ID: 956485646

View in Genome Browser
Species Human (GRCh38)
Location 3:69719359-69719381
Sequence GAACAGACTTAGAAGTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956485645_956485646 -5 Left 956485645 3:69719341-69719363 CCATAGTCAAATTCAAGAGAACA No data
Right 956485646 3:69719359-69719381 GAACAGACTTAGAAGTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956485646 Original CRISPR GAACAGACTTAGAAGTATAA AGG Intergenic
No off target data available for this crispr