ID: 956484539

View in Genome Browser
Species Human (GRCh38)
Location 3:69708391-69708413
Sequence GGTACCTCAATAATATATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956484538_956484539 -4 Left 956484538 3:69708372-69708394 CCTCATAGTAGATGTAGTTGGTA No data
Right 956484539 3:69708391-69708413 GGTACCTCAATAATATATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956484539 Original CRISPR GGTACCTCAATAATATATCT TGG Intergenic
No off target data available for this crispr