ID: 956486522

View in Genome Browser
Species Human (GRCh38)
Location 3:69728701-69728723
Sequence CTCAAATAGAAATCAGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956486522_956486524 -7 Left 956486522 3:69728701-69728723 CCCTCTTCTGATTTCTATTTGAG No data
Right 956486524 3:69728717-69728739 ATTTGAGAGAGAGTGAAGCCCGG No data
956486522_956486530 28 Left 956486522 3:69728701-69728723 CCCTCTTCTGATTTCTATTTGAG No data
Right 956486530 3:69728752-69728774 ACCATATGTAAGGACTACTGAGG No data
956486522_956486525 4 Left 956486522 3:69728701-69728723 CCCTCTTCTGATTTCTATTTGAG No data
Right 956486525 3:69728728-69728750 AGTGAAGCCCGGTGACTATTTGG No data
956486522_956486529 18 Left 956486522 3:69728701-69728723 CCCTCTTCTGATTTCTATTTGAG No data
Right 956486529 3:69728742-69728764 ACTATTTGGGACCATATGTAAGG No data
956486522_956486526 5 Left 956486522 3:69728701-69728723 CCCTCTTCTGATTTCTATTTGAG No data
Right 956486526 3:69728729-69728751 GTGAAGCCCGGTGACTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956486522 Original CRISPR CTCAAATAGAAATCAGAAGA GGG (reversed) Intergenic
No off target data available for this crispr