ID: 956487575

View in Genome Browser
Species Human (GRCh38)
Location 3:69739330-69739352
Sequence TTTCGTGGGAGCGGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 61}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956487563_956487575 11 Left 956487563 3:69739296-69739318 CCTCTCCCCCGCCTGGCCTTCTG 0: 1
1: 0
2: 7
3: 70
4: 645
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
956487569_956487575 3 Left 956487569 3:69739304-69739326 CCGCCTGGCCTTCTGGGAGCTGT 0: 1
1: 0
2: 5
3: 34
4: 346
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
956487561_956487575 19 Left 956487561 3:69739288-69739310 CCACGTTGCCTCTCCCCCGCCTG 0: 1
1: 0
2: 1
3: 13
4: 239
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
956487566_956487575 6 Left 956487566 3:69739301-69739323 CCCCCGCCTGGCCTTCTGGGAGC 0: 1
1: 0
2: 1
3: 20
4: 273
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
956487568_956487575 4 Left 956487568 3:69739303-69739325 CCCGCCTGGCCTTCTGGGAGCTG 0: 1
1: 0
2: 3
3: 54
4: 537
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
956487571_956487575 -5 Left 956487571 3:69739312-69739334 CCTTCTGGGAGCTGTAGTTTTCG 0: 1
1: 0
2: 3
3: 24
4: 140
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
956487560_956487575 22 Left 956487560 3:69739285-69739307 CCACCACGTTGCCTCTCCCCCGC 0: 1
1: 0
2: 1
3: 20
4: 225
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
956487570_956487575 0 Left 956487570 3:69739307-69739329 CCTGGCCTTCTGGGAGCTGTAGT 0: 1
1: 1
2: 1
3: 37
4: 231
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
956487567_956487575 5 Left 956487567 3:69739302-69739324 CCCCGCCTGGCCTTCTGGGAGCT 0: 1
1: 0
2: 8
3: 66
4: 511
Right 956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956487575 Original CRISPR TTTCGTGGGAGCGGCTCCCC AGG Intergenic
900549314 1:3246232-3246254 ATTCTTGAGAGCGGCTCCCGGGG + Intronic
916850173 1:168695604-168695626 TTTGGTGGGAAAGGCTGCCCTGG - Exonic
920183945 1:204149122-204149144 TTTACTGGGAGGGGCTCCCCAGG + Intronic
923093373 1:230755923-230755945 TTGCTGGGGAGCGGCTCCCCAGG - Intronic
1083993008 11:66258132-66258154 TCTAGTGGGAGCGCCTCCGCAGG + Intronic
1084128727 11:67118316-67118338 TGTCCTGGGCTCGGCTCCCCGGG - Intergenic
1096978943 12:55717390-55717412 TTTCCTGCCAGCTGCTCCCCAGG - Intronic
1098071555 12:66681293-66681315 TGACCTGGGAGTGGCTCCCCAGG - Intronic
1102715758 12:114970956-114970978 TCTCATGTGAGAGGCTCCCCTGG + Intergenic
1104351684 12:128049529-128049551 TATCATGGGAGCTGCTCGCCTGG + Intergenic
1104674170 12:130701508-130701530 TTTCCTGTGCCCGGCTCCCCTGG - Intronic
1104923318 12:132302662-132302684 CTGCGTGGAAGCGGCTGCCCTGG - Intronic
1105797712 13:23872688-23872710 TTCCCTGGGAGCTGCTCCCGGGG + Intronic
1108437827 13:50417892-50417914 TACTCTGGGAGCGGCTCCCCTGG + Intronic
1108753093 13:53468725-53468747 TTACCTGGGACCAGCTCCCCAGG - Intergenic
1113495272 13:110723148-110723170 GTTCCTGGGACAGGCTCCCCAGG + Intronic
1122789053 14:104176750-104176772 CTCCGTGGGAGCATCTCCCCAGG - Exonic
1122888966 14:104723989-104724011 ATTCGTGGGGGCGGCTCCCCAGG + Intergenic
1202890829 14_KI270722v1_random:155744-155766 ATTCTTGGGAGAGGCTGCCCTGG + Intergenic
1130613468 15:85381269-85381291 GCGCGAGGGAGCGGCTCCCCGGG + Intronic
1132594371 16:741455-741477 GGCCCTGGGAGCGGCTCCCCAGG - Intronic
1135504234 16:23022329-23022351 TGACGTGGGAGTAGCTCCCCTGG - Intergenic
1146475936 17:33162807-33162829 CTTCCTGGTAGCAGCTCCCCTGG + Intronic
1150488936 17:65561407-65561429 TTTCTTTGAAGCGGCTCCGCTGG + Intronic
1151939072 17:77281506-77281528 TTTCCTGGGAGCGGCGGCCACGG + Exonic
1161203596 19:3029085-3029107 GGTCGTGGGAGCCCCTCCCCGGG + Exonic
1161957796 19:7506205-7506227 TTTCGGGGGTGGGGCTTCCCGGG - Intronic
1168132337 19:54329600-54329622 TTTCCTTGGAGTGGCTCCCATGG - Intergenic
1202666248 1_KI270708v1_random:122581-122603 ATTCTTGGGAGAGGCTGCCCTGG + Intergenic
925456237 2:4018779-4018801 TGTGGTGGGAGGGGCTGCCCTGG + Intergenic
929532897 2:42763546-42763568 TTCCGTGGGGGCAGCTGCCCGGG - Exonic
931678170 2:64718660-64718682 GTTCCTGGGATCTGCTCCCCTGG + Intronic
932265835 2:70366298-70366320 TTTTGTGAGAGCTACTCCCCTGG + Intergenic
934941923 2:98508993-98509015 TTTCCAGGCAGCGGCACCCCTGG - Intronic
936512338 2:113157986-113158008 CTTGGTGGGAGCTGCCCCCCCGG + Intronic
944933747 2:204545875-204545897 GTTCCGGGGAGCGGCGCCCCGGG + Intronic
1169082193 20:2804534-2804556 ATTCGTGGCTGCGGCTCCCGGGG + Intergenic
1170571202 20:17633859-17633881 GTTTCTGGGAGGGGCTCCCCTGG - Intronic
1170970793 20:21114706-21114728 TTTCATGGTGGCGGCTCCACGGG - Intergenic
1183075933 22:35426707-35426729 CTTCCTGGGAGCACCTCCCCGGG - Intergenic
1183201273 22:36387350-36387372 TTCCACGGGAGCGGCTGCCCCGG + Intronic
1183382658 22:37498199-37498221 TTTCCTGGGAGCTGCTTCCCAGG - Intronic
1184109201 22:42385096-42385118 TTTGGTGGCAGGGGCTGCCCCGG + Exonic
1184662742 22:45972766-45972788 GCACGTGGGGGCGGCTCCCCGGG + Intronic
950032895 3:9863659-9863681 TTTAGTGGGGGCCGCTCCCTGGG - Intergenic
950305391 3:11912407-11912429 TTTAGTGGGGGCTGCTCCCTGGG - Intergenic
956487575 3:69739330-69739352 TTTCGTGGGAGCGGCTCCCCAGG + Intergenic
957089630 3:75716793-75716815 ATTCTTGGGAGAGGCTGCCCTGG - Intronic
961713724 3:128845419-128845441 TTTAGTGGGGGCCGCTCCCTGGG + Intergenic
964201259 3:154121526-154121548 TTGCGTGGGAGCCGCGCACCTGG + Intronic
968036819 3:195554593-195554615 CTTCATGGCAGCGGCTCCACGGG - Intergenic
968079634 3:195836989-195837011 TTTCCTGGGAGCAGCCTCCCAGG + Intergenic
984838052 4:184040532-184040554 ATGGGTGGGAGCGACTCCCCAGG - Intergenic
1007689151 6:43687537-43687559 TTTGGAGGTACCGGCTCCCCAGG - Intronic
1016919971 6:149283111-149283133 TTTAGTGCGGGAGGCTCCCCGGG + Intronic
1017871567 6:158491108-158491130 TTACGTGGGTGCGGCTACCCTGG - Intronic
1018450367 6:163901667-163901689 TTACGTGGGTGCGGTTCTCCAGG + Intergenic
1030304014 7:108002025-108002047 TGTTGGGGGAGCTGCTCCCCGGG - Intronic
1040482642 8:47840896-47840918 TTTGGTGGGAGAGGCCCTCCTGG - Intronic
1051591090 9:18777277-18777299 GGTCGTCGTAGCGGCTCCCCGGG - Exonic
1056964089 9:91151872-91151894 TTTCGTGGGTGTTGCTGCCCAGG + Intergenic
1062316568 9:135970238-135970260 TTCCCTGGGAGCAGCTTCCCAGG + Intergenic
1062440633 9:136567758-136567780 ATGCGTGGGAGGGGCTCCCTCGG + Intergenic
1203487934 Un_GL000224v1:74945-74967 ATTCTTGGGAGAGGCTGCCCTGG + Intergenic
1203500555 Un_KI270741v1:16838-16860 ATTCTTGGGAGAGGCTGCCCTGG + Intergenic
1191065629 X:56343889-56343911 TTTCGGGGTGGGGGCTCCCCTGG + Intergenic
1192138841 X:68630724-68630746 TTTCTTGGGAGCTGCAGCCCTGG - Intergenic