ID: 956488464

View in Genome Browser
Species Human (GRCh38)
Location 3:69746346-69746368
Sequence CAGTGTAAAAAAATGTATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 429
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 395}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956488460_956488464 25 Left 956488460 3:69746298-69746320 CCTTTTTTTAGAACAGATCACAT 0: 1
1: 0
2: 3
3: 31
4: 357
Right 956488464 3:69746346-69746368 CAGTGTAAAAAAATGTATCTTGG 0: 1
1: 0
2: 1
3: 32
4: 395

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956488464 Original CRISPR CAGTGTAAAAAAATGTATCT TGG Intronic
900935364 1:5762816-5762838 AAGTGTAACAAAATGTGTATAGG - Intergenic
905224524 1:36470485-36470507 CAGTGAATTAAAATGTATCAAGG - Intronic
906843368 1:49163841-49163863 CACAATAAAAAAATGAATCTTGG + Intronic
908002284 1:59692098-59692120 AAGTACAAATAAATGTATCTTGG + Intronic
908403396 1:63791358-63791380 CACTGGAAAAAAATATGTCTGGG + Intronic
909473944 1:76061439-76061461 CACTTTAAAAAAACTTATCTGGG - Intergenic
911371597 1:97001379-97001401 CAGTTTAAAAAATTGAATATTGG + Intergenic
911507953 1:98777134-98777156 CAGTGAAGAAAACTGTATCAAGG + Intergenic
911761492 1:101622361-101622383 CTGTGAAAAATAATGTATCAAGG + Intergenic
917021502 1:170593424-170593446 CAGTGTAATAAAATGCATTCAGG - Intergenic
917746731 1:178016779-178016801 CAATGAAAAAAACAGTATCTAGG - Intergenic
918824489 1:189305592-189305614 CAGTATAAAGAAGTGTATTTAGG + Intergenic
919637862 1:200020848-200020870 TAATAAAAAAAAATGTATCTGGG - Intergenic
920594284 1:207253192-207253214 CAGTCTTAAAAAATGTTGCTGGG - Intergenic
921453461 1:215337998-215338020 TAAAGTATAAAAATGTATCTAGG - Intergenic
921496355 1:215846805-215846827 CAAGTTAAAAAAATGTCTCTAGG - Intronic
921760209 1:218904618-218904640 CAGGGTGAAAAAATGTTGCTAGG + Intergenic
922312805 1:224411864-224411886 AAGTAAAAAAAAATGTAGCTGGG - Intronic
924183868 1:241466397-241466419 CACTGTAAGAAGAGGTATCTGGG + Intergenic
1063095503 10:2905183-2905205 CAGGGATAAAAAATGTCTCTGGG + Intergenic
1063219276 10:3951019-3951041 CCCTTTAAAAAAATGTCTCTGGG + Intergenic
1063357074 10:5411274-5411296 CAATGTATTAAAATGTCTCTAGG - Intergenic
1063990851 10:11560981-11561003 AAGCTTAAAAAAATGTATATGGG + Intronic
1064164694 10:12975927-12975949 CAGTGTAGAAGAGTGTGTCTTGG - Intronic
1065486199 10:26238669-26238691 CAGTCTCTAAAAATGTGTCTGGG + Intronic
1066178784 10:32939307-32939329 CAGTGTAGACAACTGTTTCTAGG - Intronic
1066552565 10:36575791-36575813 CATTTTAAAAAAATGGATGTGGG + Intergenic
1067413892 10:46089438-46089460 CAGATTAAAAAAATATATATAGG - Intergenic
1068056267 10:52015518-52015540 CAATGGAAAAAAATGTCTCCAGG - Intronic
1068321167 10:55418521-55418543 GAGTGTAAGAAAATGTATGCTGG + Intronic
1068438819 10:57024389-57024411 CAGTGTTAAAAAATGTAATTTGG + Intergenic
1069216141 10:65823745-65823767 CAGTTTAAGCAAATGTCTCTGGG + Intergenic
1070020448 10:72580229-72580251 CAATGTAAAATAATATGTCTAGG + Intronic
1070958799 10:80484252-80484274 AAGTGTAAAATAGTATATCTGGG + Intronic
1071584575 10:86807151-86807173 CACTTTCAACAAATGTATCTAGG + Intronic
1071855096 10:89616292-89616314 CAATGTATAGAAATTTATCTAGG - Intronic
1073419951 10:103416715-103416737 CAGTGTAAAAAACTCTCTCCGGG - Exonic
1073526370 10:104186255-104186277 CATTGTAAATAAATGGATATAGG + Intronic
1074219140 10:111419124-111419146 GATGGTAAAAAAATCTATCTGGG + Intergenic
1075493970 10:122902162-122902184 CAGTGAAAAAAAAGGTATTCGGG + Intergenic
1076224159 10:128759995-128760017 CAGACAATAAAAATGTATCTGGG - Intergenic
1079179043 11:18172378-18172400 CTGTGTACAAAAATGCTTCTAGG + Intronic
1079269808 11:18973562-18973584 CTGTGTACAAAAATGCTTCTAGG - Intergenic
1079607032 11:22382800-22382822 CCGAGTCAAAAAGTGTATCTTGG - Intergenic
1080551131 11:33375129-33375151 CAGTGTAAAAGAATGAAACGTGG - Intergenic
1081058451 11:38441035-38441057 CAGTGAAAAAAAATGTGTTCAGG - Intergenic
1081224794 11:40507371-40507393 CCATTTAAAAAAATATATCTAGG - Intronic
1081416509 11:42822036-42822058 CAGTGTACATAAAAGTAACTTGG + Intergenic
1082166659 11:48956944-48956966 ATGTGTAAAACAATGTATTTTGG - Intergenic
1084194131 11:67514311-67514333 AAATGTAAAAAAATTCATCTTGG + Intergenic
1084831592 11:71773995-71774017 AAATGCAAAAAAATGTAGCTGGG + Intergenic
1085163270 11:74369278-74369300 CAGTGTACAAAAATGGATAATGG + Intronic
1085899201 11:80677587-80677609 CAGACTAAAAAAATGTATTAAGG - Intergenic
1085965038 11:81513192-81513214 CAGTGTCCTAAAATGTATCTGGG - Intergenic
1086539272 11:87888313-87888335 ATGTGGAAAAAAATGTGTCTTGG + Intergenic
1086794505 11:91083808-91083830 CAATGGAAAAAAATGTCTCCAGG + Intergenic
1087489014 11:98799474-98799496 GAGTGGAAAAAAATGTATACAGG + Intergenic
1087586927 11:100133575-100133597 CAGGGTTAAAATATCTATCTGGG - Intronic
1087591604 11:100196120-100196142 CAGAGTAAAAAAATGAAAATGGG + Intronic
1088192999 11:107246729-107246751 GAATGTACAACAATGTATCTTGG - Intergenic
1088359516 11:108976117-108976139 ATGTGTAAAAAAAATTATCTTGG + Intergenic
1089081022 11:115776318-115776340 CGGTTGAATAAAATGTATCTTGG + Intergenic
1090026602 11:123172784-123172806 CAATGTAAAAAAATGTTTATTGG - Intronic
1090564098 11:127967759-127967781 CATTTTTAAAAAATGTATCATGG - Intergenic
1090873174 11:130766039-130766061 CAGTGTGCAGAAATGTCTCTAGG + Intergenic
1090953364 11:131493753-131493775 CAGTGTAGCAAAAAGTTTCTGGG - Intronic
1093284366 12:17240092-17240114 CAGTCTAAGAAAATGAAACTTGG - Intergenic
1093897859 12:24595084-24595106 GAGTGGAAAAAAATCTCTCTAGG + Intergenic
1094454057 12:30612911-30612933 GATTTTAAAAAAATGTATCAGGG - Intergenic
1095236053 12:39796998-39797020 CAGTGTAAAAGAGTGTTTTTTGG + Intronic
1095840616 12:46687764-46687786 CTTTTTAAAAAAATGTACCTAGG + Intergenic
1096003470 12:48149054-48149076 CAGTGTAACTAAATTTCTCTAGG - Exonic
1096442459 12:51655531-51655553 AAAAGTAAAAAAATTTATCTGGG - Intronic
1097088036 12:56483477-56483499 CAGTGTAAAAAAAAGAAATTGGG + Intronic
1098437870 12:70487127-70487149 CAGTGTAGAAAGTTGTATTTTGG - Intergenic
1099458898 12:82898838-82898860 CAGTGTAATAAAATTTGGCTGGG - Intronic
1100536776 12:95518991-95519013 CAGTGGAAAAAAATGTGTTCAGG - Intronic
1100674260 12:96848980-96849002 CAGTGAAAGCAAATATATCTAGG + Intronic
1100956300 12:99912651-99912673 CAGTGTTAAAAAAATTAACTGGG - Intronic
1101861620 12:108486811-108486833 CAGTGTACAAAAATGTCTCAAGG + Intergenic
1103266886 12:119638300-119638322 AAATTTAAAAAAATATATCTGGG + Intronic
1105204814 13:18212253-18212275 CATTTAAAAAATATGTATCTTGG + Intergenic
1105204910 13:18213501-18213523 CATTTAAAAAATATGTATCTTGG + Intergenic
1105449252 13:20484166-20484188 CAGTGTAGAAAAATCAATCTAGG - Intronic
1105657029 13:22452934-22452956 CAATGTAATAAAGTGTATATTGG + Intergenic
1106154947 13:27145790-27145812 CAATGAAAAGAAATGTGTCTTGG + Intronic
1106692873 13:32137369-32137391 CAGTCTAGAAGAATGTCTCTGGG + Intronic
1107751124 13:43568505-43568527 CAGTTTATCAAAATGTTTCTTGG - Intronic
1109092025 13:58059881-58059903 TAGTGTAATGAAATGTAACTTGG + Intergenic
1109460328 13:62647605-62647627 TAGTGTAAGAAAATGCATATGGG + Intergenic
1109916638 13:68996009-68996031 CATTGTAAAAAAATGTTCTTAGG - Intergenic
1110340335 13:74383155-74383177 CAGTGTAATAAAAGCCATCTAGG - Intergenic
1110373998 13:74771388-74771410 CAGTGTAATAAAATGAATTCAGG - Intergenic
1110951362 13:81496208-81496230 CAGTGGAAAACAATGAATTTGGG - Intergenic
1111311884 13:86500335-86500357 ACGTGTATGAAAATGTATCTTGG + Intergenic
1111825508 13:93262722-93262744 CAGTGGAATAAAATGCAACTTGG - Intronic
1111892536 13:94102142-94102164 CAGGGAATAAAAATTTATCTTGG + Intronic
1112388308 13:98960414-98960436 TAGTGTATAAAAATCTAACTTGG + Intronic
1113065161 13:106365965-106365987 CAATATAAAAAAATATATATTGG - Intergenic
1113097478 13:106680931-106680953 CAGGGAAAAAAAATGTCACTGGG + Intergenic
1113576231 13:111397019-111397041 AAGTGTGAAAATTTGTATCTAGG - Intergenic
1114548575 14:23520520-23520542 CAGTGTCACCAAAAGTATCTTGG - Intergenic
1115592535 14:34878170-34878192 CAATGTAAATAAATGTATCCTGG + Intergenic
1117411050 14:55451472-55451494 CACTGAAAAAAAATATATCCTGG - Intronic
1117679012 14:58184337-58184359 CAGTGTAAAGAAATAAAACTAGG + Intronic
1119423362 14:74521337-74521359 ATGTGGAAAAAAATGTATGTGGG + Intronic
1119791002 14:77349709-77349731 CAGTGAAGAAAAATGAAGCTGGG - Intronic
1120668014 14:87330099-87330121 CAATGTTAAAAAATTTTTCTGGG + Intergenic
1120936697 14:89903450-89903472 CAGTGAAAGAAAATGTTACTGGG + Intronic
1121848259 14:97194791-97194813 CAATTTAAAAAAAGGTATCCAGG - Intergenic
1122073520 14:99221009-99221031 AAATATAAAAAAATGTAGCTGGG - Intronic
1124967125 15:34442443-34442465 CAGAGTATACAAGTGTATCTTGG + Intergenic
1125009186 15:34852071-34852093 TAGGGAAAAAAAATGTATTTTGG + Exonic
1125278291 15:38016792-38016814 CACTGTCAAAAAGTTTATCTGGG + Intergenic
1126088889 15:45034489-45034511 TAATGTAAAAAAATGTATTTAGG + Intronic
1126425188 15:48520066-48520088 CAGTTTAAAAAATTGTGTCTAGG - Intronic
1126971327 15:54115261-54115283 TAATGTACAAAAATGTATTTGGG + Intronic
1127162084 15:56199427-56199449 GATTGTAAAAATATGTATTTTGG + Intronic
1127323586 15:57872092-57872114 CAGTGTATAAAAATATGTGTGGG - Intergenic
1127364538 15:58275374-58275396 CAAAGTATAAAAATATATCTGGG + Intronic
1128535831 15:68489559-68489581 CAGTGTGAACAATTGTCTCTGGG - Intergenic
1129223269 15:74147787-74147809 CATGGGAAAAAAATGAATCTTGG - Intergenic
1129842125 15:78750379-78750401 CAGTTTAAAAAAATTTTTTTTGG + Intergenic
1130391992 15:83464857-83464879 CTGTTTTAAAAAATGTATCTCGG + Intronic
1130911108 15:88271431-88271453 CAGGATAAACAAATGTATTTGGG - Intergenic
1131610218 15:93952962-93952984 CAGTGTCCCAAACTGTATCTGGG - Intergenic
1134431650 16:14214251-14214273 CAATGAAAGAAAATGTAACTTGG - Intronic
1134474852 16:14564271-14564293 TATTATAAAAAAATGTTTCTGGG - Intronic
1135706586 16:24680258-24680280 CAGAAAAAAAAAAAGTATCTGGG + Intergenic
1135751296 16:25060502-25060524 CAGAGTAAAAAGATGTAAGTGGG - Intergenic
1135929341 16:26723506-26723528 CAATAGAAAAAAATGTAGCTGGG + Intergenic
1138324577 16:56153616-56153638 TAGTTTAAAAAAATATATTTGGG + Intergenic
1138721097 16:59080646-59080668 CAAAGTAAAAACAAGTATCTTGG + Intergenic
1139763830 16:69210209-69210231 AAATGTAAAAAAATGTATTACGG + Intronic
1140243170 16:73223012-73223034 CAATATAAAAAAATGAATCTAGG + Intergenic
1140542089 16:75765686-75765708 TAGTATAAAAAAATATATCATGG - Intergenic
1141327036 16:83070530-83070552 CAGTATTAAAAAAACTATCTTGG + Intronic
1142591532 17:1008268-1008290 CAGTCTCAAAAAATGTTTCTGGG + Intronic
1143755918 17:9067512-9067534 CTGTGTAAATTAATGTATCCCGG - Intronic
1146154983 17:30515775-30515797 CAGAATAAAGAAATGTAACTGGG - Intronic
1146549491 17:33768304-33768326 CTTTTTAAAAAAATGTATATGGG - Intronic
1148498215 17:48067998-48068020 CAGTGGAAAAACATGTTTGTTGG - Intergenic
1149166972 17:53763458-53763480 TACCGTAAAGAAATGTATCTTGG - Intergenic
1149324488 17:55516188-55516210 CAATGAAAAACAATGTAGCTAGG + Intergenic
1149472471 17:56928960-56928982 CTATTTAAAAAAATGTATCCTGG + Intergenic
1150373944 17:64664527-64664549 CAGCATAGAAAAATGTATATAGG + Intergenic
1150374377 17:64668181-64668203 CAGCATAGAAAAATGTATATAGG + Intergenic
1150374697 17:64671330-64671352 CAGCATAGAAAAATGTATATAGG + Intergenic
1150409069 17:64927538-64927560 CACTGTAAAAAAATGAAGCAAGG + Intergenic
1150448391 17:65245286-65245308 CACTTTGAAAAAATGAATCTGGG + Intergenic
1150761181 17:67963235-67963257 CACTGTAAAAAAGTGAATCAAGG + Intronic
1150778035 17:68097610-68097632 CAGCATAGAAAAATGTATATAGG - Intergenic
1151639657 17:75381845-75381867 AAGTGAGAAAAAATGTATTTTGG - Intronic
1154253874 18:12766536-12766558 CAGAGGAAAATAATCTATCTTGG - Intergenic
1155547729 18:26932127-26932149 CAGTTTAAAATAATATATGTTGG + Intronic
1155879802 18:31131380-31131402 CAGTTTACAAAACTTTATCTAGG - Intronic
1156031778 18:32721608-32721630 CATTGAAAAATAATGTATCAAGG - Intronic
1156417168 18:36908705-36908727 CAGTGTGAATATATTTATCTAGG + Intronic
1156606221 18:38670493-38670515 CAGTGCAGAAAAGTATATCTGGG + Intergenic
1157017943 18:43741808-43741830 CAGAATAAAAAAAAGGATCTTGG + Intergenic
1157076565 18:44473593-44473615 CAGTGAAATAAAATGCATGTGGG + Intergenic
1157297845 18:46458903-46458925 CAGTGTATGAAAATGTCTCCAGG + Exonic
1158117903 18:54016964-54016986 CAGTGTAAAAAATCCTATCTAGG + Intergenic
1158453152 18:57584842-57584864 CAGTGAAAAAAAATGTTTGGGGG + Intronic
1158997995 18:62943193-62943215 CCTTGTAAAAAAATCCATCTAGG + Intronic
1159509967 18:69384318-69384340 GAGTGTTAAAAATTGTATCATGG + Intergenic
1160311328 18:77793611-77793633 CAATGTAAAATGATGTATTTGGG - Intergenic
1163741878 19:19019595-19019617 AAATATACAAAAATGTATCTAGG + Intronic
1167228829 19:48268717-48268739 CACCGTAAAAAAATGTAACTGGG + Intronic
1167929125 19:52849365-52849387 AAGTGTAATAAAATACATCTGGG - Intronic
1168227167 19:55003976-55003998 CAGTGATCAAAAATGTCTCTGGG + Intergenic
926846687 2:17148845-17148867 AAGTGTTAAATAATATATCTTGG + Intergenic
927061574 2:19427647-19427669 CACTGAAAAAATATGTATTTGGG - Intergenic
927069769 2:19515510-19515532 CAATGAAAAAAAATGTATTCAGG - Intergenic
927291885 2:21412762-21412784 CAGAGTAAAGAAAAGTATCATGG + Intergenic
927704478 2:25288608-25288630 AAGTTTAAAAAAGTGTTTCTAGG - Intronic
928869933 2:35964245-35964267 AAGTAAAAAAAAATGTATGTTGG + Intergenic
928889460 2:36186451-36186473 CCTGGAAAAAAAATGTATCTAGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929745634 2:44654862-44654884 CAGTGTCAATAAATATTTCTAGG + Intronic
931805139 2:65796935-65796957 CAGTGGAAAAACAAGTACCTGGG + Intergenic
931914013 2:66933289-66933311 CAGTGGCAAAAAATGTCTCTTGG + Intergenic
933221356 2:79693141-79693163 CAGTGTAAAAATTTATATCAGGG - Intronic
933971237 2:87471427-87471449 CCATGTAAAAAAATGTCTGTAGG + Intergenic
934016599 2:87892333-87892355 AAGTGTAAGAAAATATATCCTGG + Intergenic
934584791 2:95482016-95482038 CAGTGCAAAGAAAGGTATTTTGG - Intergenic
934594664 2:95594700-95594722 CAGTGCAAAGAAAGGTATTTTGG + Intronic
934788111 2:97030938-97030960 CAGTGCAAAGAAATGTATTTTGG - Intergenic
935466483 2:103404446-103404468 CAGTGGAAGAAAATCTTTCTGGG + Intergenic
935589571 2:104834197-104834219 CAGTTTATAAAAATGCATGTCGG - Intergenic
936731861 2:115391710-115391732 CAGTTTAATGAAATGAATCTTGG - Intronic
937627504 2:124059850-124059872 CAGTATATAAAAATGTCTCATGG + Intronic
937716152 2:125035868-125035890 CAATGAAAAAAAAAGTATGTAGG - Intergenic
937950309 2:127381535-127381557 CAGTGTTAATAAATGTTTGTTGG - Intronic
939476790 2:142696984-142697006 CAATGAAAAAAAAAGTATCTAGG + Intergenic
940291925 2:152085490-152085512 CAGTGTGAAAACAAGTATCTGGG + Intronic
940976410 2:159950116-159950138 CAGTATAAAAAAATTTAACCAGG - Intronic
941285073 2:163601285-163601307 AAATGTAAAAACATATATCTAGG - Intronic
941323230 2:164081698-164081720 CAGGGAAAAAAAATGAAACTTGG - Intergenic
941426644 2:165354512-165354534 CAGTGTAGAAAAATATGTCGTGG + Exonic
942238609 2:173937957-173937979 CAGTGTTAAAAAATGACTTTAGG + Intronic
942429166 2:175891448-175891470 CAATCTAAGAATATGTATCTTGG + Intergenic
942524207 2:176836112-176836134 CAGTGTGAAAGAATGTTTGTGGG - Intergenic
943058792 2:183016611-183016633 TACTGTAAAATAATGTAACTGGG - Intronic
943329164 2:186538275-186538297 CAATGTAAAAATATGTATGTGGG + Intergenic
943501659 2:188697480-188697502 CACTGGACAAAAATGTACCTAGG - Intergenic
943764969 2:191650805-191650827 TGGTTTAAAAAAATATATCTTGG - Intergenic
943863727 2:192900002-192900024 AAGTTTAAAAAAATGTGTTTGGG - Intergenic
944013193 2:194999551-194999573 TACTGTAAACAAATGTATCCAGG + Intergenic
944105424 2:196074519-196074541 CATTTTAAAAGAAGGTATCTGGG + Intergenic
944240045 2:197477391-197477413 GAGTGTTAACAAATGGATCTTGG + Intergenic
945217158 2:207445829-207445851 CAGTTAAAAAAAATGTGTTTGGG + Intergenic
945727004 2:213482749-213482771 GAGTGTAGAATTATGTATCTAGG + Intronic
946485265 2:220095224-220095246 CAGTAAACAAAAATGTATGTTGG + Intergenic
946629414 2:221649884-221649906 CAGTGGAAAATGATGTCTCTGGG - Intergenic
1168941429 20:1714751-1714773 CAATGAAAAAAAAATTATCTAGG + Intergenic
1169512154 20:6275924-6275946 TAGAATAAAAAAATGTTTCTAGG + Intergenic
1169675576 20:8150233-8150255 CACTGTAGAAAAATCTATCCAGG - Intronic
1173710079 20:45147409-45147431 CAGTGGAAAAAAAAGAAACTTGG + Intergenic
1174761080 20:53207840-53207862 AAAAGTAAAACAATGTATCTGGG - Intronic
1175007185 20:55697288-55697310 CAAGAAAAAAAAATGTATCTGGG - Intergenic
1175694211 20:61089257-61089279 AACTGTTAAAAAATGTATATAGG - Intergenic
1176655497 21:9585853-9585875 AAGTTCAAAAAAATGTATTTAGG + Intergenic
1176712998 21:10272189-10272211 CATTTAAAAAATATGTATCTTGG + Intergenic
1177281809 21:18990436-18990458 CTGCTTAAAAAAATGTTTCTTGG + Intergenic
1179562576 21:42225253-42225275 CAGTGTAAATATAAGTTTCTCGG + Intronic
1180590304 22:16931647-16931669 CAGTGTACAAAACTCAATCTAGG - Intergenic
1180760952 22:18205562-18205584 CATTTAAAAAATATGTATCTTGG - Intergenic
1180774717 22:18419224-18419246 CATTTAAAAAATATGTATCTTGG + Intergenic
1181070829 22:20338361-20338383 CATTTAAAAAATATGTATCTTGG + Intergenic
1183646618 22:39130982-39131004 CAGACTAAATGAATGTATCTGGG - Exonic
1183800637 22:40160721-40160743 CAAAGCAAAAAAAAGTATCTGGG - Intronic
949974290 3:9440870-9440892 TAGTTTAAAAATATGTATCCAGG - Intronic
950181386 3:10915864-10915886 CACTTTAAAAAATTGTCTCTGGG - Intronic
952148354 3:30558742-30558764 CAGTGTAAAAATATGAGTCTGGG + Intergenic
952148680 3:30562521-30562543 CAGTATAAAAAAATGATTTTTGG - Intergenic
952431444 3:33227838-33227860 GAGTGTAAAAAAATATTTCTTGG - Intergenic
953177860 3:40568095-40568117 CAGTTTAAAAACATCTTTCTAGG + Intronic
953756086 3:45647060-45647082 CATTGTCAAAAAATGTATATGGG + Intronic
954766116 3:52918130-52918152 CAGTGGAAAAAAATAAAGCTGGG - Intronic
954891609 3:53935516-53935538 CAGTGTGAGTAAATGTATGTAGG + Intergenic
956488464 3:69746346-69746368 CAGTGTAAAAAAATGTATCTTGG + Intronic
957056316 3:75445515-75445537 AAATGCAAAAAAATGTAGCTGGG - Intergenic
957911067 3:86620653-86620675 CACTTTAAAAAAAAGTATCCAGG + Intergenic
957982069 3:87523559-87523581 CAGTTTAAATAAATGTTTATTGG - Intergenic
958446937 3:94227023-94227045 TAGTGTTTAAAAATGTACCTGGG + Intergenic
958764767 3:98353663-98353685 AAGTGAGAAAAAATGTATCATGG - Intergenic
959126969 3:102301486-102301508 CAATGTAGAAAAAAGTCTCTAGG - Intronic
959143416 3:102514268-102514290 TAGTGGAAAAAAATGTATATGGG - Intergenic
959401444 3:105906948-105906970 CTGTCTAAAAATATGTATTTGGG - Intergenic
959483367 3:106900046-106900068 CAGTGTGAAAAAAATTATTTGGG - Intergenic
959783176 3:110260636-110260658 CAGAAAAAAAAAATCTATCTAGG + Intergenic
960502548 3:118454952-118454974 CAGTGAGGAGAAATGTATCTGGG + Intergenic
961298071 3:125903192-125903214 AAATGCAAAAAAATGTAGCTGGG + Intergenic
961395424 3:126584378-126584400 AAGTTTAAAAAAATTTAGCTGGG + Intronic
961968302 3:130929503-130929525 CAGCTTAAAAACTTGTATCTGGG + Intronic
962155508 3:132944821-132944843 CAGTGAAAAAATATGTAGTTGGG - Intergenic
962819948 3:139038828-139038850 CGGTGTTAAATCATGTATCTTGG + Intronic
963261613 3:143197527-143197549 CAGGGAGCAAAAATGTATCTGGG - Intergenic
963469286 3:145717919-145717941 CAGTATATAAAAATATATGTAGG - Intergenic
963495346 3:146052774-146052796 AATTTTAAAAAAGTGTATCTTGG - Intergenic
963515828 3:146306702-146306724 CGGAGTAAAAAATTGTTTCTTGG - Intergenic
965484135 3:169257923-169257945 CAGTGTAAGAAAAAGTAGCCGGG + Intronic
965713375 3:171578434-171578456 CTGGGTAATAAAATGTATATTGG - Intergenic
965762077 3:172089794-172089816 AAGTGGAAAACTATGTATCTAGG + Intronic
966254715 3:177904763-177904785 CATACTAAAAAAATGTAACTGGG - Intergenic
970105094 4:12573659-12573681 CAGGATAAGAAAAGGTATCTTGG + Intergenic
970395959 4:15666094-15666116 CAGTTTAAAAATATGAATTTTGG + Intronic
970438508 4:16058960-16058982 CAGTGTCCAAAAAGGTACCTTGG + Intronic
970790043 4:19846562-19846584 TTGTTTAAAGAAATGTATCTAGG + Intergenic
971068360 4:23061004-23061026 CAGTGGGAAAAAGTGTATTTGGG + Intergenic
971600348 4:28583357-28583379 CACTGTTAAAACATGTATGTAGG - Intergenic
971655045 4:29333365-29333387 CAGTATGAAGAAATATATCTTGG - Intergenic
972880619 4:43417710-43417732 CAATGGAAAAAAATGTATCCAGG - Intergenic
972974595 4:44618531-44618553 CTTTGTAAAAAAATGCCTCTTGG + Intergenic
973915284 4:55627683-55627705 TAGTGAAAAGAAATGTATATTGG + Intronic
974538444 4:63200121-63200143 CACAGTAAAAAAATGTCTCGTGG + Intergenic
975721139 4:77249768-77249790 CAGTGTAATAAGAATTATCTAGG + Intronic
975962184 4:79924200-79924222 CATTTTAAAAATATGTATTTGGG - Intronic
977164990 4:93683702-93683724 AAGTACAAAAACATGTATCTTGG - Intronic
977349785 4:95867782-95867804 CAGTATAAAAATATTTATCACGG - Intergenic
978407030 4:108391091-108391113 CCGTGTACAAAAAAGTTTCTTGG + Intergenic
979069830 4:116187961-116187983 CAGTGAAAACAAATGCATCATGG + Intergenic
979101650 4:116624379-116624401 CAGCTTAAGAGAATGTATCTGGG + Intergenic
980056994 4:128087219-128087241 CCCTGTGAAAAAATGTATCTGGG - Intronic
980263146 4:130480460-130480482 CTGTGTAAAAAAATAAATATGGG + Intergenic
981452498 4:144914511-144914533 AAATGTAAAAGAATGTATCATGG + Intergenic
981507672 4:145520854-145520876 CAGTGTAAAAAAATGGTAGTGGG + Intronic
982534377 4:156590879-156590901 CAGTTTGACAAAATTTATCTTGG + Intergenic
982711756 4:158765054-158765076 GAGTTTGAGAAAATGTATCTAGG - Intergenic
983003890 4:162458126-162458148 CTGTGTAAGAAAAGGTTTCTGGG + Intergenic
983711298 4:170720179-170720201 AAGTTTAGAAAAATGTATCCTGG + Intergenic
983893829 4:173059926-173059948 CAGTTTGAATACATGTATCTTGG - Intergenic
985029022 4:185769834-185769856 CAGTGAAAAATAATGTGTTTAGG + Intronic
986396861 5:7339630-7339652 CATTGTACAAAAATGTTTCAAGG + Intergenic
986523830 5:8650729-8650751 CAATATAAAAAAATACATCTAGG - Intergenic
986950855 5:13082885-13082907 AAGTTTAAGAAAATGTATTTAGG - Intergenic
987334622 5:16887890-16887912 TAGTGTTAAAAATTGTTTCTGGG - Intronic
987431223 5:17835842-17835864 TAATTTAAAAAAATGTTTCTTGG - Intergenic
987725505 5:21694129-21694151 CACTTAAAAAAAATGTTTCTTGG + Intergenic
988310104 5:29545865-29545887 CAATGTAAAAAAATGTATGGGGG - Intergenic
988692132 5:33582839-33582861 CAGTTTTAAAAAATGTTTATGGG + Intronic
988739199 5:34053328-34053350 CAGAATAAAGAAATGTATTTGGG - Intronic
988867692 5:35353833-35353855 CAGTGTAAAAAAAAGTTGCCGGG - Intergenic
988920784 5:35940066-35940088 CAGTTCAAAAAACTGGATCTGGG + Intergenic
989119195 5:37986772-37986794 CAGTGTGAATAATTTTATCTTGG + Intergenic
990780594 5:59357630-59357652 CAGAGTTAAGAAATGTTTCTAGG - Intronic
992007994 5:72498383-72498405 CAGTGAACTAAAATGTATATGGG - Intronic
993410462 5:87567303-87567325 CAGTGTAAAAAAAGGCCACTGGG - Intergenic
993598841 5:89894175-89894197 CAGTGAAATAAAATGTGTGTCGG + Intergenic
993739195 5:91516932-91516954 TAGTGAACAAAAATGAATCTTGG + Intergenic
994059725 5:95460974-95460996 CAGTATAAAAAAGTTTATTTGGG - Intergenic
994208038 5:97057972-97057994 CAGTGGGAAAAAAAGTATTTGGG - Intergenic
994344411 5:98668278-98668300 CACTGTAATAAAATGTCTCCCGG + Intergenic
996145287 5:119967406-119967428 CAGTGTACAAAACTATATTTGGG - Intergenic
996678518 5:126203926-126203948 CAGTTAAAAAAAAGGTATTTAGG + Intergenic
997098819 5:130945199-130945221 CTCTGAAAGAAAATGTATCTAGG + Intergenic
998504698 5:142662982-142663004 AACTACAAAAAAATGTATCTGGG - Intronic
1000139476 5:158387975-158387997 TATTTTAAAAATATGTATCTGGG - Intergenic
1000546373 5:162608758-162608780 CAGTCTACATAAATGTAGCTTGG + Intergenic
1000699954 5:164436813-164436835 GAGTCTAAAAATATGTATATAGG - Intergenic
1000714557 5:164624423-164624445 CAGTGAAAAACAATATATTTTGG - Intergenic
1004072572 6:12314371-12314393 CATGGGAAAAAAATGTCTCTCGG - Intergenic
1004615400 6:17283122-17283144 CTGTGTGCAAAAATGGATCTTGG + Intronic
1008286471 6:49658727-49658749 GACTGTAAAAAAATATCTCTGGG + Intergenic
1008505655 6:52227142-52227164 CAGCGCACAAAAATGTATTTTGG + Intergenic
1009460651 6:63908864-63908886 GAGTGGAAAAAGATGTTTCTGGG + Intronic
1009555418 6:65158425-65158447 CATTGTAAAAGAATGTTACTGGG - Intronic
1010017229 6:71119511-71119533 CAATGAAAAAAAAAGTATTTGGG - Intergenic
1010439408 6:75875965-75875987 GAGTGTAAACAAATGAAGCTAGG - Intronic
1012050536 6:94337069-94337091 CAGTGTAAATATATATATATAGG + Intergenic
1012456582 6:99413352-99413374 GAAATTAAAAAAATGTATCTTGG - Intronic
1012546023 6:100420421-100420443 CGATGTAGAAAAATGCATCTTGG - Intronic
1012686977 6:102263365-102263387 CAGTTTAAAAAAATATTTATTGG + Intergenic
1013613944 6:111823739-111823761 AAGTGTTAAAATATGTGTCTGGG + Intronic
1014853442 6:126369433-126369455 AACTTTAAAAAAATGTATGTTGG - Intergenic
1015486655 6:133778235-133778257 CATTATAAAAAAATGCATCCTGG - Intergenic
1016740407 6:147522626-147522648 TAGTGTAAAAGAATGTATAATGG - Intronic
1017514870 6:155147151-155147173 CAATGTAAATAAAAGTATATTGG - Intronic
1019802640 7:3099634-3099656 GAGTGTAAATAAGTGTATTTGGG + Intergenic
1021044410 7:15905009-15905031 CACTGTAATAAACTGTATATAGG - Intergenic
1022366995 7:29730835-29730857 TACTGTAAAAAACTGTATGTTGG - Intergenic
1022408802 7:30119666-30119688 CATTGTAATAAAATGTGTCTTGG - Intronic
1023785955 7:43707951-43707973 CAGTGTAAAAAAATTTCCTTGGG + Intronic
1025136899 7:56423798-56423820 CGTTGTAAAAAAATCTAGCTGGG - Intergenic
1026168262 7:67930511-67930533 CAAAGTTAAAAACTGTATCTTGG - Intergenic
1027499761 7:78934402-78934424 CAGTGGAAAAAAATGTGTTCTGG - Intronic
1028272792 7:88813627-88813649 CAACATAACAAAATGTATCTTGG + Intronic
1028272860 7:88815289-88815311 CAGTATAACAAAATATAACTTGG + Intronic
1028647699 7:93116870-93116892 CAGAGTTAAAAAATGTATGTGGG - Intronic
1028773314 7:94652227-94652249 CAGTGTAAAAAAATGACTCTAGG - Intronic
1029292647 7:99514243-99514265 GAGTTTAAGAAAATTTATCTAGG + Intronic
1029790704 7:102840137-102840159 CAGTGAAAGAGAATGTATATTGG + Intronic
1030329086 7:108253879-108253901 CATTGTAAATAATTGTAACTTGG - Intronic
1030775426 7:113529117-113529139 CATTATAAAAAAATGTGTTTTGG - Intergenic
1031184991 7:118465837-118465859 CAGTGTAATAAATTGTATTTTGG - Intergenic
1031781449 7:125972307-125972329 AATTGTAAAAAAATGTATGAAGG + Intergenic
1033064521 7:138141211-138141233 CAATATAAAAAGATGTATCAAGG - Intergenic
1033554058 7:142472917-142472939 AATTGTCAAAAAATATATCTAGG + Intergenic
1035737627 8:1900208-1900230 CTGTCTAAAAGAATGTATTTCGG - Intronic
1036179278 8:6568926-6568948 CAGTCTAAAAAAATGAAGCTGGG + Intronic
1036199655 8:6757850-6757872 CAGTGAAATAAATTGTATTTAGG + Exonic
1038601214 8:28944849-28944871 CACTGTAAAAAACTGAATTTTGG + Intronic
1039210490 8:35207211-35207233 CAGTTTAAAAATATATAGCTGGG + Intergenic
1039960842 8:42246453-42246475 AAGTGCAAAACAATGTATTTTGG - Intergenic
1040722894 8:50347980-50348002 CAGTATGTAAAAATGTTTCTTGG - Intronic
1041159603 8:55026087-55026109 CCCTTTAAAAAAATGTCTCTGGG - Intergenic
1041212855 8:55570018-55570040 CAGTTTACAAATATGAATCTTGG - Intergenic
1041607559 8:59800838-59800860 AAGTATATAAAAACGTATCTTGG + Intergenic
1041660508 8:60397057-60397079 AAGTGTAATAAAATGTAAATAGG + Intergenic
1041833292 8:62181233-62181255 AAGTGTACAAAACTGAATCTGGG - Intergenic
1042007431 8:64197260-64197282 CACTGAAAAAAAAAGTATATAGG + Intergenic
1042094289 8:65195306-65195328 CACTGTAAAAAAATGCATTAGGG - Intergenic
1042282835 8:67073133-67073155 CAATGTATAAGAATGTATGTGGG - Intronic
1042326271 8:67531577-67531599 CAGTGTATATAAATGTACATAGG - Intronic
1043952799 8:86327806-86327828 TAGTCTAAAAAAATGTAACACGG + Intergenic
1044098996 8:88106315-88106337 CGCTTTAAAAATATGTATCTTGG + Intronic
1045154452 8:99451652-99451674 CAAGGAAAGAAAATGTATCTGGG - Intronic
1045982630 8:108209302-108209324 CAGTGGAAAAAAGTCTATTTTGG + Intronic
1046060347 8:109132269-109132291 CACCGTAAAAATATGTATTTGGG - Intergenic
1046343265 8:112887217-112887239 TAGTATAAAAGAATGTAACTGGG + Intronic
1046626169 8:116578858-116578880 AACTGTAAACAAATGTGTCTGGG + Intergenic
1047909425 8:129511122-129511144 CAGTGACAAAAAATGTGTTTTGG - Intergenic
1050015906 9:1234504-1234526 CAGTGACAACAAATGTTTCTTGG + Intergenic
1050651794 9:7784779-7784801 CAGTGTTAAAATAAGTAACTGGG - Intergenic
1050817249 9:9831262-9831284 CAATGTCAAAAAATGTCTCTAGG - Intronic
1050941242 9:11461450-11461472 AAGTTTATAAAAATGTTTCTTGG + Intergenic
1051493023 9:17688333-17688355 CGGTGAAAAAAAATGTAGTTTGG + Intronic
1052109607 9:24564567-24564589 TGGTGTAAAAAAGTATATCTGGG - Intergenic
1052620426 9:30901527-30901549 CAATGTAAAAAAAAGAATTTTGG - Intergenic
1055028867 9:71751664-71751686 CATTTTAAAAAAATATATCTTGG + Intronic
1055849454 9:80608782-80608804 CAGGGAAATAAAATGTATTTTGG + Intergenic
1055902634 9:81258814-81258836 TAGAGAAAAAAAATGTAGCTTGG - Intergenic
1055984826 9:82047197-82047219 CAGTATAAAAAGATGTAAATTGG - Intergenic
1056383190 9:86074262-86074284 CAATGTATAAAAAAGTATTTAGG + Intronic
1057459753 9:95250447-95250469 CAGTGCAAAAAAATCTAGATCGG + Intronic
1057543618 9:96000185-96000207 TATTTTAAAAAATTGTATCTTGG - Intronic
1059055495 9:110974864-110974886 CAGTGTAAAACAGTGCACCTTGG - Intronic
1059265187 9:113022027-113022049 CATTTTAATATAATGTATCTGGG + Intergenic
1059469308 9:114492449-114492471 CAGTGTAGAAACATTTATCAAGG + Intronic
1059800246 9:117742877-117742899 TAATATAAAAAGATGTATCTGGG + Intergenic
1061145537 9:128795892-128795914 CCATGTAAAAATATTTATCTAGG - Intronic
1061490863 9:130943542-130943564 CATTAAAAATAAATGTATCTTGG + Intergenic
1062263695 9:135676891-135676913 GAATTTAAAAAAATGTATCGTGG - Intergenic
1203633215 Un_KI270750v1:89325-89347 AAGTTCAAAAAAATGTATTTAGG + Intergenic
1186646775 X:11515158-11515180 CAATGTAAGACAATCTATCTTGG - Intronic
1187517305 X:19983909-19983931 AAATATAAAAAAATGTAGCTGGG + Intergenic
1187923810 X:24232196-24232218 CAGTTTTTAAAAATATATCTGGG - Intergenic
1189048252 X:37616431-37616453 CAGTGTTAAAAAAGGACTCTTGG + Intronic
1189862953 X:45292064-45292086 GAGTGTAAAAGGATGTATCCTGG + Intergenic
1191017221 X:55821792-55821814 CCGTGAAAAATAAGGTATCTAGG - Intergenic
1193086810 X:77454346-77454368 AAGTATAAAAATATTTATCTGGG + Intronic
1194009808 X:88547663-88547685 AATTTTAAATAAATGTATCTGGG - Intergenic
1195218467 X:102723221-102723243 CAGTGTAAGAAAGTGTTGCTAGG + Intronic
1195776179 X:108408597-108408619 CAGTACAAAAAAATGAAACTAGG - Intronic
1197136260 X:123063462-123063484 CTGTGTAAATAAATATATATGGG - Intergenic
1197520797 X:127494072-127494094 AATTGTACAAAAATGTTTCTAGG + Intergenic
1197944456 X:131823431-131823453 CACTGCAAAAAAATGTTTCTTGG + Intergenic
1198473734 X:136975164-136975186 CATTGTACAAAAATGTTTATAGG - Intergenic
1198831582 X:140756767-140756789 CAGAAAAAAAAAATGTTTCTTGG - Intergenic
1198965450 X:142224593-142224615 CAGTTTAAAAAAAAATATTTGGG + Intergenic
1198972887 X:142301326-142301348 TGGAGTAAAGAAATGTATCTAGG - Intergenic
1199127887 X:144146207-144146229 AAGTGTAAGAAAATATATCCTGG - Intergenic
1199923274 X:152432828-152432850 CCCTTTAAAAAACTGTATCTAGG - Intronic
1199928375 X:152493804-152493826 CAATGAAAAAAAATGTCTCCAGG + Intergenic
1200987305 Y:9316318-9316340 CATAGGAAAAAAATGTACCTAGG + Intergenic
1201863740 Y:18626947-18626969 CTGTGAGAAAAAGTGTATCTGGG - Intergenic
1201869582 Y:18693431-18693453 CTGTGAGAAAAAGTGTATCTGGG + Intergenic
1202116482 Y:21473202-21473224 CAGTGTTAAAAAAAATAACTCGG + Intergenic