCGCCCTGGG + Intergenic
1178840848 21:36136421-36136443 CCACCCCTCCCTTTGGCCCTAGG + Intronic
1179375569 21:40847188-40847210 CCTCCCCTGCCTCTGGCCGCTGG + Intergenic
1179529730 21:42010427-42010449 CCGCCCCGCCCTCCGGCGCCCGG - Intergenic
1179700448 21:43151207-43151229 CCGCCCCGGTCTCCAGCCCTGGG + Intergenic
1179755361 21:43492562-43492584 TCCCCCCTGCCTCGGGACCTTGG - Intergenic
1179882755 21:44300318-44300340 CCGCCCCGGCCTCCTGCCCCGGG + Intronic
1179979568 21:44889072-44889094 GCGCACCTGCCGCGGGCCCTGGG - Intronic
1180109861 21:45642847-45642869 CGGCCCCAGCCTCCGGGCCGGGG + Intergenic
1180491675 22:15854256-15854278 CTGCCCCTGACGCTGGCCCTTGG - Intergenic
1180876052 22:19175734-19175756 CCACAGCTGCCTCCGGGCCTCGG - Exonic
1180921293 22:19522901-19522923 GAGCCCCAGCCTCCAGCCCTGGG + Intergenic
1180941454 22:19662050-19662072 CCACCCCTGCCTGCTGCCCCCGG + Intergenic
1181440290 22:22932115-22932137 GCCCCCCTGCCTCCCACCCTGGG - Intergenic
1182107217 22:27698155-27698177 AGGCGCCTGCCTCCTGCCCTCGG + Intergenic
1182636108 22:31728326-31728348 GAGCCACTGCCCCCGGCCCTAGG - Intronic
1183482770 22:38074292-38074314 CCACCCCCGCCCCAGGCCCTAGG + Exonic
1183585897 22:38752772-38752794 CCCCCCCGGCCCCCGGCCCCCGG + Intronic
1183633098 22:39045306-39045328 CCGCCCCTGCAGGCTGCCCTGGG - Intronic
1183744793 22:39686148-39686170 CCGCCCCCGCCGCCAGCCCCCGG + Exonic
1184179344 22:42809538-42809560 CCTCCCCTGCCCCTGGCCCCTGG - Intronic
1184197503 22:42940083-42940105 CCGCTCCTGCCTACAGCCTTCGG - Intronic
1184604511 22:45564481-45564503 GCTCTGCTGCCTCCGGCCCTTGG + Intronic
1184684024 22:46087969-46087991 GGGCCCCTGCGTCCAGCCCTCGG + Intronic
1184684424 22:46089740-46089762 CTGCCCCTGCCTCCTGCCCGAGG + Intronic
1184741168 22:46429867-46429889 CTGGCACTGCCTCCAGCCCTGGG + Intronic
1185359917 22:50399857-50399879 CTGCTGCTGCCTCCAGCCCTGGG - Intronic
1185374188 22:50474667-50474689 CCGACCCAGCCCCCAGCCCTCGG + Intronic
949925737 3:9039642-9039664 CTGTTCCTGCCTCCGGCCCCTGG + Intronic
950590861 3:13935028-13935050 CCGTCTCTGCCTCCGGACCCCGG - Intergenic
951643666 3:24863928-24863950 CCGCCCCTCCCTGAGGCTCTTGG + Intergenic
951898398 3:27632957-27632979 CCGCCGCTGCCTCCGCGCCATGG + Intergenic
952955872 3:38556831-38556853 CAGTGCCTGGCTCCGGCCCTGGG + Intronic
953376773 3:42435473-42435495 ACGCCACTGCCTCCAGCCCCTGG + Intergenic
954117142 3:48473233-48473255 CCTCCCCGGCCCCCGCCCCTTGG - Intronic
954137826 3:48590188-48590210 CAGGCCCTGCCCCCGTCCCTTGG - Intronic
954404442 3:50337627-50337649 CCGCCCTCGCCTCCGGCCAGAGG - Intronic
955261384 3:57394477-57394499 CCTCCACTGCCTCCGTCCCCTGG + Intronic
955611846 3:60765892-60765914 CCTCCCATCCCTCCTGCCCTTGG + Intronic
955996545 3:64685709-64685731 CCCGCCCTGCCTCAGTCCCTAGG + Intronic
956452288 3:69386333-69386355 CCGTCCCTGCCCCGCGCCCTGGG - Intronic
956467667 3:69535641-69535663 CCGCCCCTGCCTCCGGCCCTAGG + Intronic
957193352 3:77039098-77039120 CCTCCCCTTCCTCCTTCCCTTGG + Intronic
957551452 3:81710972-81710994 CCGCCCCTCCGTCCCACCCTGGG - Intronic
961514008 3:127421683-127421705 CTGCTCCTGCCCCCTGCCCTGGG - Intergenic
961573956 3:127819934-127819956 CCTGCCCTGCCTCCAGCCCCTGG - Intronic
963236759 3:142963741-142963763 CCGTCCCTCCCTCCGCGCCTCGG - Intergenic
968054938 3:195684139-195684161 CCTCCCCTGCCACCAGGCCTTGG - Intergenic
968133696 3:196207635-196207657 CCGCCCCTGGCCCCGCCCCCAGG + Intronic
968657782 4:1786056-1786078 CCACCTCTGCCTCCAGCTCTCGG - Intergenic
968690607 4:1987934-1987956 CCGCAGCAGCCCCCGGCCCTTGG + Exonic
968755186 4:2412045-2412067 CTGCCCCTGCCTGCGCCCCAGGG - Intronic
968775106 4:2535916-2535938 CCGCCGCTGCCTCCGCACCCAGG + Intronic
968786133 4:2623576-2623598 CAGCACCTGCCACAGGCCCTTGG + Intronic
968905021 4:3447008-3447030 CTGCCTCGGCCTCCTGCCCTGGG - Intronic
968962852 4:3753913-3753935 CCGCCCCTGCCTTCGTAGCTGGG - Intergenic
968976581 4:3825215-3825237 CTGCTCCTGCCTCCGGGTCTTGG + Intergenic
969462351 4:7335514-7335536 CCGCCTCTTGCTCCGGCCCGAGG + Intronic
969798020 4:9541108-9541130 CTGGCCCTGGCTCCTGCCCTGGG - Intergenic
969836477 4:9846415-9846437 CCTCCCCTGCCTCCCTACCTAGG - Intronic
970218713 4:13785464-13785486 TCTCCCCTGCCTCTGCCCCTGGG - Intergenic
972765621 4:42150950-42150972 CCGCCCCTCCTTCCTGCCCCGGG - Intronic
973817619 4:54632808-54632830 CCGAGCCTCCCTCCGCCCCTTGG + Intergenic
973919731 4:55673106-55673128 CCCTCCCTGCCTCAGGGCCTGGG + Intergenic
982236185 4:153253186-153253208 CCTCTCCTGCCTCCTGCCCCTGG - Intronic
983249286 4:165326892-165326914 CCGCCCCCGCCCCCGCCCCCGGG + Intergenic
984770465 4:183432796-183432818 CCGCCACTACCTCCAACCCTGGG - Intergenic
984803743 4:183735853-183735875 CCCCCCCTCCCCCCGGCCCGGGG + Intergenic
984891595 4:184498804-184498826 GCCCACCTGCCTCAGGCCCTTGG - Intergenic
984979933 4:185270685-185270707 CCTTCCCTCCCTCCAGCCCTTGG + Intronic
985472243 5:53524-53546 CCGCCGATGCCGCTGGCCCTCGG - Intergenic
985504587 5:271743-271765 CCGGCCCTGGGGCCGGCCCTGGG + Exonic
985676117 5:1232169-1232191 CCCCCCCAGCCCCCGACCCTGGG + Intronic
985727489 5:1523794-1523816 CCGCCCCTGCCTCCAGCGCAGGG - Exonic
985734907 5:1573886-1573908 CCTCCCCTGCCACCAGGCCTTGG + Intergenic
985794340 5:1950609-1950631 CCGCCCTGGCCTCCTGCCCGGGG + Intergenic
988497021 5:31754176-31754198 CAGCCTCTGCCTGCAGCCCTTGG + Intronic
989146716 5:38257750-38257772 CCGCCCCGGCCCCCTGCCCCAGG + Intergenic
989401476 5:41012222-41012244 CTGCCCTTGACTCCTGCCCTTGG + Intronic
990910192 5:60844374-60844396 CGGCTCCTCCCTCCGGCCCTCGG - Exonic
991630964 5:68655967-68655989 CCTGCCCTGCCTCCAGCCCAGGG - Intergenic
992291350 5:75283278-75283300 CAGTACCTGCCTCCGGCCTTGGG + Intergenic
992528078 5:77630562-77630584 CTGCCTCTGCCGCCGGCGCTGGG - Exonic
995400533 5:111736012-111736034 CCGCCCCTCCCTCAGACACTTGG - Intronic
997297533 5:132777303-132777325 CCGCCCCTGCCCCCGCCCGCGGG + Exonic
997505287 5:134412037-134412059 CAGCCCGTGGCTCCTGCCCTGGG + Intergenic
998071051 5:139198259-139198281 CCGCCCCTACCTTCGGCCTCCGG + Exonic
998080953 5:139274401-139274423 AAGTCCCTGCCTCTGGCCCTGGG - Intronic
998088862 5:139349529-139349551 GAGCCACTGCCTCCTGCCCTTGG + Intronic
998529004 5:142868217-142868239 CCACCTCTGCCTGCAGCCCTTGG - Intronic
999273144 5:150309712-150309734 CCCCCGCTGCCTCCTGGCCTTGG + Intronic
999297428 5:150468463-150468485 GTGCCCCTGCCTCCTTCCCTTGG - Intergenic
999300110 5:150485871-150485893 CCGCCCCGGCCCCCGCCCCGGGG + Intronic
1000218651 5:159189891-159189913 CCCTCCCTGCCCCCAGCCCTTGG - Intronic
1001342682 5:170862120-170862142 CCGCCGCTGTCCTCGGCCCTCGG - Intronic
1001608830 5:172983717-172983739 GCGCGCCGGCCTCCGCCCCTCGG - Intergenic
1001739144 5:174035475-174035497 CCGCCCTTCTCTCCAGCCCTGGG + Intergenic
1002000015 5:176192166-176192188 CCTCCCCTGCCTCCTGCCCAGGG + Intergenic
1003167474 6:3693382-3693404 CCCCCACTGCCGCCTGCCCTCGG - Intergenic
1003173354 6:3737331-3737353 CCGCCCCTGCGGCCAGCCATGGG - Intronic
1004902969 6:20210929-20210951 CCGCCTCTGCCTGGGTCCCTGGG + Intronic
1005512400 6:26522148-26522170 CCGAGCCTGCCTGCGTCCCTAGG - Intergenic
1005765302 6:29005452-29005474 CCGCCCCTGCCTGCAACCCCAGG + Intergenic
1005882969 6:30074517-30074539 CCGCTCCTGCCTGGGGCCTTGGG + Intronic
1006277262 6:33015339-33015361 CTGCACCAGCCTCCTGCCCTGGG + Intergenic
1006302341 6:33200275-33200297 CCTCCCCTGGCTCCGGCTCCGGG + Exonic
1006379309 6:33688440-33688462 CCGCCCCACCCTCCCGCCCGTGG - Intronic
1006606295 6:35259875-35259897 CCCGCCCGGCCTCCCGCCCTGGG - Intronic
1006860834 6:37170665-37170687 CACCCCCCGCCTCCGGCCCGGGG + Intronic
1007696286 6:43736197-43736219 CAGCAGCTGCCTCCGGCCTTGGG - Intergenic
1007731658 6:43951228-43951250 GAGCCCATGCCTCCTGCCCTGGG - Intergenic
1007760094 6:44128233-44128255 CGGCCGCTGCCCCCGGCTCTGGG + Intronic
1009036043 6:58118004-58118026 CAGCCACTGCCTCTGGCCATGGG - Intergenic
1010229723 6:73523624-73523646 CCGCCCCAGCCTCCCTCCCTAGG - Intronic
1010289171 6:74115573-74115595 CCACCCCTCCCACCAGCCCTTGG - Intergenic
1012351503 6:98256918-98256940 CCTCCCCTGCCTACAGTCCTTGG + Intergenic
1014946510 6:127504908-127504930 CTGCCCCTGCTTCCTGCCCCTGG - Intronic
1015776820 6:136822821-136822843 CCGCCTCCGCCTCCGCCCCCCGG - Intronic
1016051773 6:139537467-139537489 CCCTCCCTGTCTCCTGCCCTGGG + Intergenic
1016448321 6:144155329-144155351 CCGCCCCTGCCGCTGCCCCCAGG - Intronic
1016940867 6:149482031-149482053 CTGCCCCTTACTTCGGCCCTGGG - Intronic
1018331060 6:162727777-162727799 CCGCCCCCGCGCCCGGCCCTAGG + Intronic
1018923471 6:168191342-168191364 CTGCCCCTGCCCCTCGCCCTTGG + Intergenic
1019290165 7:246344-246366 TCCCGCCTGCCTCCGGCCCCTGG + Intronic
1019432289 7:1004698-1004720 CCGCCTCTGCCACCCACCCTGGG + Intronic
1019440595 7:1044462-1044484 CCGCCCTGGCCTCCGCCCCCCGG - Intronic
1019485111 7:1285733-1285755 CTGCCCCTGCGTCCGCCGCTGGG - Intergenic
1020016932 7:4836574-4836596 CCGCTGCAGCCTCCGGGCCTGGG + Exonic
1020139096 7:5603073-5603095 CCGGCCCTGCCTGCGTTCCTGGG + Intronic
1020257667 7:6510932-6510954 CCGCCGCAGCCTCCGGTCCCAGG - Exonic
1021566711 7:22023716-22023738 CCTCCCCTTCCTCCGTGCCTTGG + Intergenic
1022375278 7:29806600-29806622 CCGCCGCCGCCTCCGGCTCCGGG - Exonic
1022536629 7:31102489-31102511 CCCTGCCTGCCTCTGGCCCTAGG - Intronic
1022575170 7:31490262-31490284 CCGTCCCAGGCTCTGGCCCTGGG + Intergenic
1023055831 7:36289334-36289356 GCGCCCCTCCCTGCAGCCCTTGG + Intronic
1023840910 7:44097021-44097043 CCCCTCCTCCCTCCAGCCCTGGG - Intergenic
1023850244 7:44146210-44146232 CTGTCCCAGCCTCCTGCCCTTGG + Intronic
1023969187 7:44978839-44978861 GAGCCACTGCCTCCTGCCCTGGG + Intronic
1026540364 7:71274972-71274994 CAGTCCCTGCCTCTGGCCCTGGG + Intronic
1026819527 7:73537506-73537528 CCTCCCCTGCCTACAACCCTGGG + Intronic
1026836825 7:73645310-73645332 GAGCCACTGCCTCTGGCCCTAGG + Intergenic
1028728923 7:94122370-94122392 CCACCTCTGCCTTCTGCCCTCGG + Intergenic
1029073786 7:97920412-97920434 CCGGCCCTGGCTCCTGCCCCGGG + Intergenic
1029521731 7:101067078-101067100 CCTGCGCTGCCTCCCGCCCTTGG - Intergenic
1029552541 7:101245054-101245076 CCGCCCCTGCCACTGGGCCATGG - Exonic
1029614197 7:101645993-101646015 CCGGCCCTGCTTCCAGCCCAGGG - Intergenic
1029727378 7:102416071-102416093 CCTCACCTTCCTCCGGCCCCCGG + Intronic
1030362594 7:108610623-108610645 CCCCCCCTTCATCCTGCCCTGGG + Intergenic
1032023084 7:128421034-128421056 CCACTCCTGCCTCCAGCCCAGGG + Intergenic
1032174413 7:129611928-129611950 CCGCCCCCGGCTCTGGGCCTGGG + Intronic
1032266528 7:130373848-130373870 CCGTCCTAGCCTCTGGCCCTGGG - Intergenic
1032410451 7:131690324-131690346 TCGCCCCTCCCTGCTGCCCTAGG - Intergenic
1033080602 7:138293634-138293656 CCGCTCCTCACTCCAGCCCTGGG + Intergenic
1033339144 7:140478777-140478799 CCGCCGCTGCCTCCGGCTCCCGG - Intronic
1033372566 7:140724197-140724219 CCGCCCCTGCCCCTGCCCCACGG + Intronic
1034441216 7:151086862-151086884 CCGCCGCCGCCCCCGGCCCCGGG - Exonic
1034825097 7:154255163-154255185 CCGCCTGTGCCTCCACCCCTCGG - Intronic
1035019622 7:155792740-155792762 CCGGCTCTGCCTCTTGCCCTGGG + Intergenic
1035299550 7:157887965-157887987 CGCCCCCTGCCTCCCACCCTTGG + Intronic
1035349864 7:158238304-158238326 CCTCCCCTCCCTCCTGCCCTGGG + Intronic
1035372662 7:158389162-158389184 CCGCACCTGCCTCCTGCCGAGGG - Intronic
1035614064 8:989321-989343 CAGCCCCTCCCTCAGGCCCTGGG - Intergenic
1036179259 8:6568812-6568834 CTGCCCCTGCCTGCAGGCCTTGG + Intronic
1036243915 8:7100848-7100870 CTGGCCCTGGCTCCTGCCCTGGG - Intergenic
1037731320 8:21526117-21526139 CCTCCCCAGCCTCCAGCCCCTGG - Intergenic
1037804801 8:22053336-22053358 GTGCCCCTGCCTCCGGGCATTGG - Intronic
1038800512 8:30744719-30744741 ACGCCACTGCGCCCGGCCCTAGG + Intronic
1039465944 8:37784878-37784900 CCACCCCTGCCCCAGGCCCTGGG - Intronic
1039838947 8:41280030-41280052 CCTGCTCTGACTCCGGCCCTTGG + Intronic
1039970890 8:42320808-42320830 TCCCCCCTGCTTCCGGCCCATGG - Exonic
1045509895 8:102806331-102806353 CCTCCCCCTCCTCCCGCCCTCGG + Intergenic
1045582984 8:103499971-103499993 CCGCCACCGCCGCCGCCCCTTGG - Intergenic
1047211896 8:122847341-122847363 CCCGCCCTGCCTCCTGCCCCAGG + Intronic
1047239636 8:123074072-123074094 GCGCCACTGCATCCGACCCTGGG - Intronic
1047567351 8:126060265-126060287 CCTCCCATGCCTACGACCCTAGG + Intergenic
1048050710 8:130813389-130813411 TCTCCCCTCCCTCCAGCCCTTGG + Intronic
1048766941 8:137854867-137854889 CCCCTCCTCCCTCCTGCCCTCGG + Intergenic
1049302994 8:141881655-141881677 CTGATCCTGCCTCTGGCCCTTGG - Intergenic
1049508995 8:143018466-143018488 CCGCCCCTGCCCCCGCCCCGGGG + Intronic
1049529846 8:143148726-143148748 CAGCCCCTGTCTCCCGCTCTGGG + Intergenic
1049613878 8:143567986-143568008 CCGACCATGCCACCTGCCCTGGG - Intronic
1049663366 8:143830484-143830506 CTACCCCTGCCTCCACCCCTGGG + Intergenic
1050366627 9:4879135-4879157 CCGCCCATGCCTCAGGGCCCTGG - Intronic
1052819199 9:33125561-33125583 GAGCCCCTGCCTTTGGCCCTTGG - Intronic
1053363370 9:37505276-37505298 CCCCATCTGCCTCTGGCCCTGGG + Intergenic
1053786344 9:41655245-41655267 CCGCCCCCGCCTCCCGGCCCCGG - Intergenic
1054781940 9:69174017-69174039 CCGCCGCCGCCTCCCGCCCCCGG + Intronic
1055576945 9:77670081-77670103 CCACCCCTGCCACTGGCCCTGGG + Intergenic
1056154149 9:83817834-83817856 CCGCCCCCGCCCCCGCCCCGAGG - Intronic
1056787857 9:89605550-89605572 CCGCCCCTGTCTCCCAGCCTGGG - Intronic
1057312084 9:93949014-93949036 CCTCCCCTGGCTGCGGCCCCCGG + Intergenic
1057463773 9:95292426-95292448 CCGCCGCCGCCTCGGGCCCGTGG + Intronic
1057499583 9:95585941-95585963 CAGCCTCTGGCTCCTGCCCTGGG + Intergenic
1060543969 9:124449939-124449961 CCGGCTCTGCCTCCGGCCACTGG + Intergenic
1060584513 9:124777581-124777603 GCGCCCCTTCCTCAGGCCCCGGG - Intronic
1060599679 9:124869526-124869548 CCTCCCCTGTCTCCGACCCTTGG + Intronic
1061015804 9:127980411-127980433 CCGCCCCTGCCTCTGCCTCCTGG - Exonic
1061028088 9:128063470-128063492 CGGCCCCCGCCTCTGACCCTGGG - Exonic
1061194571 9:129100756-129100778 CCTCCGCAGCCTCCTGCCCTGGG + Intronic
1061366023 9:130172778-130172800 CCGCCCCCGCCCCCGCCCCCCGG + Intronic
1061370592 9:130195374-130195396 CCGACCCTGCCTTGGCCCCTTGG - Intronic
1061959207 9:133979478-133979500 CCGCTCCTTCCTGCTGCCCTGGG - Intronic
1062230386 9:135479250-135479272 CCGCCCCCGACCCCGGCCCAAGG + Intronic
1062254393 9:135614258-135614280 CCGCTCCTGCTGCTGGCCCTTGG + Intergenic
1062326189 9:136013681-136013703 CAGCCCCTCCCTCCCTCCCTGGG + Intronic
1062338176 9:136081711-136081733 CCCCTCCTGGCTCGGGCCCTGGG + Intronic
1062376437 9:136263938-136263960 CCGCCCCTCCTGCCGGGCCTAGG + Intergenic
1062421083 9:136483103-136483125 CCGCCCCTGGCCCCGCCCCTCGG + Intronic
1062428596 9:136517124-136517146 CCGCCCCCACCCCCTGCCCTCGG - Intronic
1062549450 9:137079208-137079230 CCGCCCCTCCGCCCAGCCCTCGG + Intronic
1062566128 9:137164753-137164775 CGACACCTGCCTCCAGCCCTCGG + Intronic
1062609834 9:137368899-137368921 GCGCCCCTGCCCACAGCCCTGGG - Intronic
1062635105 9:137486606-137486628 CGGCCCCCACCTCCGGCCCCAGG + Intronic
1203787600 EBV:136611-136633 CCGCGCCTTCCTACGGTCCTGGG + Intergenic
1186480838 X:9895234-9895256 CAGCCCCTGGCTCCTGCCCAAGG - Exonic
1186670018 X:11758408-11758430 CCGCCCCCGCCCCCGGTCCCGGG - Intronic
1187173123 X:16870531-16870553 CCGCCTCCGCGGCCGGCCCTGGG - Intergenic
1187648357 X:21374296-21374318 GCGCGCCTGCCGTCGGCCCTGGG + Intergenic
1187648420 X:21374562-21374584 CCGCTCCGGTCTCCGTCCCTAGG - Intronic
1189001953 X:36957541-36957563 CCGCGCGAGCCTCGGGCCCTGGG + Intergenic
1189069244 X:37847119-37847141 CCGCTGCTGCCTCCGTCCCTTGG - Intronic
1189383799 X:40520568-40520590 CATCCCCTGCCTTCTGCCCTTGG - Intergenic
1189658901 X:43277605-43277627 CTGCCCCCTTCTCCGGCCCTGGG - Intergenic
1192260975 X:69505653-69505675 CCGCCCCCGCCGCCGGCTCTCGG + Exonic
1194236037 X:91384016-91384038 CAGCCCCTACCTCCAGCACTGGG - Intergenic
1195473693 X:105260807-105260829 TTCCCCCTGCCCCCGGCCCTGGG + Intronic
1197708821 X:129652256-129652278 CCTCCACTGCCTCCTGACCTGGG - Intronic
1197749884 X:129957230-129957252 CGGCCCCCGCCCCCGCCCCTCGG + Intergenic
1198088690 X:133305958-133305980 CCGCCTCCGCCTCCCGCCTTGGG - Intronic
1199615582 X:149652503-149652525 CCACCCCTGCTGCCAGCCCTGGG - Intergenic
1199622571 X:149713439-149713461 CTGCCCCTGCCATCGGTCCTTGG + Intronic
1199872685 X:151913036-151913058 CCACCCCTGCTGCCAGCCCTGGG + Intronic
1200250873 X:154553039-154553061 CCGCCCCTCCCTGCAGCTCTGGG - Intronic
1200259089 X:154602442-154602464 CCGCCACTGGCTCCTGCCCCAGG - Intergenic
1200304210 X:155008321-155008343 CCGCCCCTCCCTGCAGCTCTGGG + Intronic