ID: 956468548

View in Genome Browser
Species Human (GRCh38)
Location 3:69542224-69542246
Sequence CTACAGCCCCGGAGCGCCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 79}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956468548_956468553 14 Left 956468548 3:69542224-69542246 CCTGCGGCGCTCCGGGGCTGTAG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 956468553 3:69542261-69542283 GTCTCGGCTGCGCACCGCGCGGG 0: 1
1: 0
2: 2
3: 5
4: 73
956468548_956468555 21 Left 956468548 3:69542224-69542246 CCTGCGGCGCTCCGGGGCTGTAG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 956468555 3:69542268-69542290 CTGCGCACCGCGCGGGACCTGGG 0: 1
1: 0
2: 1
3: 5
4: 46
956468548_956468554 20 Left 956468548 3:69542224-69542246 CCTGCGGCGCTCCGGGGCTGTAG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 956468554 3:69542267-69542289 GCTGCGCACCGCGCGGGACCTGG 0: 1
1: 0
2: 1
3: 8
4: 89
956468548_956468552 13 Left 956468548 3:69542224-69542246 CCTGCGGCGCTCCGGGGCTGTAG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 956468552 3:69542260-69542282 TGTCTCGGCTGCGCACCGCGCGG 0: 1
1: 0
2: 0
3: 4
4: 32
956468548_956468556 22 Left 956468548 3:69542224-69542246 CCTGCGGCGCTCCGGGGCTGTAG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 956468556 3:69542269-69542291 TGCGCACCGCGCGGGACCTGGGG 0: 1
1: 0
2: 1
3: 3
4: 68
956468548_956468558 28 Left 956468548 3:69542224-69542246 CCTGCGGCGCTCCGGGGCTGTAG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 956468558 3:69542275-69542297 CCGCGCGGGACCTGGGGACCCGG 0: 1
1: 1
2: 2
3: 12
4: 187
956468548_956468551 -2 Left 956468548 3:69542224-69542246 CCTGCGGCGCTCCGGGGCTGTAG 0: 1
1: 0
2: 0
3: 9
4: 79
Right 956468551 3:69542245-69542267 AGACGGCTACTTTATTGTCTCGG 0: 1
1: 0
2: 0
3: 4
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956468548 Original CRISPR CTACAGCCCCGGAGCGCCGC AGG (reversed) Intronic
901067728 1:6502377-6502399 CTACAGCCCAGAACCACCGCTGG + Intronic
901206790 1:7502142-7502164 CGACAGCCCCGGAAGGCAGCTGG + Intronic
902969539 1:20037342-20037364 CCACAGCCCAGGAGCTCTGCTGG - Intronic
903950521 1:26993754-26993776 CTACAGCCGCAGACCGCCGGTGG + Exonic
905449594 1:38047691-38047713 CTGGAACCCCGGAGCGCGGCCGG - Intergenic
906578813 1:46917444-46917466 CTAGAGCCTCGTAGCTCCGCTGG - Intergenic
907012555 1:50977637-50977659 CTACGGGCCCGGGGCGCCTCGGG + Intergenic
907414069 1:54302024-54302046 CTACAGCTCCAGAGGGCGGCTGG + Intronic
908473931 1:64470557-64470579 CTACAGCGCGGGAGCGCGGGCGG - Intergenic
916792551 1:168136821-168136843 CTCCAGTCCCGGAGCGCGGCGGG - Intronic
920010194 1:202861552-202861574 ATAAATCCCCGGAGAGCCGCCGG + Intergenic
923369397 1:233295480-233295502 CACCAGCCCCGGGGCGCAGCCGG - Exonic
1065214896 10:23439563-23439585 CTGCAGCCCCCGGGAGCCGCCGG + Exonic
1072701017 10:97641217-97641239 CAACTCCCCAGGAGCGCCGCCGG - Intronic
1072731600 10:97850278-97850300 CGACAGCCTCCGAGCGCCCCCGG + Exonic
1074618696 10:115094215-115094237 CTCCAGCCCCGGGGCGCCCCGGG + Intronic
1075185092 10:120248706-120248728 CTTCAGAGCCGGAGCGCCACAGG - Intergenic
1075715227 10:124551683-124551705 CTGCAGCCCCTGAGACCCGCGGG + Intronic
1075999420 10:126903833-126903855 CTACAGCGCCTGAGCCCCGGAGG + Intergenic
1076658194 10:132037866-132037888 CTACAGCCCCAGAGCAGCCCTGG - Intergenic
1078371631 11:10751284-10751306 CTGCCGCCCCGCGGCGCCGCTGG - Exonic
1078527225 11:12110446-12110468 CTACAGCCCACGTGCGCCGGCGG + Intronic
1081547784 11:44083838-44083860 CTGCAGCCCCAGAACGCCCCAGG - Exonic
1083958445 11:66000241-66000263 CTGCAGCCCTGGAGGGCCCCTGG - Intronic
1084072327 11:66744610-66744632 CTAGAGCCTCTGAGCGCCGCGGG - Intronic
1085085100 11:73661506-73661528 CTACAGCGCCGGCGCCCCTCTGG + Exonic
1100505588 12:95217416-95217438 CTCGCGCCCGGGAGCGCCGCAGG - Exonic
1103320005 12:120086970-120086992 CTACAGCCGCGGCGCAGCGCCGG - Intronic
1103991609 12:124803160-124803182 ATCCAGCCCCGGAGCTCAGCTGG - Intronic
1107447503 13:40481809-40481831 CCACAGCCCCAGAGCACGGCAGG - Intergenic
1113389836 13:109884881-109884903 CTACAGCCCTGGGGGGCCGTGGG - Intergenic
1114485182 14:23057700-23057722 CCGCAGCCCAGGAGCGCCGAGGG - Intergenic
1117547826 14:56807993-56808015 CCGCAGCCCCGCAGCCCCGCAGG + Intronic
1126347975 15:47717025-47717047 CTGCAGCCCAGGAGAGCTGCGGG - Intronic
1126649826 15:50909033-50909055 CAGCAGCCCCTGAGCCCCGCCGG - Intronic
1138228853 16:55323696-55323718 CTGCAGCCCCTGCGCTCCGCTGG - Intergenic
1138385904 16:56635566-56635588 CTCCACTCCCGGCGCGCCGCGGG - Intergenic
1141513441 16:84527136-84527158 CCACAGCCTCGGAGAGCCCCGGG + Intronic
1143524405 17:7463673-7463695 CTACAGCCAGGGAGCCCCGGAGG - Exonic
1148437627 17:47695499-47695521 CCACAGCCCCGGTGCGCCCGGGG + Exonic
1152545468 17:80998112-80998134 TTACAGCCCCTCAGCGCCCCAGG + Intronic
1157676066 18:49569478-49569500 CTACAGCCTCGGAGCGCACGTGG + Exonic
1159260412 18:66005911-66005933 CTGCAGCCCCGGTGCGGTGCGGG - Intergenic
1160976292 19:1794344-1794366 CTAGAGCCCAGGAGCTCAGCAGG - Intronic
1162021079 19:7868925-7868947 CCACTGCCCTGGAGCCCCGCTGG - Exonic
1163715213 19:18869227-18869249 CGGCAGCCCCGGAGGGCGGCTGG - Exonic
1167347306 19:48954790-48954812 CCGCTGCCCCGCAGCGCCGCCGG - Intergenic
1168074067 19:53969633-53969655 CTACACCCCTGGAGCCCCGATGG - Intronic
925984988 2:9207656-9207678 CCGCAGCCCCCGAGCGCCGCAGG + Intronic
935997138 2:108786753-108786775 CTGCGGCCGCGTAGCGCCGCGGG + Exonic
948587784 2:239030147-239030169 AGACAGCCCTGGAGCGACGCTGG - Intergenic
1169116857 20:3071795-3071817 CTCCCTCCCCGGAGCGCCGCGGG - Intronic
1170572944 20:17642627-17642649 CCCCAGCCCAGGAGCGCCCCTGG - Intronic
1172528543 20:35615913-35615935 CTTCAGCCGCTGCGCGCCGCGGG - Exonic
1172794609 20:37528110-37528132 GGACAGCCCCGAAGCGCGGCCGG + Intergenic
1176426354 21:6550964-6550986 CTCCAGCCTCGGAGGGCCTCGGG + Intergenic
1179701845 21:43159281-43159303 CTCCAGCCTCGGAGGGCCTCGGG + Exonic
1183316529 22:37140036-37140058 CTACAGCCCGGCAGCCCTGCGGG + Intronic
1185362332 22:50415773-50415795 CTATAGCTCAGGAGCCCCGCTGG - Intronic
956468548 3:69542224-69542246 CTACAGCCCCGGAGCGCCGCAGG - Intronic
960582747 3:119294689-119294711 CGGCGGCCCCGGAGCGGCGCGGG + Exonic
961013213 3:123449186-123449208 CAACAGCTCCGGAGCCCCGGGGG + Exonic
962259973 3:133895913-133895935 CCCCAGCCCCGCAGCCCCGCGGG - Intergenic
963607163 3:147421291-147421313 CCAGAGCCCGGGAGCGCCGGAGG + Intronic
978741790 4:112145544-112145566 CTACCGCCCCGGACAGCCGCCGG - Exonic
1002600612 5:180352498-180352520 GGACAGCGCGGGAGCGCCGCGGG + Intronic
1013230580 6:108158044-108158066 CTGCAGTCCCGAAGCCCCGCGGG + Intronic
1016272044 6:142301439-142301461 CAACAGCCCGGGAGCGTGGCGGG + Intergenic
1018774212 6:166998863-166998885 CTGCAGCCCCGGGGGGGCGCCGG - Intergenic
1019326191 7:439480-439502 CTCCAGCCCCCGAGAGCCCCTGG + Intergenic
1019608396 7:1922108-1922130 CTACAGACCTGGAGAGCCACAGG + Intronic
1019666898 7:2256529-2256551 CTAGCGCTTCGGAGCGCCGCAGG - Intronic
1022723022 7:32957571-32957593 CTCCAGCCCCGGAACGCCATCGG - Exonic
1026676878 7:72435540-72435562 TTGCAGCCCCGGAGAGCCTCAGG + Intronic
1026775781 7:73230264-73230286 CTACAGCCTCGGAGGGCAGGGGG - Intergenic
1027016638 7:74783636-74783658 CTACAGCCTCGGAGGGCAGGGGG - Intronic
1027071390 7:75162300-75162322 CTACAGCCTCGGAGGGCAGGGGG + Intergenic
1043873825 8:85463784-85463806 CCGGAGCCCCGGAGCCCCGCCGG + Intergenic
1048860996 8:138724465-138724487 CTGCAGCCCCGGAGCTCAGCTGG - Intronic
1049018163 8:139936174-139936196 CCAGAGCCCAGGAGCGCCACAGG + Intronic
1049278225 8:141730576-141730598 CTGCAGCCAGGGAGCGCGGCTGG + Intergenic
1049613664 8:143567273-143567295 TTCCAGCGCCGGAGCGTCGCGGG - Exonic
1049657511 8:143805261-143805283 TTACAGCCCCCGAGAGCGGCGGG - Exonic
1049762041 8:144336174-144336196 CCACAGCGCCGGAGCCCCGCAGG - Exonic
1058754516 9:108072156-108072178 CTACAGCCTAGGAGAGCCACAGG - Intergenic
1060939735 9:127536394-127536416 CTGCAGCCCCAGAGCTCAGCAGG - Intronic
1061725541 9:132580343-132580365 CTGCCGGCCCGGACCGCCGCGGG + Intergenic
1062656270 9:137605768-137605790 CTACAGCCCCGGGGAGCCGTTGG + Exonic
1187419636 X:19122787-19122809 CTGGAGCCCAGGAGCGCTGCGGG - Intergenic