ID: 956489687

View in Genome Browser
Species Human (GRCh38)
Location 3:69757618-69757640
Sequence CTGGCTCTTCCCCAAGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956489687_956489691 6 Left 956489687 3:69757618-69757640 CCCTGAACTTGGGGAAGAGCCAG 0: 1
1: 0
2: 3
3: 18
4: 215
Right 956489691 3:69757647-69757669 GAGATGAAAAAAAACAGTTTGGG 0: 1
1: 2
2: 5
3: 66
4: 717
956489687_956489690 5 Left 956489687 3:69757618-69757640 CCCTGAACTTGGGGAAGAGCCAG 0: 1
1: 0
2: 3
3: 18
4: 215
Right 956489690 3:69757646-69757668 AGAGATGAAAAAAAACAGTTTGG 0: 1
1: 1
2: 11
3: 96
4: 1058

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956489687 Original CRISPR CTGGCTCTTCCCCAAGTTCA GGG (reversed) Intronic
900090051 1:916296-916318 CTGTCTCTTCCCCCTGGTCAGGG + Intergenic
901082827 1:6593143-6593165 GTGGCTCTTCCTCAACTGCAGGG + Exonic
902205467 1:14865151-14865173 CTGCCTCTTGCCCAAGGTCAGGG + Intronic
902703678 1:18190175-18190197 CTGCCTCTTCCCTCAATTCAGGG + Intronic
905233853 1:36531970-36531992 CTGCCTCTTCCTCAAGTTAGAGG - Intergenic
905359271 1:37407625-37407647 CTAGCTCTTCTCCCAGCTCAAGG - Intergenic
905858493 1:41330632-41330654 CAGGCTATGCCCCAAGTTCCCGG + Intergenic
905976291 1:42176346-42176368 CAGTGACTTCCCCAAGTTCATGG + Intergenic
908592990 1:65653013-65653035 CTGGCTTTTCCTCATCTTCATGG - Intergenic
908967046 1:69777932-69777954 CTGTCTCTTCTCTAACTTCAGGG + Intronic
909095689 1:71285360-71285382 GAGGCTCTCCTCCAAGTTCAAGG + Intergenic
909457002 1:75861376-75861398 CTGGCTTCTCCCCATCTTCATGG + Intronic
911776368 1:101818450-101818472 CTTGCTCTTCCCAAAATTCTAGG - Intronic
914356098 1:146885838-146885860 CTTGCGGTTCTCCAAGTTCATGG - Intergenic
914998579 1:152566083-152566105 CTGGCTGTGCCCCAAGCTCTGGG - Exonic
914999932 1:152579811-152579833 CTGGCTGTGCCCCAAGCTCTGGG - Exonic
915103286 1:153515867-153515889 CTGTGTCCTCCCCAAGTCCAGGG - Intergenic
916878610 1:168997701-168997723 CTGGCTTTTCCTCATCTTCATGG + Intergenic
917376549 1:174353734-174353756 CTCTGTCTTCCCCAAGTACATGG + Intronic
917406073 1:174709706-174709728 CTGGCTTTTCCTCATCTTCATGG - Intronic
918245366 1:182654859-182654881 CTTGCTATTCTCCAGGTTCAAGG - Intronic
918479408 1:184961650-184961672 ATGGCTCTAACCCCAGTTCAGGG + Intronic
923750381 1:236741401-236741423 CTGACTTTTCCCCAAATTCCAGG + Intronic
1064371038 10:14751783-14751805 CTGGCACTTCCTCAAGCTCTTGG - Intronic
1065318273 10:24485457-24485479 CTGGCTCCTCTCCAAACTCAAGG + Intronic
1065780753 10:29164417-29164439 ATGGGTCTTCCCCAGGTGCAAGG + Intergenic
1066510149 10:36086698-36086720 CTGGCTCTACACTAAGTTTATGG + Intergenic
1066662452 10:37749687-37749709 CTGGCTGGTCCCCAAGTTTCTGG - Intergenic
1069833752 10:71296130-71296152 CAGGCACGTCCCCAAATTCAGGG + Intronic
1070739543 10:78893700-78893722 TTTGTTCTTCCCCAAGTCCAGGG + Intergenic
1070999849 10:80818908-80818930 CTGGCTTTTCCTCATCTTCATGG - Intergenic
1071189713 10:83084848-83084870 CTGGCTCTTCTCCATGTTGGAGG - Intergenic
1071941389 10:90595258-90595280 ATACCTCCTCCCCAAGTTCATGG - Intergenic
1074697605 10:116064716-116064738 CTGGTTCTAACCCAGGTTCATGG - Intronic
1077042609 11:531271-531293 CTAGCTCTCCCCCAACCTCAGGG + Intergenic
1077104298 11:835293-835315 CTGGCTCTGCCCCGACTTCTGGG + Intronic
1077322436 11:1948271-1948293 CTGGGTGTTCCCCAAGGTCAGGG - Intronic
1077520503 11:3030517-3030539 CTGGGCCTGCCCCAAGTACAGGG + Intronic
1086300215 11:85420045-85420067 CTGGTTTTTCCCCATTTTCATGG + Intronic
1089253624 11:117182004-117182026 CTGGTTCTTCCCCAGGCTCCGGG + Intronic
1089365684 11:117919589-117919611 CTAAGTCTTCCCCAACTTCAGGG + Intronic
1089539203 11:119179881-119179903 CGAGCTCTTCCCCATGTTCATGG + Exonic
1090788008 11:130067630-130067652 CTTGCTTTTCCCTGAGTTCAAGG + Intergenic
1202805454 11_KI270721v1_random:3584-3606 CTGGGTGTTCCCCAAGGTCAGGG - Intergenic
1095291615 12:40485266-40485288 CTGGATCATCCGCAAGATCAGGG + Exonic
1096589893 12:52651035-52651057 CTGGCTTTTCTCCTATTTCAAGG - Intronic
1100178290 12:92055952-92055974 CTGTCTCTTCACCAAGTGTAGGG + Intronic
1106200949 13:27536823-27536845 CTGGCTCTTCGGAAAGCTCAGGG + Intergenic
1107119495 13:36781264-36781286 CTGCATCTTTTCCAAGTTCAGGG + Intergenic
1107641840 13:42452278-42452300 CTGGTTTTTCCCCATCTTCATGG + Intergenic
1107942309 13:45385703-45385725 ATGGCCCTTCCCCCAGTTCTGGG - Intergenic
1110338831 13:74365034-74365056 CTGGCTCATCACCAAGTTCATGG - Intergenic
1112388398 13:98961040-98961062 CTGGCTCTTCCACTAGCCCAGGG - Intronic
1115537227 14:34384657-34384679 CTGGCTCCTCCCCAGGCTGAGGG + Intronic
1115867109 14:37760111-37760133 CTGGTTCTTCCTCATGTTCGTGG + Intronic
1115933221 14:38521663-38521685 CTGGCCTTTCCTCAAGGTCAAGG - Intergenic
1116858387 14:49973943-49973965 CTGGCTCTGCCCCAGGCTCCTGG + Intergenic
1117584598 14:57187405-57187427 CTGCCTCCTCCCCAAGGTCCTGG - Intergenic
1118608037 14:67517276-67517298 CTGGCTCTCCCCCAGGCTCTGGG + Intronic
1120333202 14:83119939-83119961 CTGGCTCTAACCTAAGATCAAGG + Intergenic
1121560710 14:94873437-94873459 CTGGCCCTTCCACCACTTCAAGG + Intergenic
1121841057 14:97134212-97134234 GTGGCTCTGCACCAAGTTTAAGG - Intergenic
1124386306 15:29210629-29210651 CTGGACCCTCCCCCAGTTCATGG + Intronic
1129021341 15:72521898-72521920 CTGGCACTTGCCCAAGTGCTGGG - Intronic
1132062936 15:98707683-98707705 CTACCGCTTCCCCAAGCTCACGG + Exonic
1132782160 16:1633257-1633279 CTGGCTCTTCCCAAAGCTCCGGG - Intronic
1134065516 16:11225706-11225728 CTGGCTCTGCCCCAAAGCCATGG + Intergenic
1134148035 16:11783363-11783385 CGAGCAGTTCCCCAAGTTCAAGG + Intronic
1137521486 16:49199113-49199135 CTGACTCTGCCCCTAGCTCAAGG - Intergenic
1137551193 16:49438695-49438717 CTGCCTCTCCCCCAAGATCCTGG - Intergenic
1137861951 16:51855766-51855788 CTGGGTCTTGCCCAAGCTGATGG + Intergenic
1138799649 16:60012656-60012678 TTGGCCCTTCCCCAAATCCAGGG - Intergenic
1139596825 16:67963133-67963155 CTGGTTCTTCTCCAAGTCCATGG - Intronic
1139977917 16:70829624-70829646 CTTGCGGTTCTCCAAGTTCATGG + Exonic
1142244621 16:88964193-88964215 CCTGCTCTTCCCCCAATTCATGG + Intronic
1142423736 16:89989500-89989522 CTGGCTCCGCCCCAGGTTCCCGG - Intergenic
1143427015 17:6848301-6848323 CTGGCTTCTCCCCATCTTCATGG + Intergenic
1144825000 17:18100853-18100875 CTGGCTCCTCACCAAGTACTGGG + Intronic
1145775437 17:27524631-27524653 CTTGCTCTTCCCCAATTCCTGGG - Intronic
1146528263 17:33585214-33585236 CTGGCTCTTGCCCTGATTCAAGG - Intronic
1147318548 17:39632641-39632663 CTGCCGCGTCCCCAAGGTCAGGG + Intronic
1152764214 17:82127288-82127310 CTGGCTCTTCCCCAGGAGCAGGG + Intronic
1154949045 18:21190535-21190557 ATGGTCCTTCTCCAAGTTCATGG + Intergenic
1157589257 18:48826456-48826478 CTGGCTCTTGCCCACCTTCAGGG + Intronic
1161802199 19:6422555-6422577 CTGACTCTTCCCTAAGTTGGAGG - Intronic
1162768181 19:12932893-12932915 CTGGCACTTCCCCAAGCTGGAGG - Intronic
1163437621 19:17304715-17304737 TTGACTCTCCCCCAAGTTCAAGG - Intronic
1164513786 19:28917594-28917616 GAGGCCCTTCCCCAAGGTCACGG + Intergenic
1167407107 19:49318226-49318248 CTTGTTCTTCTCCAAGTTCTAGG - Intronic
1167768343 19:51499108-51499130 CTGGCTCTCCCCTGAGTTGAAGG + Intronic
1167793756 19:51695833-51695855 CTGGCCCTTCTCCACCTTCACGG - Intergenic
1168063906 19:53908859-53908881 CTGTCTCTTCTCCAAGCTCAAGG + Intergenic
925412570 2:3648437-3648459 CTGGCTCTTCCTCACCTGCACGG + Intergenic
927688135 2:25187168-25187190 CTGGCTCATCCCAAACTTAATGG + Intergenic
929089177 2:38197845-38197867 CAGGATCTTCCCAGAGTTCATGG - Intergenic
930377825 2:50589761-50589783 CTGTGTCTTGCCCAAGGTCAGGG + Intronic
931637783 2:64356250-64356272 CTGGCTCTTCCTTCAGTTCGTGG + Intergenic
932707548 2:74038367-74038389 CTAGGTCTTCCCCAAGTTGGAGG - Intronic
934649546 2:96083164-96083186 CTGCCTCTTCCCCTAGTCCTGGG + Intergenic
935346061 2:102109611-102109633 CTGCCTGATCCCCAAGTTGAGGG - Intronic
939955178 2:148521860-148521882 CTGGCTCTTCCCAAATGTCCAGG + Intergenic
939955731 2:148526559-148526581 CTGGCTCTGCCACCAGTGCAAGG + Intergenic
940602715 2:155881237-155881259 CTGGCTTTTCCTCATCTTCATGG - Intergenic
945462237 2:210122414-210122436 CTGTTTTTTCCCCAAGTTCTTGG - Intronic
945948768 2:216019257-216019279 CTGCCTCTTAACCCAGTTCAGGG - Intronic
945969660 2:216223228-216223250 CTAGCTTTTCCCCAAATGCAGGG + Intergenic
946148650 2:217749396-217749418 CTGGCTCTGCCCCATGTTCTGGG - Intronic
946314071 2:218897987-218898009 CTGGATTCTCCACAAGTTCAAGG + Intronic
1170880019 20:20288899-20288921 CCGGCTCATCCCCATGTACAAGG + Exonic
1171135897 20:22694144-22694166 CTGGCTCTTCCCCAGGCACTGGG + Intergenic
1171203158 20:23257742-23257764 CAGGCTCTGCCCCAGGCTCAGGG + Intergenic
1172150584 20:32787491-32787513 CTGGTTTTTCCCCGTGTTCAGGG - Intronic
1172194032 20:33079802-33079824 ATGGCCCCTCTCCAAGTTCAGGG + Intronic
1175424054 20:58853322-58853344 CGGGCTGTTCCCCGATTTCAGGG - Exonic
1175437652 20:58965607-58965629 CTGCCTGTTCCCCCAGTTGAAGG + Intergenic
1175608522 20:60331049-60331071 CTGGCACTTTCTGAAGTTCAGGG - Intergenic
1177166631 21:17612162-17612184 CCCGGTTTTCCCCAAGTTCAAGG + Intronic
1178793070 21:35718157-35718179 CTGGCTCTCCCCCAGCTTCTGGG - Intronic
1179273505 21:39869626-39869648 CTGGCTGATCTCCAAGTTCCTGG + Intronic
1179496492 21:41775119-41775141 CTGGCTCCACTCCAAGCTCAAGG - Intergenic
1179769943 21:43607034-43607056 TTGGCTCTTCCCAAAGTGCTGGG - Intronic
1182037394 22:27210151-27210173 CCAGCTCTTGCCCAAGGTCATGG + Intergenic
1182737101 22:32538631-32538653 ATGGCTCTTTCCCAATGTCATGG + Intronic
1184602942 22:45554265-45554287 CATGCTCCTCCCCCAGTTCACGG + Intronic
949683286 3:6540601-6540623 CTGGTTCCTCCCCATCTTCATGG + Intergenic
950077914 3:10200251-10200273 CTGGCTCTGCCACAAATGCATGG - Intronic
950190909 3:10975464-10975486 CTGGCTCTGCCCCAACTTTAGGG + Intergenic
950456091 3:13093548-13093570 CTGCCTCCTCCCCAAGCTCAGGG + Intergenic
951795372 3:26533107-26533129 CTGGTTCTTCCTCATTTTCATGG + Intergenic
953020680 3:39111103-39111125 GTGGCTCTCCCCCAGTTTCAGGG - Intronic
954746981 3:52792920-52792942 CTGCCTCATCCCCAAGTGCCTGG - Intergenic
956489687 3:69757618-69757640 CTGGCTCTTCCCCAAGTTCAGGG - Intronic
959463054 3:106650622-106650644 CTGGGTCTTCTCCCAGTCCACGG + Intergenic
959506033 3:107157024-107157046 CTGGCTTTTCCTCATCTTCATGG - Intergenic
960391782 3:117085668-117085690 GTGGCTTTTACCCTAGTTCATGG + Intronic
961602584 3:128072876-128072898 CTGGCTCCTCCCCATGCACAGGG + Intronic
962951208 3:140220725-140220747 CTTTCTCTTCACTAAGTTCATGG - Intronic
965497384 3:169414412-169414434 CTGGTTTTTCCCCATCTTCATGG - Intronic
965866754 3:173214627-173214649 CTGGCTTTTCCCCAATTCCCTGG - Intergenic
966259198 3:177955365-177955387 CTGTCTCTTGCCCATGCTCATGG + Intergenic
966470481 3:180283390-180283412 CTGGCTTTGCCCCAGGATCAGGG + Intergenic
967092779 3:186149501-186149523 CTGCCTCTTCAGCAGGTTCACGG + Exonic
967158493 3:186714706-186714728 CTGGCTCTACCCTAAGTACAAGG - Intergenic
968512555 4:1002041-1002063 GCAGCTCTTCCCCAAGTTCGCGG + Exonic
969444144 4:7234574-7234596 CTGGATCTCCTCCAAGCTCAGGG - Intronic
969648199 4:8446216-8446238 CTGGCTCTTCCCTCAGGTCCTGG + Intronic
969874037 4:10122945-10122967 CATGCTCTCACCCAAGTTCAAGG + Intergenic
975369399 4:73567710-73567732 CTGGGTCTCACCCAAGTCCACGG + Intergenic
976256962 4:83109650-83109672 CTGGCTCTTCCCCAGTTGCAGGG + Intronic
976370919 4:84286963-84286985 CTGGCTTTTCCTCATCTTCATGG - Intergenic
976395026 4:84545982-84546004 CTGGTTTTTCCTCATGTTCATGG - Intergenic
977146401 4:93446322-93446344 CTGGCTAATCCCAAAGTTAAAGG + Intronic
977220058 4:94327729-94327751 CTGTCTCTTCCCCAAGGTTTGGG + Intronic
979217887 4:118187719-118187741 ATGGCTTTTTCCCAAGATCATGG - Intronic
985779329 5:1861778-1861800 CAGGCTCAGCCCCAAGTCCAGGG + Intergenic
986060923 5:4189064-4189086 CTTGCTCTTCCCCAAATCCGGGG + Intergenic
986157944 5:5195719-5195741 CTTGCATTTCCCCAAGTTTATGG + Intronic
986773783 5:10995814-10995836 CAGTCTCTTCCCCATGTCCATGG - Intronic
987656646 5:20815639-20815661 CTGGCTTTTCCTCATCTTCATGG - Intergenic
990283142 5:54273224-54273246 CTGGCTTTACCCCAAATTCATGG - Intronic
990837927 5:60042826-60042848 CTGGTTCCTCCCCATCTTCATGG - Intronic
992171250 5:74104146-74104168 ATTGCTCTTCCCAAAGTGCATGG + Intergenic
992719550 5:79547161-79547183 CTGGCTCCTCCCTAGGCTCAAGG - Intergenic
995731054 5:115242711-115242733 CTGCCTCCTCCCCAAGTGCTGGG - Intronic
997697858 5:135875375-135875397 CTGGATCTTTCCCAAGTTGGGGG - Intronic
1001307045 5:170582779-170582801 CTGGCTCTTCCCCAATTTGTAGG - Intronic
1002962412 6:1928042-1928064 CAAACTCTTCTCCAAGTTCAAGG - Intronic
1003482201 6:6544634-6544656 CTGGCTCTTCCACAAGTGTTGGG + Intergenic
1005883580 6:30077835-30077857 CTGGCTTATCCCCAACTCCAAGG + Intergenic
1006409568 6:33864711-33864733 CTGTCTCTTCCCCGAAGTCAGGG - Intergenic
1008344987 6:50415525-50415547 CTGTTTCTCCCACAAGTTCAAGG - Intergenic
1009945245 6:70335738-70335760 CTGGTTTTTCCCCATCTTCATGG + Intergenic
1012908741 6:105096153-105096175 CTGGCTCAGCACGAAGTTCAGGG + Intergenic
1013656535 6:112252782-112252804 CTGGCTTCTCCCCAAGTTTCTGG + Intronic
1013797444 6:113903581-113903603 CCACCTCTTCCCCAAGTGCAGGG + Intergenic
1015640372 6:135325688-135325710 CTTTCTCTTCCCCTAGTTCCAGG + Intronic
1016255730 6:142102946-142102968 ACAGCTCTTCCCCAAGATCATGG - Intergenic
1017657977 6:156648300-156648322 CTGGCTCTTCCCAAGGTGCTTGG - Intergenic
1019573438 7:1724787-1724809 CTGCCCCTTCCTCAAGGTCAAGG + Intronic
1022507984 7:30918626-30918648 CCTGCTCTTCCCCAAGGCCAGGG + Intronic
1022804411 7:33807444-33807466 CTGGCACTGCCCCCACTTCAGGG + Intergenic
1023563253 7:41497604-41497626 CTGTGTCCTCCCCAAATTCATGG + Intergenic
1024059740 7:45689048-45689070 CTGGATCTTCCCCACCTACAAGG - Intronic
1024214129 7:47232270-47232292 CAGGCCCTTCCCCAAGTCCTGGG - Intergenic
1024664789 7:51535871-51535893 CTGGCTTTTCCTCATCTTCATGG + Intergenic
1026652068 7:72224452-72224474 CTGGGTCTTCCTTTAGTTCACGG - Intronic
1027266643 7:76498389-76498411 CTGGCTCCTCCCCCAGGGCAGGG - Intronic
1027318024 7:76996507-76996529 CTGGCTCCTCCCCCAGGGCAGGG - Intergenic
1029483383 7:100825874-100825896 CTTCCTCTTCCCCTCGTTCATGG + Intronic
1030105215 7:105981576-105981598 CAGGATCTCCCCCAAGCTCATGG + Intronic
1030138102 7:106277844-106277866 GTGGCTCTTACCCAAGTTCATGG - Intronic
1031711121 7:125047327-125047349 CTGGCTTTTCCTCATCTTCATGG - Intergenic
1032054987 7:128677070-128677092 CTGACTCTTCTCCAATTTCCAGG - Intronic
1033309017 7:140246074-140246096 CTGGCTCAACTCCAAGTACAAGG - Intergenic
1033368664 7:140690104-140690126 CTGTTTTATCCCCAAGTTCATGG + Intronic
1034257563 7:149732994-149733016 CTGGCTGTTCCCCAAACTGATGG - Intronic
1035226205 7:157434122-157434144 CAGGCTCTACCAAAAGTTCAAGG + Intergenic
1035473082 7:159122986-159123008 CTGGGTCTTCCCCCAGTTGGAGG - Intronic
1035604416 8:920246-920268 CTGGCACTTACCCAAATTCTGGG + Intergenic
1036404802 8:8445268-8445290 CTAGCTCCTCCCCAAGCACACGG + Intergenic
1041141144 8:54820603-54820625 CTGTCCCTTCCCCAAGCACAAGG + Intergenic
1042965522 8:74347927-74347949 CTCAATTTTCCCCAAGTTCATGG + Intronic
1043108099 8:76140726-76140748 CTAGCTCTTCCTCAAAGTCAAGG + Intergenic
1043129614 8:76444886-76444908 GTGGATTTTCCCCAAGTTTAGGG + Intergenic
1044511225 8:93081565-93081587 ATGGCACTTCTCCAAGTACAGGG - Intergenic
1047033260 8:120907014-120907036 TTGCCTTTTGCCCAAGTTCATGG + Intergenic
1047495465 8:125405654-125405676 CTGGCTACTGCCCCAGTTCAGGG + Intergenic
1047874312 8:129118731-129118753 CTGGATATTCACCAAGTTCTTGG - Intergenic
1049509241 8:143019248-143019270 ATGGCTCATCCCCAGGCTCAGGG - Intronic
1050575094 9:6986603-6986625 CTGGGATTTCCCCAGGTTCAAGG - Exonic
1050929835 9:11308831-11308853 CAGGCTCTTCCCCACGCACAAGG - Intergenic
1050949126 9:11566224-11566246 CTGGGTCTTGCCCAAGGTCCAGG + Intergenic
1051752655 9:20359394-20359416 CTGGCTCTTCCCCATCTTCAGGG - Intronic
1053231335 9:36412577-36412599 CTCGCTCTTCACCAAGTGGATGG - Intronic
1055589418 9:77795721-77795743 CTGGCTCTTCCCTAATGCCAAGG + Intronic
1056042721 9:82685071-82685093 CTGGCTCCTCCCAAATCTCATGG + Intergenic
1056968097 9:91180710-91180732 CTGCCTCTTACTCAAGTTAATGG - Intergenic
1058420849 9:104831764-104831786 CTGGCTCATCAACAAGTCCATGG - Exonic
1058453578 9:105119017-105119039 GTGGCTCTGCCCCAAGCACAAGG + Intergenic
1060736833 9:126071422-126071444 CTGGCTGGCCCCTAAGTTCAGGG - Intergenic
1061887957 9:133602247-133602269 CTGGCTCTTTCCCACTTGCAGGG - Intergenic
1062277403 9:135737345-135737367 TTGGCTCTTCCGCAAGCTCAGGG + Intronic
1062457943 9:136648803-136648825 CAGGCTCTTCCCCAAGGTGCTGG + Intergenic
1186043321 X:5505408-5505430 CTGGCTTTTCCCAAAGTGCCGGG + Intergenic
1186599681 X:11023908-11023930 CTGGCTTTTCCTCATCTTCATGG + Intergenic
1186868499 X:13745756-13745778 CTGACTCTTCCCTTAGTCCATGG - Intronic
1188955524 X:36431564-36431586 CTGGGTCTTCAAAAAGTTCATGG - Intergenic
1192395046 X:70772008-70772030 TGGCCTCTTACCCAAGTTCATGG + Intronic
1192759088 X:74077167-74077189 CTGGCTTTTCCTCATCTTCAGGG + Intergenic
1195826296 X:109004373-109004395 CTGGCTTTTCCTCATCTTCATGG - Intergenic
1196150746 X:112370617-112370639 CTTGCTCTTCTCAAAATTCAGGG - Intergenic
1196735411 X:118977214-118977236 CCTGCTCTTCCCCAAGATCTGGG - Intronic
1199094592 X:143724501-143724523 CTGGCTTTTCCTCATCTTCATGG - Intergenic
1199893140 X:152108010-152108032 CTCTGTCTTCCCCATGTTCATGG + Intergenic
1199988609 X:152970647-152970669 TTGGCTCTTCCTTATGTTCAGGG + Intronic
1201465013 Y:14270634-14270656 CTGGTTTCTCCCCAACTTCATGG - Intergenic
1201892412 Y:18957014-18957036 CTGGCTTTTCCTCATCTTCATGG - Intergenic