ID: 956491592

View in Genome Browser
Species Human (GRCh38)
Location 3:69778053-69778075
Sequence CTGTGGAGATGGAGAGGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1377
Summary {0: 1, 1: 0, 2: 16, 3: 131, 4: 1229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956491581_956491592 24 Left 956491581 3:69778006-69778028 CCAATAAGGAGCAGTGTAGGCAA 0: 1
1: 0
2: 0
3: 8
4: 103
Right 956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG 0: 1
1: 0
2: 16
3: 131
4: 1229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956491592 Original CRISPR CTGTGGAGATGGAGAGGAGG TGG Intronic
900146142 1:1159608-1159630 CTGTGGACATGGAGAGTGGCGGG - Intergenic
900149029 1:1170263-1170285 CGGTGCTTATGGAGAGGAGGAGG - Intergenic
900170110 1:1263183-1263205 GTGTGGAGAAGCAGACGAGGAGG + Intronic
900544298 1:3219944-3219966 CTGGGGAGATGGCGAGGCTGCGG + Intronic
900562582 1:3314706-3314728 CTCAGGAGATGAGGAGGAGGGGG - Intronic
900606047 1:3524012-3524034 CTGTGGACATGGAGAGGCAGAGG - Intronic
900726932 1:4222669-4222691 CTGTGACGATGGAGTGCAGGAGG + Intergenic
900914840 1:5629558-5629580 CTGTGATGATGGAGTGGAGCTGG + Intergenic
900952618 1:5866320-5866342 CGGTGGCGGAGGAGAGGAGGAGG - Intronic
901150455 1:7097805-7097827 CTCTGGAGATGGAAAGTAGATGG + Intronic
901428328 1:9197680-9197702 GACTGGAGAGGGAGAGGAGGAGG - Intergenic
901479963 1:9518453-9518475 CTGCGAAGGTGCAGAGGAGGGGG + Intergenic
901668449 1:10839629-10839651 CTGTGGGGTGGGAGTGGAGGTGG + Intergenic
901879673 1:12186321-12186343 CTGTGAGGAAGGGGAGGAGGAGG + Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
902075462 1:13781001-13781023 AGGTGGAGAAGGAGAAGAGGAGG - Exonic
902376718 1:16033308-16033330 CTGGGGAGATGGGGAGGTGGGGG + Intronic
902467311 1:16626148-16626170 CTGGGGAGGGGGAGATGAGGAGG + Intergenic
902507274 1:16946596-16946618 CTGGGGAGGGGGAGATGAGGAGG - Intronic
902952081 1:19892957-19892979 ATGCTGAGATGGAGAGGTGGAGG - Intronic
903081180 1:20814778-20814800 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
903176706 1:21585851-21585873 CTGTGGAAATGGAGAGGGGAGGG + Intergenic
903519251 1:23934976-23934998 CTGTGGGGAGGGGGAGGGGGAGG - Intergenic
903539773 1:24090344-24090366 AAGTGGAGACAGAGAGGAGGAGG + Intronic
903574747 1:24332251-24332273 CTCAGGAGAGGGAGATGAGGTGG - Intronic
903651711 1:24926692-24926714 CTGTGGAGTTGGGGAGCAGAGGG + Intronic
903653580 1:24935383-24935405 CGCGGGAGGTGGAGAGGAGGTGG - Intronic
903674344 1:25054810-25054832 CTGGAGGGACGGAGAGGAGGGGG + Intergenic
903721496 1:25408877-25408899 GTGGGGAGATGGTGAGAAGGAGG + Intronic
903827058 1:26154022-26154044 TGGTGGAGGTGGAGAGGTGGTGG + Intergenic
903917559 1:26775179-26775201 CTGTGTTGAAGCAGAGGAGGCGG + Exonic
903999574 1:27331185-27331207 GTGTGGCCATGGAGAAGAGGGGG + Intronic
904077164 1:27852156-27852178 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
904784951 1:32975838-32975860 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
905070734 1:35223172-35223194 CTCTAGAGAAGGAGAGGAAGCGG - Intergenic
905120630 1:35679246-35679268 CTGTGGAGAGGCAGACCAGGAGG - Intergenic
905223699 1:36466201-36466223 CTATGGAGATTGGGAGGAGAGGG + Exonic
905305558 1:37015555-37015577 CTGTGGACATTGTCAGGAGGTGG - Intronic
905336312 1:37247110-37247132 CTGTGGAGATGAAAGGGTGGGGG - Intergenic
905521759 1:38605777-38605799 CAGGGGGGCTGGAGAGGAGGTGG - Intergenic
905807139 1:40885080-40885102 TTGTAGAGATGGAGTGGTGGGGG - Intergenic
906125440 1:43424409-43424431 CAGTGAGGATGGAGAGGAGCTGG - Exonic
906404261 1:45529058-45529080 TTGTGGAGATGGTGAAGGGGTGG - Intergenic
906472999 1:46146668-46146690 GTGTAGAGTTGGAGGGGAGGGGG - Intronic
906819485 1:48914127-48914149 CTGTGGAGAACGAGAAGAGAAGG + Intronic
906829227 1:49014114-49014136 ATGTGCACATGGAGAGAAGGGGG - Intronic
907304583 1:53506627-53506649 CTGTGTAGATGGAGGGGATGTGG + Exonic
907342063 1:53742248-53742270 TAGTGAGGATGGAGAGGAGGAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
907855686 1:58301220-58301242 ATGTGGGGGTGGAGAGGGGGGGG + Intronic
907901565 1:58746303-58746325 TGGTGGACATGGAGAGAAGGGGG - Intergenic
908241742 1:62194499-62194521 CTGTGGAGTTGGAGAGACGCCGG + Intergenic
908315487 1:62928079-62928101 CTGAGGAGATGAAGAAGAGGAGG + Intergenic
908816542 1:68041374-68041396 CTGTGGAGGAAGAGAAGAGGAGG - Intergenic
908838852 1:68257684-68257706 CAGTGGAGATGAAGAGAAGTTGG - Intergenic
909543648 1:76818900-76818922 CTATTAAGATGGAGAGGAGGAGG - Intergenic
909756055 1:79227442-79227464 TAGCGGTGATGGAGAGGAGGTGG - Intergenic
910089479 1:83445405-83445427 CAGTAAAAATGGAGAGGAGGAGG + Intergenic
910324198 1:85985808-85985830 CTGTGGAGACAGAAAGGAAGTGG + Intronic
910520083 1:88110891-88110913 CAGTGGAAATGGACAGGAAGTGG - Intergenic
910568361 1:88671834-88671856 CTGTGGATTTGGATACGAGGGGG + Intergenic
910598856 1:89008995-89009017 CTGAGAAGATGGAGAGGGAGAGG - Exonic
910693827 1:89991628-89991650 CAGTGGGGATGAAGAGGAGGGGG + Intergenic
910758088 1:90712112-90712134 GTGGGGAGATGGAGAGCAGAGGG + Exonic
911251905 1:95585895-95585917 AAATGAAGATGGAGAGGAGGGGG - Intergenic
911385991 1:97176350-97176372 CTATGGAGATGGAGAAGGTGTGG + Intronic
911486864 1:98513622-98513644 CTGTGGGGAGGGAGAGGGAGAGG + Intergenic
911593079 1:99770176-99770198 CAGTGGAGATGGAGAAGAGGGGG - Intergenic
911723517 1:101217274-101217296 CTGAGGAGATGGAGTGTAGAGGG + Intergenic
911968110 1:104393894-104393916 TTGTGTAGATGGAGAGTAGAAGG + Intergenic
912499078 1:110110027-110110049 CAGTGGGGATGCAGAGGAGGAGG + Intergenic
912552519 1:110493359-110493381 CAGAGGAGTTGGAGAGGAGTTGG - Intergenic
912582565 1:110734005-110734027 ATGGGGAGGTGGAGAGGAGAAGG + Intergenic
912717052 1:111990096-111990118 CAGTGGAGGAAGAGAGGAGGAGG + Intergenic
912764463 1:112396219-112396241 CTGTGGATGGGGAGTGGAGGCGG + Exonic
913242356 1:116840074-116840096 CTCAGGAGGTGGAGAGGTGGAGG + Intergenic
913993592 1:143637086-143637108 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
914230805 1:145763897-145763919 ATGGGGAGAGGGAGAGGGGGAGG - Intronic
914718850 1:150272729-150272751 CTTTGGAGGAGGAGGGGAGGCGG + Intronic
915095624 1:153460255-153460277 CTGTGGAGCTGGAGCTGGGGAGG + Intronic
915482402 1:156195868-156195890 GAGTAGAGGTGGAGAGGAGGAGG + Intronic
915491377 1:156251795-156251817 CAGAGCAGATGCAGAGGAGGGGG + Intronic
915527828 1:156487096-156487118 ACATGGAGATGGAGAGGATGGGG + Intronic
915727103 1:158025714-158025736 CAAAGGAGATGGAGAGGAGAGGG + Intronic
915940906 1:160117674-160117696 CAGTGGAGATGCAGGGGAGAAGG - Intronic
916029418 1:160863093-160863115 TTGTGGAGGTGGAGTGGAGAGGG + Intergenic
916177442 1:162054342-162054364 GTGTGGGGTGGGAGAGGAGGAGG + Intergenic
917231984 1:172847157-172847179 CTGTGAAGAAGGAAAGGAGAGGG + Intergenic
917859721 1:179134717-179134739 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
917963822 1:180166156-180166178 CTGGGGGGATGGCGAGGAGCAGG + Intronic
918113234 1:181476348-181476370 GTGTGGTGATGGACAGGTGGTGG + Intronic
918319940 1:183354802-183354824 CTGTGGTGATTGAGAGAAGTAGG - Intronic
918445049 1:184609124-184609146 CTCTGGAGAGGGAGAGGTGAGGG - Intronic
918475249 1:184917676-184917698 CTTTTGAGGTGGACAGGAGGAGG - Intronic
919023476 1:192137914-192137936 CTCTTCAGCTGGAGAGGAGGAGG + Intergenic
919087185 1:192934218-192934240 CTGAAGAGATGGAGTGGAGGTGG - Intergenic
919736299 1:200953917-200953939 CTTGGGAGATGAAGAGGTGGAGG - Intergenic
919935465 1:202247930-202247952 CTGAGGCGCTGGGGAGGAGGAGG - Intronic
920106298 1:203555901-203555923 CAGGAGAGACGGAGAGGAGGGGG + Intergenic
920212533 1:204338778-204338800 CTGTGGAAATGAAGGGGATGGGG + Intronic
920259361 1:204678523-204678545 GTCTGGAGCTGGTGAGGAGGGGG - Intronic
920679240 1:208060110-208060132 CTGTGGAGTTGGTGGGCAGGAGG - Intronic
920989473 1:210922878-210922900 ATGAGGAGGTGGAGAGTAGGTGG - Intronic
921060277 1:211579098-211579120 CTGAGGAGCTAGAGAGGCGGCGG + Intergenic
921189811 1:212699556-212699578 CTGCGGAGGTGCAGAGGTGGCGG - Intronic
921192604 1:212724200-212724222 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
922082163 1:222308047-222308069 GGGTGGGGATGGTGAGGAGGAGG - Intergenic
922345643 1:224694075-224694097 CTGTGGAGGAGGAGAGGAGAGGG + Intronic
922357004 1:224785960-224785982 TTGTGAACCTGGAGAGGAGGAGG + Intergenic
922468838 1:225862852-225862874 CTGTGGCCAGGGAGAGAAGGAGG + Intronic
922566617 1:226605582-226605604 CTGAGGGGATGGAGAAGAGATGG - Exonic
923399620 1:233603671-233603693 CTGTGGAGATGGCAAAAAGGTGG - Intergenic
923448837 1:234097657-234097679 CTGTGGGAATTAAGAGGAGGAGG + Intronic
923467442 1:234261951-234261973 CTGTGGAGATAGAAAGGTGAAGG - Intronic
923482327 1:234397196-234397218 CTGTGAAGGGGAAGAGGAGGAGG + Intronic
923716534 1:236429179-236429201 CTGTGCAGAGGGAGAGGGAGCGG + Intronic
923745191 1:236693587-236693609 CCGTGGTGTGGGAGAGGAGGAGG - Intronic
923893473 1:238241466-238241488 ATGTGGAAATGGAGAGAATGGGG + Intergenic
923918088 1:238530745-238530767 CTGTGGAGATGGTGTGGACCAGG - Intergenic
924133735 1:240940372-240940394 CTGTGGATCTGGAGACCAGGTGG - Intronic
924327320 1:242908965-242908987 AGGAGAAGATGGAGAGGAGGAGG - Intergenic
924527349 1:244864046-244864068 CGGCGGCGATGAAGAGGAGGAGG - Exonic
924692098 1:246362446-246362468 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
924734704 1:246745590-246745612 CTGTGGAGATGTGAAGGAAGAGG + Intronic
924793503 1:247274858-247274880 CTGTTGCAATGGAAAGGAGGGGG + Intergenic
924811022 1:247402160-247402182 CTGATGAGATGGAGAGGTGAAGG + Intergenic
1062916383 10:1243784-1243806 CAGTGGACATGGGCAGGAGGCGG - Intronic
1062960470 10:1569573-1569595 CTGATGAGCTGCAGAGGAGGAGG + Intronic
1063330018 10:5148232-5148254 CATAGGAGATAGAGAGGAGGAGG + Intergenic
1063590305 10:7388824-7388846 CTCTGCAGATGGAGTGGATGTGG + Intronic
1064325135 10:14343433-14343455 GAGGGGAGATGGAGAGGAGCTGG - Intronic
1064444644 10:15382764-15382786 CTGGGTAGATGGAGTGAAGGAGG - Intergenic
1064833072 10:19493191-19493213 TTATAGAGATGGAGAGGAGAAGG - Intronic
1065204553 10:23344346-23344368 GAGTGGAGAGGGGGAGGAGGAGG + Intronic
1065747677 10:28857176-28857198 GTGTGGTGATGGAGAGAAGTGGG - Intronic
1065866419 10:29919059-29919081 GGGAGGAGGTGGAGAGGAGGAGG - Intergenic
1066215165 10:33279433-33279455 CTCTGAAGATGGAGAGGATCTGG - Intronic
1066390750 10:34975949-34975971 GTGGGGAGATGGAGAGGGAGAGG - Intergenic
1067278478 10:44854104-44854126 CAGTGGGCATGCAGAGGAGGTGG - Intergenic
1067668778 10:48301040-48301062 AGGTGGAGATGGGGTGGAGGGGG + Intergenic
1067827226 10:49585594-49585616 GTGGGGAGATGGAGAGAAGTTGG + Intergenic
1067850373 10:49750512-49750534 CTGTGGACAAGGAGAGGTGGAGG - Intronic
1068229265 10:54149925-54149947 GTGTGGAGTTGGGGAGGAAGAGG + Intronic
1068795828 10:61078970-61078992 ATGTGGAGATGGAAATGAGTTGG + Intergenic
1069041422 10:63699476-63699498 GTGTGGAAGTGGAGAGGAGAGGG + Intergenic
1069052095 10:63805962-63805984 CTGTGGTGATAGAGGGGAGAAGG - Intergenic
1069635057 10:69919995-69920017 ATGTGGAGAAGGAAAGGATGTGG - Intronic
1069800520 10:71078870-71078892 CTTTGGACAAGGAGAGGATGTGG - Intergenic
1069893155 10:71664473-71664495 CCGTGGAGGTGGAGCGGAAGTGG - Intronic
1069930801 10:71880441-71880463 CTGGAGAGGTGGAGAGGTGGAGG - Intergenic
1070272965 10:74975875-74975897 CTGGGGAGAGGGAGAAGAAGTGG - Exonic
1070277567 10:75022063-75022085 CAGTGAAGAAGAAGAGGAGGAGG + Exonic
1070573986 10:77663318-77663340 CTGTGGAGGAGGGGAGAAGGTGG - Intergenic
1070642413 10:78179318-78179340 CTGGGGAGAAGGAGGGGAGAAGG + Intergenic
1070647570 10:78212389-78212411 CAGTGGAGCTGGAGAGCAGAAGG - Intergenic
1070846333 10:79525096-79525118 CTGTGGAGGGGCAGAGGAGGAGG - Intergenic
1070927464 10:80235210-80235232 CTGTGGAGGGGCAGAGGAGGAGG + Intergenic
1071292654 10:84198600-84198622 CTGTGGTGGTGGAGAGCAGGTGG - Intronic
1071468973 10:85965923-85965945 CTCTGGAGCTGGGGAGGAGGTGG - Intronic
1072076188 10:91976413-91976435 CTCTGGAGGTGGGGAGCAGGAGG + Intronic
1072422848 10:95304024-95304046 CAGTGGAGATGTAGAGCAGGCGG + Intergenic
1072956301 10:99891173-99891195 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1073094801 10:100972933-100972955 CTGTGAGGATGCTGAGGAGGAGG - Exonic
1073118728 10:101108364-101108386 CTCAGGATAGGGAGAGGAGGCGG - Intronic
1073215209 10:101832549-101832571 ATGTGTTGAAGGAGAGGAGGTGG - Intronic
1073324883 10:102636849-102636871 CTATGGAGAAACAGAGGAGGAGG + Intergenic
1073328844 10:102657900-102657922 CTGGGAAGATGGTGAGGAGAAGG - Exonic
1073541967 10:104322206-104322228 CTGTCTGGAAGGAGAGGAGGAGG - Intronic
1073693952 10:105844521-105844543 CTGTGAGAAGGGAGAGGAGGGGG - Intergenic
1074120798 10:110493294-110493316 CTGAGGAGCTGGGGAGGAGCTGG + Intergenic
1074256242 10:111805445-111805467 CTGTGGCCATGGAGAAGTGGTGG - Intergenic
1074432155 10:113403480-113403502 TTGTGGAAATGGGGAGGAAGTGG - Intergenic
1074490162 10:113932814-113932836 CTGTTGAGCTGAACAGGAGGTGG - Intergenic
1074923773 10:118046705-118046727 CTGAGGCGAGGGGGAGGAGGAGG - Intergenic
1074927556 10:118088753-118088775 CTTTGGAGATTCAGAGAAGGGGG - Intergenic
1074949239 10:118312893-118312915 CTGTGGGGCTGGGGAGGAGTTGG + Intronic
1075137377 10:119796065-119796087 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1075167850 10:120085327-120085349 CTATGGAGGTGGAGGGGAGGAGG + Intergenic
1075180513 10:120206936-120206958 CAGTGGAGCTGGAGGGAAGGAGG - Intergenic
1075345494 10:121679175-121679197 CTGGGGATAGAGAGAGGAGGGGG + Intergenic
1075407468 10:122204170-122204192 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1075492165 10:122880324-122880346 CTGTTTTGGTGGAGAGGAGGTGG - Intergenic
1075590323 10:123686583-123686605 CTGTAGAGCTGGCGAAGAGGAGG - Intronic
1075644170 10:124086678-124086700 CTATGGAGAGATAGAGGAGGAGG - Intronic
1075820381 10:125302958-125302980 TAGTGGAGATGAAGAAGAGGGGG - Intergenic
1075842615 10:125517752-125517774 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1075885881 10:125898606-125898628 CTGTAGCTAAGGAGAGGAGGAGG + Intronic
1075993651 10:126859368-126859390 TAGTGGAGATGAAGAGGAAGAGG - Intergenic
1076011926 10:126995671-126995693 CCGTGGAGAGGGAGAGGGAGAGG + Intronic
1076356510 10:129857486-129857508 CTGGGGAGATGGTTGGGAGGTGG - Intronic
1076439090 10:130467306-130467328 GTATAGAGATGGAGAGGAAGGGG + Intergenic
1076566886 10:131405014-131405036 CTGTGAGGATGCAGAGGACGGGG + Intergenic
1076914506 10:133415176-133415198 CCGTGGAGAGGGAGAGGGAGCGG + Intronic
1077044762 11:539860-539882 CTGTGGAGAAGGAGGGAAGTGGG + Intronic
1077475453 11:2788192-2788214 CTGTGGAGAAGGAGCCCAGGAGG - Intronic
1077528146 11:3081094-3081116 CTGGAGAGGTGGTGAGGAGGTGG + Intergenic
1077648110 11:3944453-3944475 CTGTGTAGTGGGAGTGGAGGGGG + Intronic
1077680598 11:4237161-4237183 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1077684876 11:4282559-4282581 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1077690314 11:4335371-4335393 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1077840340 11:5967726-5967748 CTGTGGTGAAGAAGAGGATGAGG + Exonic
1077881309 11:6352920-6352942 CTGGGAGGATGGTGAGGAGGAGG - Intergenic
1077957151 11:7032964-7032986 CTGTGGAGATGAGGTGGAGGGGG - Intronic
1078360519 11:10664290-10664312 GAGTGGAGATGAACAGGAGGCGG - Intronic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078625428 11:12951528-12951550 ATGAGGAGATGGCGAGAAGGAGG + Intergenic
1078779348 11:14422376-14422398 CTGTGGGGTGGGGGAGGAGGGGG - Intergenic
1079284568 11:19117242-19117264 CTGGGGAGATGGAGGGGCCGGGG + Exonic
1080015896 11:27506643-27506665 CTGTGTCGCTGGAGGGGAGGAGG - Intronic
1080049580 11:27845807-27845829 CTGTGGAGATTGAGAGAAAAAGG - Intergenic
1080056939 11:27916280-27916302 TAATGGAGATGGAAAGGAGGGGG + Intergenic
1080269330 11:30434260-30434282 CTGATGAGCTGAAGAGGAGGTGG + Intronic
1080329640 11:31120910-31120932 CCATGGGGATGAAGAGGAGGAGG + Intronic
1080517975 11:33040773-33040795 GTCTGGAGGGGGAGAGGAGGGGG - Intronic
1081646476 11:44793823-44793845 CTGAGGCCCTGGAGAGGAGGAGG + Intronic
1082269561 11:50155262-50155284 CTGAGGGGATGGGGAGGAAGGGG - Intergenic
1082703870 11:56468270-56468292 GGGTGGAGATTGGGAGGAGGGGG + Intergenic
1082738312 11:56882055-56882077 ATGGGGAGAAGGTGAGGAGGAGG + Intergenic
1083116445 11:60464249-60464271 TGGGGGAGATGGAGAGGGGGTGG - Intronic
1083130527 11:60621360-60621382 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1083612766 11:64011990-64012012 CAGTGGAGGTGGTGGGGAGGGGG - Intronic
1083725017 11:64623386-64623408 CCTTGGAGCTGGAGAGGAGAGGG - Intronic
1083735352 11:64677051-64677073 ATGGGGGGATGGGGAGGAGGGGG + Intronic
1083909468 11:65697597-65697619 CTCTGGAGTTTGGGAGGAGGTGG - Intergenic
1084043758 11:66557349-66557371 GGGTGGGGATGGACAGGAGGAGG - Intronic
1084101598 11:66953234-66953256 CTGCGGAGATGCAGAGAAAGCGG - Intronic
1084188678 11:67488995-67489017 CTGTGGTGGGGGTGAGGAGGGGG + Intronic
1084461614 11:69299459-69299481 CAGGGGAGATGCAGAGGAGGGGG + Intronic
1084466338 11:69325157-69325179 AGGTGGAGATGGTGAGGTGGTGG + Intronic
1084515133 11:69633911-69633933 CTGTGAAGATGCAGGGCAGGTGG + Intergenic
1084539360 11:69776442-69776464 CTGTGGGGATGCGGTGGAGGTGG - Intergenic
1084857029 11:71995989-71996011 CTGTGAGGAGGAAGAGGAGGGGG + Intronic
1084869921 11:72091457-72091479 CTGAGGAGGAGGAGAGGTGGGGG + Intronic
1085068649 11:73521534-73521556 TGGTGGAGATGGAGAGGTAGGGG + Intronic
1085097623 11:73774375-73774397 ATGGGGAGAGGGAGAGGGGGAGG - Intergenic
1085138918 11:74121884-74121906 CAGTGGAATTGGACAGGAGGTGG - Intronic
1085707583 11:78800487-78800509 ATGAGGAGGTGGGGAGGAGGTGG + Intronic
1086162641 11:83739835-83739857 CAGTGCAGCTGGAGAGGAGCTGG + Intronic
1086273394 11:85095593-85095615 CTGTGAAGAGGGATAGGAGCTGG - Intronic
1086341365 11:85852357-85852379 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087177605 11:95109756-95109778 CAGTGGTGATGGGGAGGAGAAGG - Intronic
1087464653 11:98489431-98489453 CTATGTAAATGGAGAGGATGAGG + Intergenic
1087653261 11:100892939-100892961 CACTGGAGATGGAGAACAGGTGG + Intronic
1087876488 11:103364780-103364802 CTGTGGAGACTGTGGGGAGGAGG - Intronic
1088044411 11:105430472-105430494 TTGGGGGGATGGAGAGGATGGGG - Intergenic
1088843260 11:113644281-113644303 CTGTGGGGGTGGGGAGGAGCTGG - Intergenic
1088919659 11:114251737-114251759 CAGTGGAGAGGAGGAGGAGGAGG + Intergenic
1089196433 11:116696351-116696373 CAGTGGAGAGGGCGGGGAGGTGG - Intergenic
1089289251 11:117427938-117427960 CTGGGGGGAAGGTGAGGAGGAGG + Exonic
1089436442 11:118472829-118472851 AGGTGGAGGTGGAGACGAGGAGG - Exonic
1089566939 11:119376575-119376597 CAGTGAAGATGGCCAGGAGGAGG - Intronic
1089570939 11:119409110-119409132 GTGGGAATATGGAGAGGAGGCGG - Intergenic
1089624249 11:119741370-119741392 GTGGGGAGGCGGAGAGGAGGTGG - Intergenic
1089723830 11:120455177-120455199 CTGAGGACATGGAGAAGAGATGG + Intronic
1090197149 11:124826485-124826507 ATGTGGAGATGTCCAGGAGGTGG - Intergenic
1090351259 11:126110037-126110059 CTGTGGTGTGAGAGAGGAGGAGG - Intergenic
1090531239 11:127593064-127593086 TTGATGAAATGGAGAGGAGGAGG + Intergenic
1090632902 11:128665986-128666008 CTTTGGAGTTAGAAAGGAGGTGG - Intergenic
1090791691 11:130095522-130095544 ATGTGGAGATAAAGAGCAGGTGG + Intronic
1091078254 11:132641326-132641348 CTCTGGGCAAGGAGAGGAGGTGG - Intronic
1091121312 11:133060219-133060241 CTGAGGGGATGGGGAGAAGGAGG - Intronic
1091340352 11:134807405-134807427 CACTGGAGATAGAGAGGAGGAGG + Intergenic
1091624733 12:2113295-2113317 CTGTGGGGACGGGGTGGAGGTGG + Intronic
1091778539 12:3199982-3200004 CTGGGGAGAAGGACTGGAGGGGG - Intronic
1091789092 12:3261029-3261051 TTGTGGTGACAGAGAGGAGGTGG + Intronic
1091847152 12:3666076-3666098 CTCTGGTGGTGGGGAGGAGGGGG + Intronic
1092229871 12:6770369-6770391 CTGTGGAGAGGGAGAGAATGGGG - Intronic
1092264382 12:6969970-6969992 CTGTGGTCGTGGAGAGGAGCAGG - Intronic
1093688430 12:22082723-22082745 TTGTGGAGAGAGAGAGGAGATGG - Intronic
1093711279 12:22333026-22333048 CTGGGGAGGTGGAGAGGAAGGGG + Intronic
1093927477 12:24923350-24923372 CTGTGCAGAAGCAGAGGACGGGG + Intronic
1093927667 12:24925573-24925595 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1094083738 12:26566041-26566063 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094083745 12:26566079-26566101 GAGAGGAGATGGAGAGGAGAAGG + Intronic
1094525780 12:31229718-31229740 CAGTGGGGCTGGAGAGGCGGTGG - Intergenic
1094556648 12:31506982-31507004 CTCTGGAGAGGGAAAGGAGTTGG - Intronic
1095068999 12:37815893-37815915 CCGTGGAGACGGAGAGGGAGAGG + Intergenic
1095370859 12:41465731-41465753 CAGTGGAGATGAAGAGGAGCAGG + Intronic
1096134529 12:49188562-49188584 CTGGGGACCGGGAGAGGAGGAGG - Intronic
1096389359 12:51217359-51217381 CTCTGGACCTGGAGCGGAGGGGG - Intronic
1096427965 12:51520346-51520368 CAATGGTGATGGAGAGGAAGAGG + Intergenic
1096561271 12:52437670-52437692 CTGTGGAGGAGGAGAGGAAGTGG + Intergenic
1096693024 12:53332850-53332872 CTGGGCAGAGGGAGAGGGGGCGG - Intronic
1096717175 12:53498700-53498722 CAGAGGAGATGGAGAGAAAGAGG + Intronic
1096800204 12:54105637-54105659 CTGTGGGGATGCAGAGTAGTAGG - Intergenic
1096886159 12:54721350-54721372 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096886182 12:54721434-54721456 CTGAGGAGGAGGAGGGGAGGAGG - Intergenic
1096979355 12:55719476-55719498 CTGGGAAGGGGGAGAGGAGGTGG - Intronic
1097021173 12:56021664-56021686 CTGAGGAGATGGAGAGGATGGGG + Intronic
1097028717 12:56076732-56076754 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1097296009 12:57963763-57963785 TTGTGGGGAAGAAGAGGAGGAGG + Intergenic
1097669237 12:62516280-62516302 TGGTGGAGATGGGGAGCAGGGGG + Intronic
1098645697 12:72898041-72898063 CTGTAGACGAGGAGAGGAGGTGG + Intergenic
1098666395 12:73168923-73168945 TTGTGGTGCTGGAGAGGATGTGG + Intergenic
1098948678 12:76616455-76616477 CTGGAGAGATGGAATGGAGGGGG + Intergenic
1099080200 12:78169153-78169175 CAGTGGAGATGGAGATGGAGTGG + Intronic
1099159140 12:79218524-79218546 CTGTGGTGATTGTGGGGAGGTGG - Intronic
1100056087 12:90511547-90511569 CTATGTAGATGGAGTGGAAGAGG + Intergenic
1100569749 12:95836956-95836978 GGGAGGAGATGGAGAGGAGAGGG + Intergenic
1101006620 12:100406959-100406981 CAATGGAGATGGAGAGAGGGGGG + Intronic
1101037030 12:100716623-100716645 CTGAGGAGAGGGAAAGGAGTGGG - Intergenic
1101323955 12:103698284-103698306 CTGTGGGGAAGGAGAGGAGAAGG - Intronic
1101444634 12:104728838-104728860 GTGTGGAGATGGACAGAAAGGGG + Intronic
1101445601 12:104734824-104734846 ATATGGAGATCCAGAGGAGGAGG + Intronic
1101728924 12:107410615-107410637 CAGTGGAGATGGGGAGGACTTGG + Intronic
1101885014 12:108655369-108655391 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1102172585 12:110853381-110853403 TGGGGGAGATGGAGAGGAGTGGG - Intronic
1102317429 12:111900572-111900594 CTGTGGAAATGGTGTGGTGGAGG + Intergenic
1102563396 12:113778875-113778897 AGGAGGAGATGGGGAGGAGGAGG - Intergenic
1102590186 12:113950890-113950912 GTGTGGCCATGGAGAGGGGGAGG - Intronic
1102749180 12:115277268-115277290 CGGGGGAGAAGGAGAGGGGGAGG + Intergenic
1102805381 12:115774993-115775015 CTGTGGATATGGATGGGAGAAGG - Intergenic
1102914163 12:116740383-116740405 CTCTGGAGACGAAGAGGAGGGGG + Exonic
1103099298 12:118158597-118158619 TAATGGAGATGGAGAGGAGTGGG - Intronic
1103781581 12:123402319-123402341 GAATGGAGATGGAGAGGAGGTGG + Intronic
1103919619 12:124392698-124392720 CAGTGGACATGTAGTGGAGGAGG + Intronic
1104489443 12:129181325-129181347 AAGTAGAGATGGAGAGAAGGAGG - Intronic
1104590556 12:130081259-130081281 CTGGGGAGGTGGGGAGGATGTGG - Intergenic
1104636533 12:130440975-130440997 CTGGGGAGATGGTAGGGAGGTGG - Intronic
1104649705 12:130522699-130522721 CTGTGCGCAGGGAGAGGAGGAGG + Intronic
1104726783 12:131082704-131082726 GGGTGGGGAGGGAGAGGAGGAGG + Intronic
1105070403 12:133231134-133231156 CAGTGGAGATGGAGGGCAGGTGG - Intronic
1105334804 13:19457520-19457542 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105356620 13:19664948-19664970 GTGGGGAGAAGCAGAGGAGGAGG + Intronic
1105835081 13:24203127-24203149 CTGTGGGGAGGGAGGGGATGGGG - Intronic
1105860114 13:24401871-24401893 CTGTGGGGAGGGAGGGGATGGGG + Intergenic
1105959060 13:25312272-25312294 CTGCTGAGAGGGAAAGGAGGAGG + Intronic
1105968399 13:25405192-25405214 CAGTGCAGAAGGAGAAGAGGAGG + Intronic
1106140117 13:27005070-27005092 GTGGGGTGATGGGGAGGAGGCGG - Intergenic
1106160413 13:27196325-27196347 CTGGGGAGTGGGAGAGGAGCAGG - Intergenic
1106254209 13:28007985-28008007 AGGTGGAGAGAGAGAGGAGGAGG - Intronic
1106560379 13:30840578-30840600 CCGTGGAGACGGAGAGGGAGAGG + Intergenic
1107185295 13:37511218-37511240 CTGTGGTGATGGTGATGGGGTGG - Intergenic
1108165774 13:47691833-47691855 GTGTGAAGATGGAGAAGAGAGGG - Intergenic
1108166563 13:47699423-47699445 CTGTGGAAAGGGAGAGGAAGAGG - Intergenic
1108664404 13:52615536-52615558 GTGGGGAGTTGGAGGGGAGGTGG + Intergenic
1108723138 13:53152229-53152251 GAGTGGGGATGGAAAGGAGGGGG + Intergenic
1109253737 13:60052043-60052065 AGGTGCAGATGCAGAGGAGGGGG + Intronic
1110179289 13:72595857-72595879 ATGATGAGGTGGAGAGGAGGGGG + Intergenic
1110505482 13:76280940-76280962 CTGTGGAAATGAAGAGAAAGAGG - Intergenic
1111388420 13:87561001-87561023 CCGTGGAGAGGGAGAGGTAGAGG - Intergenic
1111388427 13:87561028-87561050 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1111388435 13:87561055-87561077 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1111628739 13:90823003-90823025 CTATGGAGATGGAGAGTAGAAGG - Intergenic
1111900056 13:94189264-94189286 CTTTGGGGGTGGACAGGAGGAGG + Intronic
1112724029 13:102281428-102281450 CTGTGAGGAGGGAGATGAGGTGG - Intronic
1113281893 13:108797410-108797432 CCATGGAGATGAAGAAGAGGAGG + Intronic
1113326824 13:109290384-109290406 CTGAGGAGAGGTACAGGAGGGGG + Intergenic
1113406563 13:110046316-110046338 CTGTGGAGAGGGGGAGTAGGAGG + Intergenic
1113574186 13:111382582-111382604 CTGTGGTGATGGAGGTGGGGTGG + Intergenic
1113798657 13:113075122-113075144 CTGCGGAGATCGCAAGGAGGAGG + Exonic
1113939451 13:114010756-114010778 GTGGGGAGGTGGGGAGGAGGGGG + Intronic
1114429202 14:22645902-22645924 CAGTGGGGCTGGAGAGGGGGTGG - Intergenic
1114476606 14:22999449-22999471 CAGTAAAGATGGTGAGGAGGAGG - Intronic
1114556488 14:23565309-23565331 CTGTGGAGGTGAGGAGGTGGGGG - Intronic
1114578589 14:23736315-23736337 CTGTGGAGAGGGAGACGGAGAGG - Intergenic
1114624388 14:24119356-24119378 CTGGGGAAATGGAGAGCAAGGGG - Intronic
1114637501 14:24195978-24196000 CCGGGGAGATGGAGCGCAGGCGG + Intronic
1114794081 14:25692667-25692689 TTGTGAAGATGGAGAGCAAGGGG + Intergenic
1115502430 14:34061153-34061175 TCGTGGAGAGGGAGACGAGGTGG + Intronic
1115535558 14:34369697-34369719 AGGAGGAGAAGGAGAGGAGGAGG - Intronic
1116430738 14:44842538-44842560 GTGTGGAGATGGGAAAGAGGAGG - Intergenic
1116583258 14:46669729-46669751 CTGTTGAGAGAGAGAGGAGGGGG - Intergenic
1117182677 14:53208170-53208192 CTGTGTAGATACAGAGGAGTGGG - Intergenic
1117251661 14:53946104-53946126 CTTTGGAGAGGGAGTGGGGGCGG + Intergenic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1117705514 14:58463216-58463238 GTGAGGAGATGGAGAGGAACAGG - Intronic
1117987086 14:61397143-61397165 ATGTAGGGGTGGAGAGGAGGGGG + Intronic
1118227956 14:63920714-63920736 CCGTGGAGATGGAGAGAAATAGG + Intronic
1118347834 14:64952491-64952513 CTGGTGAGCTGGGGAGGAGGAGG - Exonic
1118517909 14:66546784-66546806 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1118584532 14:67340682-67340704 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1119203453 14:72776497-72776519 CTGTGGAGATGGACTCCAGGGGG + Intronic
1119409533 14:74421737-74421759 CTTTGGAGAGAGAGAAGAGGAGG + Intronic
1119481905 14:74963253-74963275 CTGTGAAAAGGGAGAGGAGATGG + Intergenic
1119562595 14:75603056-75603078 ATGTGGAGATGGAGGGGAGGTGG - Intronic
1119727806 14:76932730-76932752 GTGAGGAGGTGGAGAAGAGGAGG - Intergenic
1119835572 14:77746927-77746949 CCGTGGAGAGGGAGAGGGAGAGG - Intronic
1120138676 14:80901763-80901785 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1120613319 14:86670322-86670344 CTTGGGAGATGGAGCTGAGGAGG - Intergenic
1120904651 14:89609808-89609830 TTGTGGAGATGAACAGGAGGTGG + Intronic
1121095613 14:91216162-91216184 CTCTTGAGGTGGAGAGCAGGAGG + Intronic
1121225722 14:92320495-92320517 CTGTGGGGTTGGGGAGGGGGCGG + Intergenic
1121504480 14:94466115-94466137 CTGGGGATAGGAAGAGGAGGTGG - Intronic
1121522845 14:94598258-94598280 CTGTGGAGATGGAGAGTGGGTGG + Intronic
1121554381 14:94825214-94825236 CTGTGGAAATGGAGTGCAGTGGG + Intergenic
1121571797 14:94951835-94951857 CTCTGGAAATGCAGATGAGGGGG - Intergenic
1122123178 14:99565384-99565406 ATGTGGAGAAGGGAAGGAGGAGG + Intronic
1122606048 14:102948228-102948250 GTGTGGAGGTGGAGGGGAGTCGG + Intronic
1122606215 14:102948623-102948645 CTGTGGAGAGGGGGAGTGGGGGG + Intronic
1122629156 14:103099438-103099460 TGGTGGAGAGGGAGAGGAGTGGG + Intergenic
1122887228 14:104715507-104715529 CTGCGGAGAGGGAGGGGATGGGG - Intronic
1123023479 14:105412762-105412784 CTGTGGAGGTGGCTAGGTGGAGG + Exonic
1123067737 14:105626913-105626935 CTCTGGAGAGAGGGAGGAGGTGG - Intergenic
1123068722 14:105630707-105630729 CTCTGGAGAGAGAGAGGAGCTGG + Intergenic
1123071756 14:105645638-105645660 CTCTGGAGAGAGGGAGGAGGTGG - Intergenic
1123091420 14:105743914-105743936 CTCTGGAGAGAGGGAGGAGGTGG - Intergenic
1123097190 14:105772255-105772277 CTCTGGAGAGAGGGAGGAGGTGG - Intergenic
1123122612 14:105924952-105924974 CTGTGCAGATGGAAAGGCTGAGG + Intronic
1123685525 15:22794593-22794615 CTGTGGAGATGTGGAGGGGAAGG + Intronic
1123992864 15:25696341-25696363 GTGTGGAGATGGATAGGAGAGGG + Intronic
1124485783 15:30114396-30114418 CTGTGGAGATGGTGTGGGAGTGG + Intergenic
1124517792 15:30382872-30382894 CTGTGGAGATGGTGTGGGAGTGG - Intronic
1124540861 15:30583382-30583404 CTGTGGAGATGGTGTGGGAGTGG + Intergenic
1124547548 15:30645118-30645140 CTGTGGAGATGGTGTGGGAGTGG + Intronic
1124757797 15:32424198-32424220 CTGTGGAGATGGTGTGGGAGTGG - Intergenic
1125241927 15:37585953-37585975 GTTTGGAGATGGAGAGTAGTGGG - Intergenic
1125329142 15:38565015-38565037 CAGGGGAGTTGGAGAGGAGCGGG + Intronic
1125466696 15:39960358-39960380 CAGGGGAGATAGAGAGGAGAAGG + Intronic
1125589893 15:40847540-40847562 CTGGGGAGGAGGAGAGGTGGGGG - Intronic
1125705251 15:41729273-41729295 TGATGGAGATGGGGAGGAGGAGG - Exonic
1125715649 15:41818449-41818471 CTGTTGGGATGGAGAGGACTTGG + Intronic
1126142297 15:45448435-45448457 CTGCTGGGATGTAGAGGAGGGGG + Intronic
1126365440 15:47889507-47889529 CTGTGGAGATAGAGAGTAGAAGG + Intergenic
1126669596 15:51104215-51104237 CCGTGGAGATGGAAAGGAAAGGG - Intronic
1126689656 15:51279420-51279442 CTTTGTAGATGGAGATGTGGGGG - Intronic
1126736666 15:51737692-51737714 CTGTGAAGAGGAAGAGGCGGCGG - Exonic
1126859491 15:52870293-52870315 GTATGGTGATGGAGAGAAGGGGG + Intergenic
1127002791 15:54529720-54529742 GTGTGGAGGAGGAGAGGAGTGGG + Intronic
1127368135 15:58310358-58310380 CTGTGTGGAGTGAGAGGAGGAGG + Intronic
1127478630 15:59357818-59357840 CTGACGGGATGGAGAGGGGGAGG + Intronic
1127613189 15:60657241-60657263 ATGGGGAGAGGGAGAGGAGGAGG - Intronic
1127815688 15:62606981-62607003 TGGTGGTGATGGTGAGGAGGAGG - Intronic
1128037887 15:64542750-64542772 AAGTGGGGATGGAGAGAAGGAGG - Intronic
1128244447 15:66123649-66123671 ATGGGGAGATGGGGAGGTGGTGG - Intronic
1128322144 15:66701579-66701601 GTGGGGAGATGGAGAGGGTGGGG - Intergenic
1128375873 15:67075428-67075450 CTGGGGAGCAGGAGAGGGGGAGG + Intronic
1128757102 15:70190508-70190530 CTGTGGAGATGGCGGGACGGGGG + Intergenic
1128843888 15:70872405-70872427 TAGGGGAGAGGGAGAGGAGGAGG + Intronic
1128990688 15:72257362-72257384 GTCTGGAGCTGCAGAGGAGGTGG - Exonic
1129119965 15:73390244-73390266 CTAGGATGATGGAGAGGAGGAGG - Intergenic
1129163000 15:73757660-73757682 CTGTGGCCATGGAGGGGAAGTGG + Intergenic
1129190029 15:73931733-73931755 CTGTGGAGGTGGGGTGGAGCAGG - Intronic
1129236197 15:74225171-74225193 GGGGGGAGATGGAGAGGAAGGGG + Intergenic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129654472 15:77514882-77514904 CTGTGGGGATGCAGAGCAGCAGG + Intergenic
1129669242 15:77598001-77598023 CTAGGGAGATGGAAAGGAGCTGG + Intergenic
1129890754 15:79070206-79070228 CTTTGGAGATGGAGAGCACATGG + Intronic
1129954737 15:79625512-79625534 CAGAGGAGATGGTGAGGATGGGG + Intergenic
1130013772 15:80172270-80172292 CTGTAGAGATGACGGGGAGGAGG + Intronic
1130367659 15:83254676-83254698 CTGTGAATATGGAGAGTTGGTGG + Intergenic
1130539494 15:84811941-84811963 CTGTGGGGAAGGAGGGAAGGAGG + Intergenic
1130826137 15:87548111-87548133 CTGAGGAGATGGGGAGAAGATGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1130985717 15:88843289-88843311 CTCTGGGGATGCAGAGCAGGGGG + Intronic
1131413619 15:92232342-92232364 CTGTGGAAAAGGACAGAAGGAGG + Intergenic
1131545828 15:93314754-93314776 AGGTGGAGATGGTGAGAAGGTGG + Intergenic
1131673632 15:94648681-94648703 CTGTGTTGATGGAGAGGTGAAGG - Intergenic
1131709135 15:95033821-95033843 CAGTAGAGAGGAAGAGGAGGAGG - Intergenic
1132045709 15:98561409-98561431 CTCTGAAGATGGAAAGGATGTGG - Intergenic
1132107146 15:99071202-99071224 GTGTGGAGCAGGTGAGGAGGCGG + Intergenic
1132302766 15:100786805-100786827 ATGTGGATATGGAGAGAGGGCGG + Intergenic
1132532768 16:461522-461544 CTGAGGAACGGGAGAGGAGGTGG - Intronic
1132595269 16:746265-746287 CTGGGCAGCAGGAGAGGAGGTGG + Intronic
1132595280 16:746309-746331 CTGGGCAGCAGGAGAGGAGGTGG + Intronic
1132595313 16:746440-746462 CTGGGCAGCAGGAGAGGAGGTGG + Intronic
1132595344 16:746572-746594 CTGGGCAGCAGGAGAGGAGGTGG + Intronic
1132595379 16:746706-746728 CTGGGCAGCAGGAGAGGAGGTGG + Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1132922003 16:2400773-2400795 CCGTGGGGAGGGGGAGGAGGAGG + Intergenic
1133164596 16:3937680-3937702 CTCTGGAGATGGAGCTGGGGTGG + Intergenic
1133334678 16:4999434-4999456 TTGTGGAGATGTGGTGGAGGGGG - Intronic
1133395829 16:5446751-5446773 CGGTGGGGATGGACAGGAGGAGG - Intergenic
1134013783 16:10874427-10874449 GTGTGGGGATGGAGAGGGAGGGG - Intergenic
1134112530 16:11524234-11524256 GTGGGTAGATGGATAGGAGGGGG - Intergenic
1134235076 16:12459134-12459156 AAGTGGAGAGGGGGAGGAGGGGG - Intronic
1134690567 16:16188687-16188709 GTGTGGAGCTGGAAAAGAGGCGG - Intronic
1135180077 16:20265277-20265299 GGGTGGAGAGGGGGAGGAGGGGG - Intergenic
1135305782 16:21366564-21366586 CTGTGGAGTTGGCAAGGATGTGG - Intergenic
1135556028 16:23437319-23437341 GAGTGGGGATGGAGAGGTGGTGG - Intronic
1135609019 16:23848595-23848617 CAGTGGAGAGGGAGAGGGAGTGG - Intronic
1135698601 16:24611679-24611701 CAGTGGAGATGGACAGGGAGAGG + Intergenic
1135711988 16:24725523-24725545 CTGGGGAGGGGGAGAGGAGGGGG - Intergenic
1135985254 16:27179248-27179270 CTGTGGAGATGGGAAGATGGAGG + Intergenic
1136102458 16:28006075-28006097 CTCTGAAGATGGAGAAGACGGGG + Intronic
1136155010 16:28376714-28376736 CTGTGGGGAGGGAGAGGGAGAGG - Intergenic
1136160249 16:28415170-28415192 CAGTGGAGAGGGCGGGGAGGGGG - Intergenic
1136202839 16:28700120-28700142 CAGTGGAGAGGGCGGGGAGGGGG + Intronic
1136208082 16:28738548-28738570 CTGTGGGGAGGGAGAGGGAGAGG + Intergenic
1136302526 16:29345718-29345740 CTGTGGAGTTGGCAAGGATGTGG - Intergenic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1136452347 16:30360448-30360470 CTGTGGAGGTGGAGAGGAGCAGG - Intronic
1136532729 16:30880580-30880602 CTGGGGAGTTGGAGATGAGAAGG + Intronic
1136548935 16:30971544-30971566 CTCTGAAGATGAAGAGGAAGAGG + Exonic
1136554836 16:31001573-31001595 CAGTGATGATGAAGAGGAGGTGG - Exonic
1136566215 16:31072386-31072408 TTGTGGAGTTGGAAAGGTGGAGG - Intronic
1137281036 16:46976899-46976921 GGGTTGGGATGGAGAGGAGGTGG + Intergenic
1137571408 16:49568606-49568628 CTGTGGGGCAGGAGAGCAGGCGG - Intronic
1137658444 16:50181812-50181834 CAGAGGTGATGGAGATGAGGTGG + Intronic
1137875271 16:51990708-51990730 CTCAGGAGATGGAGGGTAGGAGG - Intergenic
1138217203 16:55214656-55214678 AGAAGGAGATGGAGAGGAGGGGG + Intergenic
1138521568 16:57574375-57574397 CTGCAGAGATGGTGATGAGGTGG + Intronic
1138534753 16:57653945-57653967 CGGTGGTGATGGTGGGGAGGGGG - Intronic
1138562105 16:57807416-57807438 CAGTGGGCATGGAGAGGTGGTGG + Intronic
1139374368 16:66487582-66487604 CTCTGCAGAGGGTGAGGAGGAGG - Intronic
1139422298 16:66856168-66856190 TTGAGGAGATGGTGAGGAGAGGG + Intronic
1139670138 16:68487277-68487299 CTGGGGACATGGAGAGTGGGTGG - Intergenic
1139778064 16:69329674-69329696 CGGTGGAGTTGGAGAAGTGGGGG - Intronic
1140210110 16:72962864-72962886 GGATGGAGATGGAGAAGAGGGGG + Intronic
1140302510 16:73772123-73772145 CTGTGGCGAGGGGGTGGAGGTGG - Intergenic
1140302667 16:73773390-73773412 CAGTGGAGATGGAGAACAGATGG + Intergenic
1140930040 16:79618948-79618970 CAGAGGAGACAGAGAGGAGGCGG - Intergenic
1141660428 16:85438354-85438376 CTCTGGGGAGGGACAGGAGGCGG + Intergenic
1141680071 16:85538653-85538675 CTGTGGGGAGGAAGTGGAGGAGG + Intergenic
1141816163 16:86410594-86410616 GAGTGGAGATGGTGAGTAGGTGG + Intergenic
1141909009 16:87045793-87045815 CTGGGGAGATGGGTAGGAGATGG - Intergenic
1142006578 16:87692212-87692234 CTGTGGGGAGGGAGACGGGGAGG - Intronic
1142014947 16:87740427-87740449 CTCTGGAGCAGGAGGGGAGGCGG - Intronic
1142188291 16:88705302-88705324 CTGAGGTGGTGGAGTGGAGGGGG - Intronic
1142313181 16:89326041-89326063 CTGTGAAGACGAAGGGGAGGAGG + Intronic
1142317913 16:89360739-89360761 ATGTGGCTATGGAGAGGAAGAGG + Intronic
1142613169 17:1120206-1120228 CTGTGATGAGGGGGAGGAGGAGG + Intronic
1142706395 17:1697688-1697710 CTGGGGAGATGGAGGAGATGGGG - Intergenic
1143058404 17:4179819-4179841 CAATGGAGAAGGAGAGGAAGAGG - Exonic
1143141286 17:4743282-4743304 CTCTGGAGAAGGAGAAGGGGAGG - Exonic
1143296638 17:5876269-5876291 CACTGGGGATGGGGAGGAGGGGG + Intronic
1143352167 17:6296999-6297021 TAGTAGAGATGGGGAGGAGGTGG - Intergenic
1143399893 17:6637303-6637325 CTGTGGAGAAGGAGACACGGTGG - Intronic
1143594690 17:7907270-7907292 CTGTGGAGCGGGAGGGGAGGGGG + Intronic
1143620090 17:8075747-8075769 CTGAGGAGTGGGAGGGGAGGAGG - Intronic
1143683051 17:8491924-8491946 GTGGGGACCTGGAGAGGAGGAGG - Intronic
1144064317 17:11611082-11611104 GTGAGGAAATGGGGAGGAGGAGG - Intronic
1144674691 17:17154237-17154259 CTTTGGAGATGGAGGGCAGCAGG + Intronic
1145084511 17:19925450-19925472 TTGTGGAGGTGGGGAGTAGGAGG - Intronic
1146351856 17:32101933-32101955 ATGTAGAGATGTAGGGGAGGAGG + Intergenic
1146530546 17:33604341-33604363 GAGTGGACATGGAGAGCAGGTGG + Intronic
1146700980 17:34960079-34960101 CAGTGGAGATGGAGAGAAGGTGG - Intronic
1147210892 17:38871779-38871801 CTGGGCAGGAGGAGAGGAGGGGG + Intronic
1147259234 17:39198747-39198769 CTGTGGAGCAGGAGAAGGGGTGG - Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147918183 17:43900830-43900852 CGGTGGGGATGGGGAGGAGGCGG + Intronic
1148193686 17:45698205-45698227 TTGGGGAGATGGAGATGGGGAGG + Intergenic
1148325687 17:46782279-46782301 CTGCTGAGAGGGAGAGGAGGAGG + Intronic
1148393424 17:47289966-47289988 TTGTGGTGGTGGAGGGGAGGTGG + Intronic
1148395785 17:47307137-47307159 GGGTGGAGACGGGGAGGAGGTGG - Intronic
1148475903 17:47928299-47928321 CTGGGCACATGGAGTGGAGGTGG - Exonic
1148533285 17:48415844-48415866 GCTTGGAGTTGGAGAGGAGGGGG + Intronic
1148554004 17:48566993-48567015 CACTGGAGATTGTGAGGAGGTGG - Intronic
1148749336 17:49935588-49935610 CTGTGGAGCTGGACAGCCGGGGG + Intergenic
1148758906 17:49989378-49989400 CTTTGGAGACGGAGAGCTGGAGG - Intergenic
1148768444 17:50053183-50053205 CTGGGGAGATGGAGTGGGAGTGG - Intergenic
1149114612 17:53077606-53077628 CTGTGGAAATTGTGAGGGGGTGG + Intergenic
1149306084 17:55347726-55347748 CTGGGGGGCTGGAGAGGAGTGGG - Intergenic
1149476231 17:56963344-56963366 CTATGTAAATGGAGAGGATGAGG - Intergenic
1149869257 17:60168077-60168099 ATGTAGAGATGTAGGGGAGGAGG + Intronic
1150120728 17:62599540-62599562 TTGCGGGGAGGGAGAGGAGGTGG - Intronic
1150569112 17:66370153-66370175 CTGTGGAGGTTGAGGGGATGTGG - Intronic
1150703271 17:67466180-67466202 CTGTAGAGATGGTGGGGTGGGGG + Intronic
1150716046 17:67573367-67573389 CTGTAGGGAAGGAGTGGAGGAGG + Intronic
1150935928 17:69635694-69635716 CTGTGGAGATGGACAGAAAAGGG + Intergenic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1151349917 17:73525613-73525635 CTGAGAAGAGGCAGAGGAGGTGG - Intronic
1151683479 17:75633860-75633882 TCGGGGAGAGGGAGAGGAGGAGG + Intronic
1152295324 17:79463928-79463950 CAGTGGCGATGGTGGGGAGGTGG - Intronic
1152441632 17:80313407-80313429 CTGTGGTGATGGAGGTGTGGAGG + Intronic
1152703652 17:81832322-81832344 CAGGGGAGAGGGTGAGGAGGTGG - Intronic
1152798095 17:82317737-82317759 CTGTGGAGATGCAGGGGCAGTGG - Intergenic
1152840843 17:82567111-82567133 CCAGGGAGATGGAGAGGTGGGGG - Intronic
1152863009 17:82706638-82706660 CTGGGGAGATGGAGAAGACCTGG - Intergenic
1152885209 17:82845438-82845460 CAGACGAGATGGAGAGGAAGGGG - Intronic
1153230821 18:2933856-2933878 CTGTGGAGCTGCAGGGGATGTGG + Intronic
1154183765 18:12161707-12161729 TTGTGGAGATAGAGAGTAGAAGG - Intergenic
1154339703 18:13492771-13492793 CTGTGGGGATGGAGAAAATGAGG - Intronic
1154440375 18:14383524-14383546 GTGGGGAGAGGGAGAGGAAGAGG + Intergenic
1155053929 18:22169394-22169416 CGCTGGAGGTGAAGAGGAGGAGG - Intergenic
1155149659 18:23112884-23112906 ATTTGGAGACTGAGAGGAGGAGG + Intergenic
1155323018 18:24637435-24637457 CTGTGGACAAGGAGGGGATGGGG + Intergenic
1155325305 18:24658504-24658526 TGGGGGAGATGGAGAGGAGGAGG + Intergenic
1155530326 18:26760091-26760113 CCTTGGAGTTGGAGAGAAGGGGG + Intergenic
1155578645 18:27277917-27277939 CTGTGGGGATGGAGAAAAGTTGG - Intergenic
1155582329 18:27323844-27323866 CTGGGGAGATGCAGAGAAGCTGG - Intergenic
1156866070 18:41890184-41890206 CTGTGGAAATGGACTGGAGTGGG - Intergenic
1157024992 18:43831842-43831864 CAGTGGAGAGGGAGAGAAGGGGG - Intergenic
1157297483 18:46456783-46456805 CGGTGTCGAGGGAGAGGAGGGGG + Exonic
1157461070 18:47894533-47894555 GTGTGGAGATTGGGAGGTGGGGG - Intronic
1157474886 18:48017123-48017145 CTGTGGAGATGGTGATGCAGAGG - Intergenic
1157492445 18:48133808-48133830 CTGTGGAGATGAATAGAGGGAGG - Intronic
1157705019 18:49799223-49799245 GTGGGGAGAGGGGGAGGAGGAGG - Intronic
1157987332 18:52453098-52453120 TTTTGGTGATAGAGAGGAGGTGG - Intronic
1158045658 18:53152620-53152642 CTGTTGTCATGGAGAAGAGGAGG - Intronic
1158301268 18:56055958-56055980 ATGTGGAGTAGGCGAGGAGGAGG + Intergenic
1158524078 18:58196927-58196949 AAGAGGAGATGGTGAGGAGGAGG + Intronic
1158561355 18:58516472-58516494 TTGTGGAGAGGGAGAGGGGTGGG - Intronic
1159009333 18:63043302-63043324 GTGGGGAGAGGGAAAGGAGGGGG + Intergenic
1159058058 18:63486233-63486255 CTGAAGAGTTGGAGAAGAGGTGG + Intronic
1159108176 18:64027124-64027146 TAGTGGAGATGGAGGGGCGGGGG + Intergenic
1159225171 18:65523835-65523857 CTGTGGAAATGGAGTGATGGTGG + Intergenic
1159241105 18:65744971-65744993 CAGTGGGCATGGAGTGGAGGGGG + Intergenic
1159374002 18:67567226-67567248 CAGTGGTGATGGATAGGAAGAGG - Intergenic
1159405620 18:67998828-67998850 CTGTAGAGCTGGACTGGAGGTGG - Intergenic
1159537953 18:69738853-69738875 CTGTGGAGGTCAGGAGGAGGAGG + Intronic
1159979840 18:74764959-74764981 CTGAGGAGAAGGAAAGCAGGAGG + Intronic
1160133006 18:76246414-76246436 CATTGGAGATGGACAGGAGAAGG - Intergenic
1160389564 18:78519721-78519743 CTGTGGAGCTGGGGAGGTGTGGG - Intergenic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160790023 19:918924-918946 CTCTGGAGCAGGAGGGGAGGAGG + Intronic
1160809493 19:1007300-1007322 CAGGGGAGAGGCAGAGGAGGTGG + Intronic
1160819850 19:1052717-1052739 GGGAGGAGAAGGAGAGGAGGAGG + Intronic
1161255501 19:3306812-3306834 GTGAGGGGGTGGAGAGGAGGCGG - Intergenic
1161476151 19:4486753-4486775 GGGTGGAGATGGTGAAGAGGAGG - Intronic
1161620355 19:5293915-5293937 CGGAGCAGAGGGAGAGGAGGAGG + Intronic
1161649880 19:5477945-5477967 GTGAGGAGGGGGAGAGGAGGGGG - Intergenic
1161966254 19:7550824-7550846 CTGGGGAGAGGGAGAGGACAGGG - Intronic
1161994386 19:7703596-7703618 CTGTGGGGATGGGGAGAAGCAGG - Intergenic
1162018148 19:7856707-7856729 CTGGAGAGTGGGAGAGGAGGGGG - Intronic
1162024250 19:7884651-7884673 ATGGGGAGGGGGAGAGGAGGAGG + Intergenic
1162054116 19:8052663-8052685 GAGTGCAGGTGGAGAGGAGGAGG + Intronic
1162140169 19:8580717-8580739 CTGGGGGGATGGAGAGGGGCTGG - Exonic
1163021210 19:14481886-14481908 CTGTGGGGATAGATGGGAGGGGG - Intronic
1163115170 19:15184862-15184884 CAGAGGAGATGGAGAGGAGGAGG + Intronic
1163142874 19:15362366-15362388 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1163255953 19:16155968-16155990 TGGTGGAGATGGAAAGAAGGAGG + Intronic
1163664003 19:18594623-18594645 CTGGGGAGGTGGGGGGGAGGGGG + Intronic
1164168706 19:22703853-22703875 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1164895930 19:31877691-31877713 CTGAGGACATGGAAAGGAGTAGG + Intergenic
1164971780 19:32539069-32539091 CTAGGGAGATGCAGAGGAGCTGG + Intergenic
1165121289 19:33560513-33560535 CTGTGGGGAAGGACAGGAGTGGG - Intergenic
1165340681 19:35209628-35209650 CTTTGGGGATGGAGTGGAGGTGG + Intergenic
1165796595 19:38523512-38523534 AGAGGGAGATGGAGAGGAGGAGG - Intronic
1165839462 19:38779142-38779164 CTGTGGAGCTGGACTGGAAGTGG + Intergenic
1165876040 19:39007578-39007600 CTGGGGAGATGCAGAGTTGGGGG - Intronic
1165889255 19:39100757-39100779 CGGTGGAGAAGGAGATGATGTGG - Exonic
1166126089 19:40716244-40716266 CTCTGAAGGGGGAGAGGAGGTGG - Intronic
1166173363 19:41048054-41048076 CAGTGAAGCTGGGGAGGAGGTGG - Intergenic
1166302804 19:41921879-41921901 TGGTGGAGATGAGGAGGAGGAGG - Intronic
1166719298 19:44988238-44988260 ATGTGGGGAGGGAGGGGAGGAGG - Intronic
1166763944 19:45241515-45241537 CTTAGGAGATGGAGAAGAGCAGG - Intronic
1166872473 19:45879238-45879260 CTGTGCAGGGGGAGTGGAGGTGG - Intergenic
1166890281 19:45987571-45987593 GGGTGAGGATGGAGAGGAGGTGG - Intergenic
1167435220 19:49475073-49475095 GAGGGAAGATGGAGAGGAGGGGG + Intronic
1167435231 19:49475109-49475131 GAGGGGAGATGGACAGGAGGGGG + Intronic
1167575657 19:50316288-50316310 CTGGGGAGGGGGAGGGGAGGAGG + Intronic
1167612305 19:50513417-50513439 CTGGGGAGAGGGAAAGGAGAGGG + Intronic
1167615370 19:50530099-50530121 CTGTGGGGATGGAGAGGAAATGG - Intronic
1168276883 19:55283893-55283915 CTGGAGGGATGGAGAGGAGGTGG - Intronic
1168633007 19:57971962-57971984 CAGTGGAGATGGGTAGGTGGTGG + Intronic
1168658120 19:58146534-58146556 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
925364208 2:3300384-3300406 CTGACGAGAAGGAGAGGGGGCGG - Intronic
925384983 2:3455531-3455553 TCATGGAGATGGAGAGCAGGAGG - Intronic
925398207 2:3552463-3552485 GGGTGGAGATGGCGTGGAGGGGG - Intronic
925398214 2:3552483-3552505 GGGTGGAGATGGCGTGGAGGGGG - Intronic
925501929 2:4514664-4514686 GTCAGGAGATGAAGAGGAGGAGG - Intergenic
925558021 2:5153514-5153536 CTTTGGAGATCCACAGGAGGAGG - Intergenic
925989101 2:9239449-9239471 GTGTGGTGATGGAGGGGTGGTGG + Intronic
926109739 2:10174133-10174155 GTGAGGACATGGGGAGGAGGCGG + Intronic
926138578 2:10354963-10354985 CTGCAGAGATGAAGATGAGGAGG + Intronic
926314264 2:11697800-11697822 CTGGTGAGATGGGGAGGAGGGGG - Intronic
926560051 2:14406863-14406885 CAGTGGAGATGAAGAAGAGTAGG - Intergenic
926675234 2:15613019-15613041 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
927138576 2:20114690-20114712 CTGGGGAGCTGGGGTGGAGGGGG - Intergenic
927234544 2:20858532-20858554 CTATGGAGAAGAAGAGGAGGAGG + Intergenic
927554457 2:24022410-24022432 CTGAGGAGATGGACAGGAAGTGG - Intronic
927882673 2:26699690-26699712 AGGTGGAGAGGGAGTGGAGGAGG - Intronic
927976425 2:27342085-27342107 CTGTCCAGGTGGAGAAGAGGTGG - Exonic
928300775 2:30122071-30122093 ATCTGAAGATGGAGAGAAGGAGG + Intergenic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
929143305 2:38685249-38685271 CTCTGGAAATGGAGCGGGGGTGG + Intronic
929238509 2:39629219-39629241 ATGGGGAGAGGGAGAGGGGGAGG + Intergenic
929763310 2:44823908-44823930 CTTGGGAGGTGGAGAGGTGGAGG + Intergenic
930665759 2:54096845-54096867 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
930715357 2:54588717-54588739 CTGTAGAGATGGAGAGTAGCAGG + Intronic
930985664 2:57584768-57584790 TAGTGGGGATGGCGAGGAGGTGG - Intergenic
931083021 2:58796895-58796917 CAGTGGAGAGGGAGAGGAAAAGG - Intergenic
931476004 2:62588136-62588158 CTTTGAAGATGAGGAGGAGGAGG + Intergenic
931576226 2:63721723-63721745 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
931604917 2:64042472-64042494 CCGTGGAGAGGGAGAGGGAGGGG + Intergenic
932253962 2:70267774-70267796 CCGTGGAGAGGGAGAGGGGGAGG + Intronic
932433303 2:71688064-71688086 TTCTGGAGAAGGAGAGGAGGGGG + Intergenic
932491748 2:72127199-72127221 GTGAGGAGACGGGGAGGAGGAGG - Intergenic
932683763 2:73850304-73850326 CTGTCGGGATGGAGTGGAGCAGG + Intronic
932807709 2:74797041-74797063 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
932883607 2:75527416-75527438 CAGTGGAGAGGGGGAGGGGGAGG - Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933356676 2:81218994-81219016 GTGTGGGGCTGGAGGGGAGGTGG - Intergenic
933799394 2:85948742-85948764 CTGTGGAGATGGAATAGGGGTGG + Intergenic
933811182 2:86033661-86033683 CTGGGGAGTTGGGGAGGAGTCGG - Exonic
933813448 2:86047787-86047809 CTGGGGAGATGCTGAGAAGGGGG + Intronic
933852991 2:86385752-86385774 ATGTGGGGAGGGAAAGGAGGAGG + Intergenic
933940352 2:87239862-87239884 GTGAGGAGAGAGAGAGGAGGAGG - Intergenic
933945411 2:87281985-87282007 GTGTGGAGTTGGAGATGAGGAGG + Intergenic
933990251 2:87628679-87628701 CTGTGGACAGTGAGGGGAGGAGG + Intergenic
934539821 2:95164672-95164694 TTATGGAGATGGAGAGTAGAAGG + Intronic
934560673 2:95311726-95311748 CTGTGGGGAAGCAGAGGTGGTGG - Intronic
934564807 2:95332537-95332559 GTGAGGGGACGGAGAGGAGGAGG + Intronic
935312832 2:101802450-101802472 CTGTGTAGAAGGAGGAGAGGAGG - Intronic
935327307 2:101948547-101948569 CTGTGGAGGTGGAGAGTGGATGG + Intergenic
935585404 2:104796320-104796342 TTGTGGAGATGGAAAGGAACTGG + Intergenic
935984708 2:108661484-108661506 TTGTGAAGATGGACAGGAGCAGG + Intronic
936019441 2:108983737-108983759 CTTTGGAGTTGGAGAGAAGGTGG - Intronic
936055854 2:109261421-109261443 CTGTGGAGCTGGACAGGCAGAGG + Intronic
936137142 2:109905135-109905157 TTGTGAAGATGGACAGGAGCAGG + Intergenic
936207555 2:110466350-110466372 TTGTGAAGATGGACAGGAGCAGG - Intronic
936245218 2:110820543-110820565 CTGAGGAGAGGGAGTGGGGGTGG + Intronic
936267311 2:111020395-111020417 CTCTGGGGATGGAGAGCTGGTGG + Intronic
936303595 2:111322145-111322167 CTGTGGACAGTGAGGGGAGGAGG - Intergenic
936334799 2:111579605-111579627 GTGTGGAGTTGGAGATGAGGAGG - Intergenic
936352786 2:111725914-111725936 GTGAGGAGAGAGAGAGGAGGAGG + Intergenic
936474201 2:112825272-112825294 CTGTGTACCTGGAGAGGAGAAGG - Intergenic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936922407 2:117702371-117702393 CTGGGCAAATGGAGAGGTGGTGG - Intergenic
936980029 2:118255680-118255702 CTGGGGGGAGTGAGAGGAGGAGG - Intergenic
936981478 2:118269181-118269203 CGGGAGAGATGGAGGGGAGGAGG + Intergenic
937168934 2:119845229-119845251 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
937575560 2:123417380-123417402 GGGTGGAGTTTGAGAGGAGGGGG - Intergenic
937907745 2:127060641-127060663 CTGTGGGGACGGACGGGAGGTGG + Intronic
937931065 2:127205547-127205569 CTGTGCACAGGGAAAGGAGGTGG - Intronic
937954916 2:127416767-127416789 GGGTGGAGGTGGAGAGGAGGTGG - Intergenic
938031420 2:127997635-127997657 CAGTGGGGATGGTGAGCAGGGGG + Intronic
938158258 2:128959528-128959550 GGGAGGAGATGGGGAGGAGGAGG - Intergenic
938262000 2:129903153-129903175 ATGAGGGGATGGGGAGGAGGGGG - Intergenic
939625965 2:144477816-144477838 CTTTGCTGATGGAGATGAGGAGG + Intronic
939710179 2:145507730-145507752 CTATGGACATAGAGAGTAGGAGG - Intergenic
940194997 2:151084028-151084050 CTGGGGAGTTGGAATGGAGGCGG + Intergenic
940277909 2:151958655-151958677 TAGTGGGGATGGAGAGGAGGAGG - Intronic
941316927 2:164004762-164004784 CTATGGACATAGAGAGTAGGAGG + Intergenic
942043518 2:172086004-172086026 CCAGGGAGAGGGAGAGGAGGAGG + Intronic
942534124 2:176945547-176945569 CTGAGGAGAGTGAGAGAAGGGGG - Intergenic
942613062 2:177762091-177762113 CTGTGAGGATGGACAGGAGCAGG + Intronic
942642479 2:178074202-178074224 CTTTCTAGATGGAGAGGAAGTGG + Intronic
943060345 2:183037389-183037411 TTTTGAAGGTGGAGAGGAGGGGG - Intronic
943184471 2:184588890-184588912 ATGAGGAGATTGAGTGGAGGAGG - Intergenic
944457179 2:199907849-199907871 CAGTTGAGAGGGAGAGGAGTGGG - Intergenic
944637596 2:201689825-201689847 CAAGTGAGATGGAGAGGAGGCGG + Intronic
944822093 2:203441238-203441260 CTGGGGAGTGGGGGAGGAGGGGG + Exonic
945000409 2:205344294-205344316 ATGTGGATATGGAGTGGATGAGG + Intronic
945048586 2:205802531-205802553 ATGTGGACATGACGAGGAGGCGG + Intergenic
945443544 2:209909453-209909475 CTGTGCAGATGGAGATGATGCGG - Intronic
945679582 2:212897887-212897909 CTCTGGGGAAGGATAGGAGGAGG + Intergenic
945779135 2:214146220-214146242 ATGTGGAGATGGAGAGATGTGGG - Intronic
945864561 2:215161829-215161851 GTGTGGAGAGGGAGTGGCGGTGG - Intergenic
946043521 2:216802810-216802832 GAGTGGGGAAGGAGAGGAGGAGG + Intergenic
946127018 2:217571756-217571778 GTGTTGTCATGGAGAGGAGGAGG + Intronic
946419075 2:219554746-219554768 CGGGGGAGATGGAGAGAGGGAGG + Intronic
946684964 2:222258665-222258687 CTGGGGAGCTGCAGAGGAAGGGG - Intronic
946751639 2:222897907-222897929 CCGTGGAGAGGGAGAGGGGGAGG + Intronic
947190964 2:227504141-227504163 CTGGAGAGGTGGAGGGGAGGCGG + Intronic
947286347 2:228519762-228519784 CTGTGGTGGTGGGGTGGAGGTGG - Intergenic
947651419 2:231789498-231789520 CTGTGAGGATGAAGAGGAAGGGG - Intronic
948169565 2:235890092-235890114 CTGTGTAGGTTGAGAGAAGGAGG + Intronic
948179171 2:235966255-235966277 CTCTGGGGATGGAGGAGAGGGGG + Intronic
948179182 2:235966286-235966308 CTCTGGGGATGGAGAAGAGGGGG + Intronic
948272831 2:236687439-236687461 CAGTGGGGATTAAGAGGAGGTGG + Intergenic
948584390 2:239009799-239009821 CAGAGGAGCTGGAGAGGAGACGG + Intergenic
948712506 2:239833755-239833777 CTGTGAAGAAGGGGAAGAGGGGG + Intergenic
948813566 2:240498473-240498495 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948813578 2:240498508-240498530 CTGTGGGGGTGGAGCTGAGGGGG + Intronic
948831217 2:240599177-240599199 CTGCCGAGATGGTGAGGATGAGG + Intronic
948842173 2:240657169-240657191 CTGGGGAGCTGGGGAGGAGGGGG + Intergenic
948860514 2:240750548-240750570 CTGGGGAGAAGCAGAGGCGGCGG + Intronic
948879133 2:240847259-240847281 CAGCGGAGAGGGAGAGAAGGAGG - Intergenic
948932141 2:241138732-241138754 CTGTGTGGATGAAGAGGATGCGG - Exonic
949043286 2:241859074-241859096 CAGAGGAGATGGGGAGGAGGTGG + Intergenic
1169230921 20:3888689-3888711 CTGTGGCGAAGGAGGGGAAGTGG - Intergenic
1169344721 20:4821284-4821306 ATGTGGAGATGGAGAGAGGTGGG + Intronic
1170008582 20:11695645-11695667 CAGTGGACAGGGAGAGGTGGTGG - Intergenic
1170010247 20:11714928-11714950 CTGTGCAGAGAGAGAGTAGGGGG + Intergenic
1170599744 20:17832051-17832073 CTGTGGGGATGAAGACGGGGCGG + Intergenic
1170688924 20:18594538-18594560 CCGTGGTAATGGAGGGGAGGAGG - Intronic
1170793817 20:19529482-19529504 TTGTGGAGATGGAGAGGAGATGG - Intronic
1170842971 20:19939009-19939031 ATTTGGAGATGGATGGGAGGAGG - Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171823613 20:29876186-29876208 CTCTGGAGCTGGAGAGCCGGGGG + Intergenic
1171869562 20:30514231-30514253 CTGTGGGGCTGCAGGGGAGGGGG + Intergenic
1171958321 20:31475977-31475999 CGGTGGGGAAGGGGAGGAGGGGG + Intronic
1171972327 20:31572202-31572224 CTGTGTTGAGGAAGAGGAGGGGG + Intronic
1172051797 20:32123156-32123178 ATGAGGAGAGGGAGAGGGGGAGG + Intronic
1172209395 20:33186207-33186229 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1172285010 20:33734139-33734161 CTGTGGAGATCTAGGGGAGGAGG + Intronic
1172443726 20:34982353-34982375 CTGGGGGGAAGGAGAGGTGGAGG + Intronic
1172455367 20:35067834-35067856 GTGGGGAGAGGGGGAGGAGGTGG + Intronic
1172595127 20:36145861-36145883 CTGAGGAGATAGAAAGGAGCTGG - Intronic
1172624659 20:36340282-36340304 AAGTGGAGATGGTGAGGAAGGGG + Intronic
1172723457 20:37016924-37016946 CAGGGGAGGGGGAGAGGAGGGGG + Intronic
1172736908 20:37133410-37133432 CTTCAGAGATGGAGAGGAGGAGG - Intronic
1172789598 20:37493702-37493724 CAGTGCAGATGGAGAGAAGGCGG - Intronic
1172790505 20:37502095-37502117 AGGTGGAGCTGGAGAGAAGGAGG - Intronic
1173648060 20:44646022-44646044 CTGGGGAGGTGGAGAGGAGCAGG - Intronic
1173827271 20:46055952-46055974 CTGGGGTTCTGGAGAGGAGGTGG + Intronic
1174147911 20:48464951-48464973 GTGAGGAGGTGGAGGGGAGGGGG - Intergenic
1174153275 20:48500974-48500996 CTGTGGACCTGGGGAGGAGCCGG - Intergenic
1174344683 20:49921433-49921455 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
1174356384 20:50000936-50000958 CTGAGGCAATGGCGAGGAGGAGG + Intergenic
1174444684 20:50582722-50582744 GGGTGGAGGTGGAGTGGAGGAGG - Exonic
1174768348 20:53274410-53274432 CTGTGGAGGCTCAGAGGAGGGGG - Intronic
1174772844 20:53317499-53317521 CTGGGGTGGGGGAGAGGAGGAGG - Intronic
1175077522 20:56388869-56388891 CTTTGCTGTTGGAGAGGAGGGGG - Intronic
1175120238 20:56711043-56711065 GGGGGGAGAGGGAGAGGAGGAGG - Intergenic
1175164455 20:57033403-57033425 CAGTGGGGCTGGAGAGAAGGGGG + Intergenic
1175166416 20:57047588-57047610 CTGTGGACAGGGGGAGGCGGTGG - Intergenic
1175216355 20:57393367-57393389 CCGTGGAGATGAAGTGGAGAGGG + Intronic
1175223801 20:57433289-57433311 CTGTGGAGCTGCAGAGGGGGAGG - Intergenic
1175336047 20:58197073-58197095 GGGTGGAGTGGGAGAGGAGGAGG - Intergenic
1175337288 20:58204942-58204964 CAGGGGAGATGGAGCCGAGGGGG - Intergenic
1175452058 20:59077748-59077770 TGTTGGAGAGGGAGAGGAGGAGG + Intergenic
1175934806 20:62509746-62509768 GGGTGGAGATGGAGGGGTGGAGG - Intergenic
1176115242 20:63429296-63429318 CTGAGGAGGCGGAGTGGAGGGGG - Intronic
1176142882 20:63553043-63553065 CCGTGGGGGTGGAGATGAGGAGG + Intronic
1176348603 21:5771813-5771835 GTGGGGAGATGGAGAGGGTGAGG + Intergenic
1176355417 21:5892397-5892419 GTGGGGAGATGGAGAGGGTGAGG + Intergenic
1176425789 21:6547541-6547563 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1176496224 21:7552642-7552664 GTGGGGAGATGGAGAGGGTGAGG - Intergenic
1176542924 21:8169883-8169905 GTGGGGAGATGGAGAGGGTGAGG + Intergenic
1176561875 21:8352928-8352950 GTGGGGAGATGGAGAGGGTGAGG + Intergenic
1177203484 21:17984077-17984099 CTGTGGAGAGGGAGAAATGGGGG - Intronic
1177605055 21:23367250-23367272 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
1177722930 21:24930180-24930202 AAGTGGAGATGGAGAGAAGGGGG - Intergenic
1179033049 21:37736661-37736683 ATGGGGAGATGGAGAGAGGGAGG + Intronic
1179133492 21:38660304-38660326 GGGTGCGGATGGAGAGGAGGGGG - Intronic
1179491464 21:41744141-41744163 CTGCGAAGATGCAGAAGAGGGGG + Intronic
1179701280 21:43155858-43155880 CTCGGGGGATGGAGAGGAGAAGG - Intergenic
1179714324 21:43279931-43279953 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714381 21:43280084-43280106 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714404 21:43280129-43280151 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714452 21:43280232-43280254 AGGTGGAGGTGGAGGGGAGGTGG + Intergenic
1179714618 21:43280611-43280633 CAGTGGAGGTGGAGGGGACGGGG + Intergenic
1179761439 21:43532329-43532351 TGGTGGAGGAGGAGAGGAGGGGG - Intronic
1179803176 21:43821578-43821600 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1179992810 21:44957453-44957475 TGGTGGAGATGAAGAGGAGGAGG - Intronic
1180077690 21:45471472-45471494 TTGTGGAGAGGCTGAGGAGGAGG - Intronic
1180107607 21:45630244-45630266 CTGTGGAGATCAGGATGAGGGGG - Intergenic
1180285904 22:10744137-10744159 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1180861112 22:19083702-19083724 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1180994460 22:19958701-19958723 TGGTAGAGATGGAGTGGAGGTGG - Intronic
1181130163 22:20726542-20726564 CTGTGGAGGTGGAGCAGAGTTGG + Intronic
1181186174 22:21105993-21106015 CTGAGGAGAGGGGAAGGAGGGGG - Intergenic
1181264386 22:21622252-21622274 CTGAGGAGAAGGACTGGAGGAGG - Exonic
1181406220 22:22686792-22686814 CTGTGCAGAGAGTGAGGAGGGGG - Intergenic
1181414171 22:22747444-22747466 CTGTGCAGAGAGTGAGGAGGGGG - Intronic
1181422544 22:22811805-22811827 CTGTGCAGAAAGTGAGGAGGGGG - Intronic
1181426992 22:22850193-22850215 CTGTGCAGAGAGTGAGGAGGGGG - Intronic
1181596437 22:23917959-23917981 CTGTGGAGATGCTTAGGTGGTGG + Intergenic
1181740305 22:24916208-24916230 CTGGGGAGATGGAGGGGATGGGG - Intronic
1181792491 22:25278634-25278656 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1181985381 22:26796837-26796859 CAGTGGAGATGGGGAGGCTGAGG + Intergenic
1182096585 22:27630233-27630255 CTGTGGATTAGGAGAGGGGGTGG - Intergenic
1182288041 22:29259491-29259513 ATGGGGACATGGAGAGGAAGGGG + Exonic
1182321063 22:29478947-29478969 CTGAGAAGATGGGGAGGGGGAGG + Intergenic
1182501779 22:30753306-30753328 ATATGGAGATGGAGGTGAGGAGG + Intronic
1182534262 22:30988496-30988518 CTTTGGAGTTGGAGAGAAGATGG + Intergenic
1182578840 22:31291634-31291656 AGGAGGAGATGGAGAGGAGGAGG + Intronic
1182868384 22:33624868-33624890 CAGTGGGGATGGAGAGAACGGGG + Intronic
1183095642 22:35550539-35550561 CTGTGGAGACGGTGGGGTGGTGG - Intronic
1183374195 22:37453564-37453586 CTGTGGAGATGCAGAGGCTGAGG - Intergenic
1183438631 22:37810004-37810026 CTGAGGTGAAGGAGAGGAGATGG - Exonic
1183530499 22:38350931-38350953 TGGTGATGATGGAGAGGAGGAGG + Intronic
1183564202 22:38601472-38601494 CTGTGGTCATGGTGAGGAGCTGG + Intronic
1183645577 22:39124222-39124244 CTGTGAAGCTGGAGGGGAGGGGG - Intronic
1183718284 22:39547085-39547107 CTGTGGGCATGGAGAGGGAGAGG + Intergenic
1184073443 22:42161330-42161352 CTGTGGAGATGAGAAGGTGGTGG - Exonic
1184080288 22:42214553-42214575 CTGTGGTGAAGGGAAGGAGGAGG + Exonic
1184142077 22:42583786-42583808 CTGTGCAGAAGGAGAGGAAGGGG - Exonic
1184145324 22:42607122-42607144 CTGGGGAGAGGGGGAGGGGGAGG - Intronic
1184365448 22:44048060-44048082 CTTTGCAGTTGGAGAGGATGGGG + Intronic
1184802451 22:46769840-46769862 CTGTGGGGTTGGAGAGGATCGGG + Intronic
1185208391 22:49553210-49553232 CTGTGGGCAGGGAGGGGAGGAGG + Intronic
949159298 3:860726-860748 CTGGAGACATGGAGAGGAGCGGG - Intergenic
949442159 3:4093468-4093490 TTGGGGAGAAGGAAAGGAGGAGG + Intronic
949853154 3:8439035-8439057 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
949926839 3:9048347-9048369 CTGGGGAGCTGGAGATGAGCTGG - Intronic
949935091 3:9110264-9110286 CTGTGGAGATGAAGAGGAGCAGG + Intronic
950021558 3:9791486-9791508 CTGTGGAGCTGGAGAGGACAGGG + Exonic
950230913 3:11275061-11275083 CAGTGGAGATGGAGAGGAGTGGG + Intronic
950326443 3:12114778-12114800 CTGTGGAGAAGGTGGGGAAGAGG - Intronic
950365455 3:12480339-12480361 CTTAGGAGGAGGAGAGGAGGAGG - Intergenic
950443379 3:13022621-13022643 CTGGGGAAATGGGGAGGATGTGG - Intronic
950890443 3:16399820-16399842 CCGTGGAGAGGGAGAGGACAAGG - Intronic
951580788 3:24160347-24160369 CTGTGGTGGTGCAGAGGATGGGG + Intronic
951857549 3:27214590-27214612 CTCTGGAAATGGTGAGGAGGTGG - Intronic
952697168 3:36279457-36279479 CTTTGAAGATGGGGAGAAGGAGG + Intergenic
952755136 3:36859116-36859138 GTGGGGAGCTGGAGAGGAGGCGG - Intronic
952834654 3:37592609-37592631 GGTAGGAGATGGAGAGGAGGGGG + Intronic
952849926 3:37719501-37719523 TTGTGCAGAGGGAGAGGATGTGG + Intronic
952894163 3:38065359-38065381 CTGTGCAGAGGGAGAGGGAGAGG + Intronic
953472656 3:43180161-43180183 TTGTGGGGAGGGAGAGGAAGAGG + Intergenic
953540454 3:43813333-43813355 GTGAGGAGATAGAGAAGAGGTGG - Intergenic
953620893 3:44531889-44531911 CTGTGGAGATGGAAAGAAATGGG - Intergenic
953753645 3:45629001-45629023 CTGGGGAGAGGAAGAGGAAGCGG + Intronic
953924931 3:46978014-46978036 CAGTGGAGGTGGAGAGGGGGCGG - Intronic
953993010 3:47498384-47498406 CAGTGGAGATGCGGAGGATGAGG - Exonic
954258063 3:49419876-49419898 CAGTGGAGAGGAGGAGGAGGAGG + Intronic
954420809 3:50418156-50418178 CTCTGCAGATGGCGAGGTGGGGG - Intronic
954429510 3:50462752-50462774 AGCTGGAAATGGAGAGGAGGGGG + Intronic
954481522 3:50804751-50804773 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
954617654 3:51977850-51977872 GTCTGGAGAGGGAGAGGAGAGGG - Exonic
954647570 3:52140797-52140819 CTGTGGAGGTGGTGGGGAGCGGG + Intronic
955075158 3:55606823-55606845 CTGTAAAGAAGAAGAGGAGGAGG - Intronic
955182401 3:56683888-56683910 CTGGGGAGTTTGAGGGGAGGAGG + Intergenic
955748595 3:62165097-62165119 CTCTGGACATGGAGAAGAGCTGG + Intronic
956090957 3:65666735-65666757 ATGTGGAGATGGCCATGAGGGGG - Intronic
956136060 3:66100268-66100290 CTGTGGGGATGGAGAGCATGAGG - Intergenic
956491592 3:69778053-69778075 CTGTGGAGATGGAGAGGAGGTGG + Intronic
956861458 3:73327924-73327946 TTGTAGAAATAGAGAGGAGGAGG - Intergenic
956878644 3:73488863-73488885 CAGCAGAGATGGGGAGGAGGGGG - Intronic
957546114 3:81639747-81639769 CTGTGGAGTGGGCTAGGAGGAGG + Intronic
957715584 3:83926388-83926410 CTGCGGAGGAGGAGAGGGGGTGG - Intergenic
958129992 3:89406171-89406193 ATTAGGAGATGGAGAGGAGAAGG + Intronic
958422268 3:93942204-93942226 TTGCGGAGAGGGAGTGGAGGGGG - Intronic
958584062 3:96062726-96062748 AGGAGGAGAAGGAGAGGAGGAGG - Intergenic
958816642 3:98923913-98923935 ATGAGGAGAAGGGGAGGAGGAGG - Intergenic
958948665 3:100393430-100393452 CTATGGAGACTCAGAGGAGGGGG + Intronic
959024556 3:101225771-101225793 CTTTGGAGGGGGAGAGGAGGAGG - Exonic
960035695 3:113101073-113101095 ATGAGGAAATGGGGAGGAGGTGG - Intergenic
960344735 3:116518644-116518666 CTGTGCAGAGGGAGAGGGAGAGG - Intronic
960519487 3:118638588-118638610 CTGTGGAGCTGGAAGGGATGAGG + Intergenic
960537036 3:118826034-118826056 TGGTGGAAATGGAGAGAAGGAGG + Intergenic
960615281 3:119590852-119590874 CAGTGGTGAGGGGGAGGAGGGGG - Intergenic
960650379 3:119941788-119941810 CTGTGCAGATGGCGGGGAGGAGG + Intronic
960847750 3:122020641-122020663 CTGTGGAGTTTGAGATGAGCAGG + Intronic
961073527 3:123961094-123961116 CTGTGGGGATGGAGAGGGACAGG - Intronic
961310041 3:125990726-125990748 CTGTGGGGATGGAGAGGGACAGG + Intergenic
961530170 3:127535855-127535877 CTGTGGTGAGAGAGAGGAGCAGG - Intergenic
961597365 3:128029109-128029131 CTGTGGAGAGGGTGGAGAGGAGG - Intergenic
961658778 3:128457424-128457446 CAGTGCAGAGGGAGAGGAAGAGG + Intergenic
962108787 3:132420237-132420259 CTGTGCAGATTGAGAGGGAGAGG + Intronic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962371894 3:134827717-134827739 CTGGGGAGCTGGGGTGGAGGCGG + Intronic
962625366 3:137220587-137220609 CTGTGGGGAGGGGGAGGGGGAGG + Intergenic
962810417 3:138954909-138954931 CTGTGAAGAAGAAGAGGATGGGG + Intergenic
962925028 3:139985028-139985050 CAGTGGAGATGGAGAGAAATGGG - Intronic
963097322 3:141557748-141557770 CTATGGAAATAGAGAGGAAGAGG + Intronic
963275322 3:143324281-143324303 CTGTGGGAATGGAGAGGGAGAGG - Intronic
963327338 3:143877114-143877136 GTGTGGGGAGGGGGAGGAGGGGG - Intergenic
963606449 3:147415581-147415603 GTGTGGAGGTGCAGAGCAGGTGG + Exonic
963638431 3:147828653-147828675 CAGTGGAGATGGAGACAAGTAGG + Intergenic
963888198 3:150603838-150603860 CTGCGGAGATGGGGATGAGTAGG + Intronic
964010982 3:151891266-151891288 CTGTAGACATGCTGAGGAGGTGG + Intergenic
966026301 3:175286989-175287011 GTGTGGGGATGGGGCGGAGGTGG + Intronic
966420374 3:179728965-179728987 GTGGGGAGACGGAGAGGAAGAGG + Intronic
966504464 3:180684017-180684039 CAGTGGAGATGGAGAGCAGTAGG - Intronic
966783678 3:183607336-183607358 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
967266402 3:187695974-187695996 CTGTGGAGACAGACAGCAGGTGG + Intergenic
967292162 3:187931782-187931804 ATGTGGAAATGGAAAAGAGGAGG - Intergenic
967421313 3:189276221-189276243 CTGTGAAGATGAAGAGGTGGTGG + Intronic
967875781 3:194267695-194267717 CTGCGGACAGAGAGAGGAGGTGG - Intergenic
967924926 3:194638560-194638582 TTGTGGAGATGCAGTGTAGGAGG - Intergenic
967943905 3:194787141-194787163 CTGTGGGAATGGAGAGGGAGGGG + Intergenic
968042592 3:195600495-195600517 TTGGGGAGAGGGAGAGGAAGAGG + Intergenic
968049428 3:195644030-195644052 CTGAAGACCTGGAGAGGAGGTGG + Intergenic
968097975 3:195945596-195945618 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968106441 3:196004979-196005001 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968132377 3:196199037-196199059 CAGTGGAGACCAAGAGGAGGAGG - Intronic
968195379 3:196702174-196702196 CAGGGGAGATGGTGAGGATGGGG + Intronic
968305190 3:197645902-197645924 CTGAAGACCTGGAGAGGAGGTGG - Intergenic
968592493 4:1466011-1466033 CTGTGAAGATGGGGTGGTGGGGG - Intergenic
968675818 4:1878723-1878745 ATGTGGAGTTGGAAAGGTGGAGG + Intronic
968814904 4:2817278-2817300 CTGAGGAGAGGAAGTGGAGGGGG + Intronic
969185442 4:5470985-5471007 CTGCAGAGATTGAAAGGAGGCGG - Intronic
969186668 4:5479515-5479537 CAGTGGAGGTGGAGTGGAGATGG + Intronic
969195354 4:5558889-5558911 CTGTTGGAATGGAGAGGAGAAGG + Intronic
969218097 4:5739167-5739189 CTATGGAAAGGGAGAGGATGAGG + Intronic
969305909 4:6326221-6326243 CTCTGAAGAGGGAGAGGATGAGG + Intronic
969684818 4:8665514-8665536 CTGAGTTGATGGAGAGGAAGTGG + Intergenic
969705496 4:8789167-8789189 CTGGGGGGAGGGAGAGGTGGAGG + Intergenic
969715072 4:8864402-8864424 GTGCGGAGAGGGTGAGGAGGTGG + Intronic
969873849 4:10121638-10121660 CTGTGCAGATGGGGAGGTGGAGG - Intergenic
970479452 4:16458561-16458583 ATGGGGAGCTGGAGAGGAGATGG + Intergenic
970715920 4:18922751-18922773 ATGTAGAGATCTAGAGGAGGAGG + Intergenic
970869427 4:20798686-20798708 CTGAGGGGATGGAGTGGCGGAGG - Intronic
971193926 4:24453831-24453853 ATGTGGAGGTGGGGTGGAGGAGG - Intergenic
971765890 4:30831170-30831192 CTGTCCAGTTGGAGAGGATGTGG - Intronic
971784645 4:31084756-31084778 GGGAGGAGATGGGGAGGAGGGGG + Intronic
971791330 4:31173622-31173644 GAGTGGAGAGTGAGAGGAGGGGG - Intergenic
971797306 4:31244423-31244445 CTGGGCAGAATGAGAGGAGGGGG - Intergenic
972308323 4:37853869-37853891 CTGCAGAAATGGAGAAGAGGTGG + Intronic
972411679 4:38801588-38801610 CTCTGGAGTTGGCTAGGAGGTGG - Intronic
972552811 4:40148463-40148485 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
972835963 4:42870029-42870051 TTATGGTGATGAAGAGGAGGAGG - Intergenic
973146972 4:46839382-46839404 CTGTGGAGAAGGAGGGGCTGGGG - Intronic
973336167 4:48958912-48958934 CAGTGGAAATGGAGAAGAAGAGG + Intergenic
973762170 4:54127687-54127709 TTGTGGAGATAGAGAGTAGAAGG - Intronic
973765535 4:54158346-54158368 TTAAGGAGAAGGAGAGGAGGAGG + Intronic
974054664 4:56973547-56973569 CTGTGTACATGGAGTGGCGGGGG + Intronic
974178169 4:58351356-58351378 CAATAGAGATGGGGAGGAGGAGG + Intergenic
974928843 4:68337213-68337235 GGATGAAGATGGAGAGGAGGAGG - Exonic
975063650 4:70036933-70036955 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
975714954 4:77196767-77196789 CTGTGTAGATTGGGAGGAAGTGG - Intronic
976071535 4:81245786-81245808 TGTTGGAGGTGGAGAGGAGGAGG + Intergenic
976118701 4:81756747-81756769 ATTTGGTGATGGCGAGGAGGAGG - Intronic
976218832 4:82739906-82739928 CGGTGGGGATGGAGAGGGGTCGG - Intronic
977477477 4:97530826-97530848 CTTTGGGGAGGGAGAGCAGGGGG + Intronic
977682134 4:99808490-99808512 CTGTGGAAGTGGAGGGGAAGAGG + Intergenic
977765122 4:100788520-100788542 ATCTGGAGATGGGGAGGAGATGG - Intronic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978789345 4:112644297-112644319 GTGTTGCGATGGAGAGGAGGGGG + Intronic
979583103 4:122383226-122383248 TTGGGGAGTGGGAGAGGAGGTGG - Intronic
979915383 4:126426274-126426296 CTATGGAGATAGAGAGTAGAAGG - Intergenic
979984156 4:127294576-127294598 CTGTTGAGCTGGATAGGAGGTGG + Intergenic
980007134 4:127555518-127555540 CTGTGGAAATGGAGAGAAATTGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980419103 4:132536888-132536910 GAGAGGAGAAGGAGAGGAGGAGG - Intergenic
980471866 4:133263239-133263261 CTGAGGGGAGGGAGAGGGGGCGG - Intergenic
981364583 4:143887583-143887605 AGGTGAAGATGCAGAGGAGGAGG + Intronic
981375084 4:144005869-144005891 AGGTGAAGATGCAGAGGAGGAGG + Intronic
981375775 4:144013766-144013788 CTGTGGGGTTGGGGGGGAGGGGG + Intronic
981385699 4:144128057-144128079 AGGTGAAGATGCAGAGGAGGAGG + Intronic
981920144 4:150078257-150078279 CCGCGGAGAAGGGGAGGAGGGGG - Intronic
982341038 4:154299216-154299238 CTGTGGACATGTAGAAGAGAAGG - Intronic
982435812 4:155383025-155383047 CTGCAGAGAGGGAGAGGAGGAGG - Intergenic
982460767 4:155667003-155667025 GTGCGGAGAAGGGGAGGAGGCGG + Intronic
984241038 4:177219485-177219507 CTGGGGAGAGGGAGAGGGAGAGG + Intergenic
984596644 4:181676516-181676538 GAGAGGAGAGGGAGAGGAGGGGG - Intergenic
984813889 4:183819557-183819579 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
985485628 5:146668-146690 CTGTGGGGGAGGAGAGGAGGGGG - Intronic
985818801 5:2146155-2146177 ATGTCGTGATGGTGAGGAGGTGG - Intergenic
985818841 5:2146395-2146417 AGGTGGTGATGGTGAGGAGGTGG - Intergenic
985818935 5:2146921-2146943 AGGTGGTGATGGTGAGGAGGTGG - Intergenic
985960306 5:3297415-3297437 CTGTGGAGAAGGAAAGGATAGGG - Intergenic
986229147 5:5845538-5845560 CTGTGGTGATGCAGAGGCGTGGG - Intergenic
987032299 5:13987155-13987177 GTGTGGAGAAGCAGGGGAGGAGG - Intergenic
987097435 5:14562183-14562205 CTGGGGGGATGGAGGGGAGATGG + Intergenic
987728451 5:21735060-21735082 CTGTGGAGACTTGGAGGAGGAGG + Intergenic
988555391 5:32232045-32232067 CTTAGGAGATAGAGAGAAGGGGG - Intronic
988998554 5:36737922-36737944 ATGTGGAGAAGGAGAGGTGGAGG - Intergenic
989021680 5:37014217-37014239 CCGTGGAGAGGGAGAGGGAGAGG + Intronic
989395425 5:40950840-40950862 CAGTGGAGATGGGGGGAAGGTGG + Intronic
990140406 5:52696828-52696850 CTATGGAGATGGAGAGGATGGGG - Intergenic
990297913 5:54421349-54421371 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
990468052 5:56087918-56087940 CTTGCGAGTTGGAGAGGAGGTGG + Intergenic
990501256 5:56398638-56398660 CAGTGGAGAGGGAGAGGGAGAGG + Intergenic
990596660 5:57319075-57319097 GTGTGAAGATGAAGAAGAGGAGG - Intergenic
990602080 5:57369253-57369275 CTGTAGAGTGGGAGAGAAGGGGG + Intergenic
990787170 5:59434711-59434733 GTGGGGAGAGGGAGTGGAGGAGG - Intronic
990871763 5:60439718-60439740 CAGTGGAGATGGAGAGAGGTGGG - Intronic
991434241 5:66580167-66580189 CTGTGGAGTTTGAGAGGCTGGGG + Intergenic
991973641 5:72164716-72164738 CTGAGGATATGCAGAGGAGCTGG - Intronic
992086340 5:73281314-73281336 CTGAGGCGATGGAGCGGGGGCGG + Intergenic
992090762 5:73314148-73314170 CTGTGTGGATGTGGAGGAGGAGG - Intergenic
992442800 5:76811588-76811610 GTGGGGAGAGGGAGAGGGGGAGG - Intergenic
992550228 5:77852627-77852649 GGGTGGGGAGGGAGAGGAGGAGG + Intronic
992753861 5:79886083-79886105 CTGTGGAGATGGGAGGGTGGCGG + Intergenic
993787316 5:92159265-92159287 CTGAGGAGATGGAGAGTGGTGGG - Intergenic
993852885 5:93033330-93033352 CTGGGGGGATGGAGGGGTGGAGG - Intergenic
994607112 5:101982009-101982031 CGGTAGAGATGGAGATGAGCAGG + Intergenic
994870799 5:105348262-105348284 CTTTGGTGAGGAAGAGGAGGGGG - Intergenic
995123111 5:108556090-108556112 GTGTGGTGATGGATTGGAGGGGG + Intergenic
995236410 5:109833686-109833708 CTGTGGGGAGGGGGAGGGGGAGG + Intronic
995809844 5:116093360-116093382 CTGAGGAGAGGGAGGAGAGGTGG + Intronic
996139508 5:119888708-119888730 CTGTGGAGTTGGAGAGTAGTGGG + Intergenic
996285328 5:121784287-121784309 CAGTGGAGATGGAGAGACGTGGG + Intergenic
996405728 5:123100305-123100327 CTGAGGAGATGGAGCAGCGGAGG + Intronic
996843424 5:127873672-127873694 CTTTGGAGATATAGAGTAGGAGG - Intergenic
997579698 5:135009541-135009563 CTGATGAGATGGCCAGGAGGAGG + Intronic
997713962 5:136028756-136028778 CTGTGGCGAGGGAGAGAGGGAGG + Intergenic
997998627 5:138606475-138606497 CTTGGGAGTTGGGGAGGAGGAGG - Intergenic
998136262 5:139676201-139676223 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998136273 5:139676237-139676259 CTGTGGAGGAGGTGGGGAGGAGG - Intronic
998149553 5:139748966-139748988 CTGTTGGGATGGAGTGCAGGTGG + Intergenic
998371058 5:141661788-141661810 CTCTGGGGATGGAATGGAGGAGG + Exonic
998432372 5:142077317-142077339 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
998495083 5:142581672-142581694 ATGGGGGGTTGGAGAGGAGGAGG - Intergenic
998641230 5:144013611-144013633 CTGAGGAGATGAAGGGGAGTAGG + Intergenic
998819685 5:146047454-146047476 GTGGGGAGAGGGACAGGAGGAGG + Intronic
999054301 5:148557255-148557277 CTGGGGAGATGGAGAGAAGTGGG + Intronic
999404328 5:151293747-151293769 ATATGGAGGGGGAGAGGAGGAGG + Intronic
999499686 5:152134361-152134383 CTTAAGAGATGGACAGGAGGTGG + Intergenic
1000043514 5:157502796-157502818 CTGTGGAGAAGAAGAGGTGAGGG - Exonic
1000064714 5:157684566-157684588 CTGTGGCCCTGGAGAGGAGGAGG - Intergenic
1000120631 5:158194647-158194669 CTGGAGGGAGGGAGAGGAGGAGG - Intergenic
1000433461 5:161179658-161179680 GTGTGGGGTTGGGGAGGAGGTGG - Intergenic
1001237454 5:170042264-170042286 GAATGGAGATGGAGAGGAAGTGG - Intronic
1001665046 5:173425666-173425688 GTGTGGAGATGAAGAGGTGTGGG + Intergenic
1001727760 5:173921423-173921445 CAGAGGAAATGGTGAGGAGGAGG + Intronic
1001824355 5:174733478-174733500 CAGTGGAGACGGAGTGGGGGTGG - Intergenic
1001848254 5:174940497-174940519 GGATGGAGATGGAGAGAAGGAGG + Intergenic
1002026078 5:176397132-176397154 CGGAGGAGATGGAGATAAGGAGG - Intronic
1002079458 5:176728735-176728757 CTGTCGGGATGGAGAGAAGAAGG + Intergenic
1002295373 5:178227834-178227856 CCATGGAGATGGAGAGGTGGAGG + Intronic
1002364415 5:178698968-178698990 CTGTGGAAATGAAGAGATGGTGG - Intergenic
1002379304 5:178814230-178814252 CCGTTGAGAGGGAGAGAAGGGGG - Intergenic
1002606404 5:180385367-180385389 CGGTGGAGATGGGGAGAAGATGG + Intergenic
1002620309 5:180483511-180483533 CTGAAGAGATGCAGAGGATGTGG - Intergenic
1002660527 5:180788370-180788392 CTGTGAGGGTGGAGAGGAAGAGG - Intergenic
1002699979 5:181116881-181116903 CTGATGAGCTGGTGAGGAGGTGG - Intergenic
1002805173 6:567009-567031 CAGTGGAGTTGGAGAGCAGTTGG - Intronic
1002847777 6:963285-963307 CTATGGACACAGAGAGGAGGAGG + Intergenic
1002947640 6:1778462-1778484 CTGTGGAATTCAAGAGGAGGGGG + Intronic
1003039420 6:2673495-2673517 CTCAGGAAATGGAGAGGATGAGG + Intronic
1003545155 6:7052348-7052370 CTGTGAGGGTGGAGAGGGGGCGG + Intergenic
1004143801 6:13046264-13046286 CGGTGGGGATGGGTAGGAGGAGG - Intronic
1005191664 6:23230404-23230426 TTGTGAAGAGGGAGAGGAGCAGG + Intergenic
1005980280 6:30831241-30831263 CTGGGGAGTGGGAGGGGAGGAGG - Intergenic
1006254644 6:32820602-32820624 ATGTGGGGATGGGGAGGAAGTGG + Intronic
1006376882 6:33676644-33676666 CGGTGGAGAGGGACAGGTGGTGG + Intronic
1006497134 6:34431870-34431892 CTGTGGTGATGGAGAGTAATGGG + Intergenic
1006576539 6:35050678-35050700 CTGTGCAGATGGGGAGAAGCCGG - Intronic
1006748607 6:36362679-36362701 CTGGGGAGATGGAGAAAAGGTGG + Intronic
1006824097 6:36921447-36921469 CTGTGGAGATGGAGGGGAGAGGG + Intronic
1006950747 6:37819720-37819742 CTGCGGAGACGGGGAGGGGGCGG - Exonic
1007053604 6:38859187-38859209 CTGTTAAGATGGTAAGGAGGAGG - Intronic
1007742289 6:44020267-44020289 CTGGGGTGATGGGGAGGAGCAGG + Intergenic
1007811377 6:44488495-44488517 GGGTGGGGATTGAGAGGAGGGGG - Intergenic
1008245769 6:49171034-49171056 AAGAGGGGATGGAGAGGAGGTGG + Intergenic
1008515470 6:52314691-52314713 CTGGATAGATGGAAAGGAGGAGG + Intergenic
1008626934 6:53326268-53326290 ATGTGGAGGTGGATAGAAGGAGG - Intronic
1008664007 6:53697894-53697916 CAGTGAGGATGGAGAGGAAGAGG + Intergenic
1009609070 6:65914822-65914844 TAGTGGAGATTGAGAGGAGTTGG - Intergenic
1010007453 6:71011068-71011090 CTGTGGGGATGGAGTGGTGGAGG + Intergenic
1010040621 6:71378663-71378685 CTGTGGAGATGGAGAAGTCATGG + Intergenic
1010264593 6:73851965-73851987 GTGGGGAGATGGAGAGGGAGAGG + Intergenic
1010697326 6:78992767-78992789 CTGAGGAGAGGGAGAAGATGGGG - Intronic
1010735306 6:79437198-79437220 CCGTGGAGGAGGAGAGGAGCAGG + Intergenic
1011084232 6:83521512-83521534 CTGTCGAAGAGGAGAGGAGGGGG - Intronic
1011249921 6:85360295-85360317 CTGAGGAGCTGGAGAGAAGTTGG + Intergenic
1011335474 6:86254865-86254887 CTGTGTGGCTGGAGAGGAGATGG + Intergenic
1011718087 6:90128033-90128055 CTGGGGAAATGGAGATGGGGGGG - Intronic
1012269580 6:97192129-97192151 CTGTGCATATGTGGAGGAGGGGG + Intronic
1012446679 6:99314208-99314230 TTGTGGTGATGGAGAGGGGCGGG - Intronic
1012545705 6:100417086-100417108 GTCTGGAGGTGGAGTGGAGGAGG - Intronic
1012932300 6:105329900-105329922 GTGTGGAGATGGAGGGGAAATGG + Intronic
1013236117 6:108198962-108198984 CTGTAGGGATGCGGAGGAGGTGG + Intergenic
1013324489 6:109031395-109031417 GTGTGAGGCTGGAGAGGAGGTGG - Intronic
1013460411 6:110369752-110369774 ATGTAGAGTTGGAGATGAGGAGG - Intergenic
1013721009 6:113028237-113028259 GTGTGGAGAGGGAGCGGTGGTGG + Intergenic
1013947532 6:115739183-115739205 CTGTGGAGATTAAAAGGTGGAGG + Intergenic
1014023428 6:116616892-116616914 CAGGGGAGAAGGAGAGGAAGAGG - Exonic
1014339689 6:120188402-120188424 TTGTGGAGACGGAGAGTAGAAGG + Intergenic
1014383026 6:120767712-120767734 CTGTGGATAAGAAGAGGAAGCGG + Intergenic
1014777127 6:125524029-125524051 CTGGGGAGATGGGGAGGGAGAGG - Intergenic
1014951007 6:127556312-127556334 CTGTGGGGAGAGAGTGGAGGTGG - Intronic
1015626160 6:135182286-135182308 ATGGGAAGAGGGAGAGGAGGAGG + Intronic
1015789433 6:136951535-136951557 CTGTTAAGATGGAGTGAAGGAGG - Intergenic
1016292107 6:142537694-142537716 CAGTTGAGAGGGAGAGGTGGGGG - Intergenic
1016738546 6:147506809-147506831 CTTTGGCGAGGGAGAGGCGGCGG + Intergenic
1016912598 6:149214158-149214180 CAGTGAAGATGGAGAAGAGCAGG - Intergenic
1017588569 6:155953692-155953714 CTGTGGAAGTGGAGGGGAGCTGG + Intergenic
1017660495 6:156669646-156669668 CTGTGGAGAGGGAGAGGGAGAGG - Intergenic
1017768505 6:157626577-157626599 CTGTGCATGTGGAGGGGAGGGGG - Intronic
1017851706 6:158309901-158309923 GTGGGGAGAGGGAGAGGGGGAGG + Intronic
1017981746 6:159406753-159406775 CCGGGGAGAGGGAGAGGGGGAGG - Intergenic
1018101686 6:160446074-160446096 CTAGGCAGAAGGAGAGGAGGTGG + Intronic
1018690227 6:166338668-166338690 CTGGGGAGAGGGTGGGGAGGCGG + Intronic
1018753509 6:166828313-166828335 GTGTGGAGTTGGGGAGGAAGGGG - Intronic
1018948455 6:168363369-168363391 AGGGGGAGATGGAGGGGAGGGGG + Intergenic
1018950859 6:168378020-168378042 CTGTGGAGAAGGAGAAACGGGGG - Intergenic
1018988826 6:168658097-168658119 ATGGGGAGATGGAGAGCAGGTGG + Intronic
1019106632 6:169673077-169673099 TGATGGAGATGGAGAGGAGATGG + Intronic
1019517423 7:1446184-1446206 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019517480 7:1446328-1446350 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019517519 7:1446434-1446456 GAGTGAAGAGGGAGAGGAGGGGG + Intronic
1019526372 7:1482240-1482262 GTCTGGGGTTGGAGAGGAGGAGG - Intronic
1019599562 7:1874456-1874478 CTCTGGTGGAGGAGAGGAGGCGG + Intronic
1019686403 7:2384418-2384440 CTGAGGAGATGGGGAGGTTGAGG - Intergenic
1019711606 7:2520500-2520522 CTCTGGAGCTGGACAGGAGGCGG - Intronic
1020076587 7:5262753-5262775 CTGTGGTGGTGGGGTGGAGGGGG - Intergenic
1020431822 7:8123258-8123280 CTGGGGAAATGGAGAGGAAGGGG - Intronic
1020654394 7:10912171-10912193 CAGTGGAGGTGGAGAGAAGAGGG - Intergenic
1020899804 7:13990442-13990464 CTGTGGCTGTGGGGAGGAGGAGG + Intronic
1021299097 7:18949367-18949389 GTGAGAAGATGAAGAGGAGGAGG - Intronic
1021593658 7:22292081-22292103 CTGTGGACAGGGGGCGGAGGGGG + Intronic
1021602064 7:22374054-22374076 GTGAGGAGATGGTGAGAAGGTGG - Intergenic
1021627645 7:22610081-22610103 TAGTGGAGATGGAGAGAAGTTGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1021855642 7:24852534-24852556 CTGAGCAGACGGGGAGGAGGAGG + Exonic
1022126761 7:27365076-27365098 CGCTGGAGATGCTGAGGAGGAGG + Intergenic
1022394064 7:29969986-29970008 CAGTGGAGGTGGAGAGGAGTGGG - Intronic
1022404824 7:30078892-30078914 CTGGGGGGATGGACAGGAGGTGG + Exonic
1022585330 7:31603396-31603418 CTGTGGAGTGGGTGGGGAGGGGG - Intronic
1022700165 7:32753183-32753205 CTGTGGAGAGAGAGAGGGAGAGG - Intergenic
1022729620 7:33010221-33010243 CTGTGGAACTGGAGAGAAGTGGG - Intergenic
1022842363 7:34176660-34176682 CTTTGCAGATGGAATGGAGGTGG + Intergenic
1022922727 7:35032883-35032905 CTGTGGAGATGGAGAGAAATTGG - Intronic
1022961525 7:35430651-35430673 CTGAGGAGGCGGGGAGGAGGTGG - Intergenic
1023151883 7:37209301-37209323 CTGTGGAGAGAGAGAGGTTGGGG - Intronic
1023569520 7:41557490-41557512 CTGGGGAGATGGGGAGGGGGAGG + Intergenic
1023837983 7:44079669-44079691 CTCTGCAGAAGGTGAGGAGGCGG + Exonic
1024049407 7:45609327-45609349 GGCTGGGGATGGAGAGGAGGCGG + Intronic
1024089798 7:45925824-45925846 CACTGGAGATGGAGAGACGGAGG + Intergenic
1024208608 7:47184821-47184843 CTCTGGGGTGGGAGAGGAGGAGG + Intergenic
1024280933 7:47719167-47719189 CTTTGGAGTTGGAGAGAATGTGG + Intronic
1024459480 7:49645338-49645360 TTATAGAGATGGGGAGGAGGCGG - Intergenic
1024505169 7:50156626-50156648 CCTGGGATATGGAGAGGAGGAGG - Intronic
1024568800 7:50707397-50707419 CTGTGGAACCGGTGAGGAGGTGG - Intronic
1024909528 7:54429190-54429212 GTGTGCTGCTGGAGAGGAGGTGG + Intergenic
1025187767 7:56874401-56874423 CAGAGGACCTGGAGAGGAGGTGG + Intergenic
1025684155 7:63702525-63702547 CAGAGGACCTGGAGAGGAGGTGG - Intergenic
1026273100 7:68853386-68853408 ATGTGGGGGTGGAGGGGAGGGGG - Intergenic
1026338125 7:69412212-69412234 TTGTAGAGATAGGGAGGAGGGGG - Intergenic
1026366486 7:69653825-69653847 CTGGGCTGATGCAGAGGAGGTGG - Intronic
1026407641 7:70084018-70084040 GGGTGGAGATGGAAGGGAGGTGG - Intronic
1026428758 7:70323123-70323145 CTAAGAAGATTGAGAGGAGGAGG + Intronic
1026852721 7:73735218-73735240 CTATGGAAAGGAAGAGGAGGTGG - Intergenic
1027043546 7:74976561-74976583 TTGTGATGATGGTGAGGAGGAGG - Intronic
1027428050 7:78081887-78081909 CTGTGGGGAAGGAGATGATGAGG + Intronic
1028447632 7:90943245-90943267 ACGTAGAGATGGAGAAGAGGTGG + Intronic
1028881961 7:95890429-95890451 CGGTGGAGGGTGAGAGGAGGAGG + Intronic
1029173360 7:98646292-98646314 CAGTGGAGATGGAAATGGGGAGG - Intergenic
1029188392 7:98755324-98755346 CTGTGGAGATGCAGAAGGGCAGG + Intergenic
1029489224 7:100861369-100861391 CTGCGGGCATGGAGGGGAGGAGG - Intronic
1029580233 7:101432353-101432375 CTGAGGACATGAAGAGGAGTGGG + Intronic
1029846575 7:103418123-103418145 GTGTGGGGATGGTGAAGAGGAGG - Intronic
1029853069 7:103484762-103484784 CTGAGGACATGGAGAGGACATGG + Intronic
1030109853 7:106017901-106017923 CAGTGGAGATGGAGTACAGGAGG - Exonic
1030124116 7:106138532-106138554 CTGTGGAGAGGGAGATGAGAGGG + Intergenic
1030338176 7:108347917-108347939 GTATGGGGGTGGAGAGGAGGCGG - Intronic
1031350979 7:120730799-120730821 ATATGGAGATGGAGAGGAATTGG - Intronic
1031934443 7:127721717-127721739 CTGTGAATAAGGAGAGGAGAAGG + Intronic
1032078145 7:128845833-128845855 TTGGGGAGTGGGAGAGGAGGGGG + Intronic
1032166953 7:129552999-129553021 GTGTGGGGATGGAGAGGAGGTGG - Intergenic
1032242910 7:130179327-130179349 CTCTGGGGAAGGGGAGGAGGGGG - Intronic
1032441703 7:131947268-131947290 CTCTGGAGAAGGAAAGAAGGAGG + Intergenic
1033023154 7:137747483-137747505 TTGTGTAAATGGAGAGGATGAGG - Intronic
1033258572 7:139822694-139822716 GTGTGGGGATGAAGAAGAGGGGG - Intronic
1034255936 7:149724712-149724734 CTGTGAAGATGGAGAACAGCTGG + Exonic
1034445594 7:151112550-151112572 CTCTGGAGACGGAGAGGGGATGG - Intronic
1034469203 7:151246649-151246671 CTGTGGAGACTGAGAGGAGGCGG + Intronic
1034569534 7:151944279-151944301 CTGTGGGGCTGGGGAGGAGGGGG - Intergenic
1034735559 7:153426183-153426205 GTGAGAAAATGGAGAGGAGGTGG + Intergenic
1034885289 7:154794213-154794235 CTGTGGGGGTGGAGGGGAGACGG + Intronic
1035128041 7:156624710-156624732 CTGTGGAGAGGGAGAGGTTCAGG + Intergenic
1035391680 7:158508550-158508572 GTGGGGAGCTGGAGAGGAGCAGG + Intronic
1035447469 7:158952604-158952626 CTGTGGACAGGGAGAAAAGGAGG + Intronic
1035659610 8:1337072-1337094 ATGAGAAGATAGAGAGGAGGAGG + Intergenic
1035659673 8:1337556-1337578 TGGTGGTGATGAAGAGGAGGAGG + Intergenic
1035693020 8:1572218-1572240 CTGATGAGATGGAGAGGAGAGGG + Intronic
1036141565 8:6213744-6213766 TTGTGGAGATGGAAAAGATGAGG + Intergenic
1036690426 8:10941399-10941421 CTGTGGAGATGGAGAAACTGAGG + Intronic
1037543937 8:19899373-19899395 TTATGGTGATGGAGAAGAGGAGG + Intergenic
1037644758 8:20783251-20783273 CTGTGCAGATGGCGAGGGGATGG + Intergenic
1037700692 8:21271645-21271667 CTGTGGGAAAGGGGAGGAGGAGG - Intergenic
1037747551 8:21659043-21659065 CAGTGGAGCTGGAGTGGAGAGGG - Intergenic
1038038587 8:23706003-23706025 CTGTGGAGATGAGAAGGTGGAGG + Intronic
1038510579 8:28130666-28130688 TTGTGCAGATGGAGGGGAAGGGG + Intronic
1038574811 8:28695808-28695830 TGGTGGTGATGGGGAGGAGGTGG + Intronic
1038745051 8:30247881-30247903 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1038873782 8:31525384-31525406 GTGAGGAGATGGAGAGGAAGTGG - Intergenic
1039398162 8:37245144-37245166 TGGTGGAGATGGAGAGCAGCAGG + Intergenic
1039934888 8:42033649-42033671 CTGTGGAAACACAGAGGAGGGGG - Intronic
1039948497 8:42150264-42150286 CCATGGAGGTGGTGAGGAGGAGG - Intergenic
1039994843 8:42522892-42522914 CTGTAGAGATGGCGGGGTGGGGG + Intronic
1040460591 8:47644094-47644116 CTGTGAAGATGGAGTGCTGGTGG + Intronic
1040685823 8:49871653-49871675 CTGAGGAGAAGGAGAGATGGGGG + Intergenic
1041056086 8:53987940-53987962 CTGTTAAGGGGGAGAGGAGGAGG - Intronic
1041335643 8:56779545-56779567 CTGTGGAGATGGAACTGTGGCGG + Intergenic
1041380617 8:57250832-57250854 CTGTGCAGAAGGTGAAGAGGTGG - Intergenic
1042051137 8:64708962-64708984 TTGTGGAGAGGCAAAGGAGGAGG - Intronic
1042376644 8:68059871-68059893 CTCTGAAGATGGAGAGGACCTGG - Intronic
1042692252 8:71513737-71513759 GTGAGGAGCTGGAGAGGAGGTGG - Intronic
1043031100 8:75134392-75134414 CTGGGGTGCTGGAGAGGATGTGG - Intergenic
1043149109 8:76691135-76691157 TTGTGGAGATGGTGAAGAGTTGG + Intronic
1043423949 8:80130142-80130164 CTGCTGAGATGAAGAGGAGGTGG + Intronic
1043639702 8:82436254-82436276 CCCAGGAGGTGGAGAGGAGGTGG + Intergenic
1044352865 8:91186797-91186819 GTGTGGGGGTGGTGAGGAGGTGG + Intronic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1044963879 8:97556905-97556927 CGGTGTAGAGGGAGAGGAGTGGG + Intergenic
1045063998 8:98429272-98429294 CTTTGGAGATGGAATGAAGGAGG + Exonic
1046023092 8:108689868-108689890 CTGGAGAAATGGAGAGGAGGGGG - Intronic
1046514809 8:115244732-115244754 GTGTTGAGATGGTGGGGAGGTGG - Intergenic
1047438889 8:124858802-124858824 CAGAGGTGATGGAGAGGAAGTGG - Intergenic
1047550062 8:125861312-125861334 CTCTGGAGATGGTATGGAGGAGG + Intergenic
1047741446 8:127810090-127810112 CTCTGGAAAGGGAGAGGAGCAGG + Intergenic
1047938105 8:129801230-129801252 CTGGGGTGATGGAGAAGGGGTGG + Intergenic
1048204437 8:132404019-132404041 CTGTGGAGATGTACAGAATGGGG - Intronic
1048219050 8:132524792-132524814 CTGGAGGGATGAAGAGGAGGCGG - Intergenic
1048281026 8:133105841-133105863 AGGAGGAGATGGAGAGGTGGGGG + Intronic
1048299246 8:133239260-133239282 GAGTGGACATGGAGAGGACGGGG - Intronic
1048361624 8:133701989-133702011 CTGAGGTGATGGTGGGGAGGGGG + Intergenic
1048469892 8:134696511-134696533 GGGTGTAGATGGAGAGGCGGTGG - Intronic
1048702596 8:137109695-137109717 CTGAGGAGATGGACATGAGCAGG - Intergenic
1049076003 8:140396567-140396589 ATGGGGAGATGGAGAGGTAGGGG - Intronic
1049202920 8:141350635-141350657 CTGCTGAGATGGAGTGGGGGTGG - Intergenic
1049310488 8:141931381-141931403 CTGAGGAGGAGGTGAGGAGGGGG + Intergenic
1049405535 8:142450395-142450417 GTGTGTGGATGGGGAGGAGGCGG - Intronic
1049424509 8:142532136-142532158 CTGTGTAGGAGGAGGGGAGGAGG + Intronic
1049466110 8:142752006-142752028 CAGTAGAGATGGAGAGGAGTGGG - Intronic
1049607560 8:143536748-143536770 CTGGGCAGATGGGGAGGGGGTGG - Intronic
1049687770 8:143945821-143945843 GTGTGGGGCTGGAGAGCAGGAGG - Intronic
1049853472 8:144847177-144847199 TTGTGGAGAGGGAGAGGAAGAGG + Intronic
1050021608 9:1290495-1290517 TAGTGGAGAAGGAGAGGAGAAGG - Intergenic
1050228106 9:3484912-3484934 CTGTAGAGATGGGGTGGGGGGGG - Intronic
1050589895 9:7150029-7150051 CTGTAGAAAGGGAGAGGAAGGGG + Intergenic
1050947001 9:11536017-11536039 ATGGGGAGATGGAGAGAAGTTGG + Intergenic
1051349306 9:16184122-16184144 GTGTGGAGGTGGAGGTGAGGAGG + Intergenic
1051760744 9:20461023-20461045 ATGTGTGGATGGAGAGGAGAAGG - Intronic
1051831174 9:21278845-21278867 CTATGGGGAAGGAGAAGAGGAGG - Intergenic
1051860112 9:21615134-21615156 CTGTATAGAGGAAGAGGAGGGGG + Intergenic
1051907985 9:22118334-22118356 CTGTTGAGAGGGAGTGGAGTGGG - Intergenic
1052402012 9:28012265-28012287 ATGTGAAGGTGGAGAGGAGCTGG + Intronic
1052508589 9:29384905-29384927 CTGGAGAGGTGGAGAGGATGTGG + Intergenic
1052995710 9:34550783-34550805 GTGTGGAGCTGGAGAGGGTGGGG - Intergenic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053346850 9:37384439-37384461 CTGAGAAGCTGGACAGGAGGAGG + Intergenic
1054818408 9:69497691-69497713 CTGTGGAAATGGAAAAGAGGAGG - Intronic
1055293883 9:74814261-74814283 CCATGGAGATGGAGAGCAGAAGG + Intronic
1055709072 9:79038896-79038918 CTGAGGAGAAGGCTAGGAGGAGG - Intergenic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1056067978 9:82956684-82956706 GTGGGGATCTGGAGAGGAGGTGG + Intergenic
1056180520 9:84078153-84078175 ATATGGAGATGGAGAGTAGAAGG + Intergenic
1056250188 9:84739760-84739782 CTGGGCAGATGGAAAGGATGTGG + Intronic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056631352 9:88295649-88295671 CTGTGGATCTGGGGAAGAGGGGG - Intergenic
1056775714 9:89511108-89511130 CTCTGAAGGTGGAGATGAGGTGG - Intergenic
1057268843 9:93635919-93635941 CTGGGGAGGTGGGGAGGAGACGG + Intronic
1057524508 9:95786665-95786687 CTGTGGAAATGGGGAAGGGGTGG + Intergenic
1057716359 9:97498911-97498933 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1057821054 9:98331452-98331474 CTGTGGAAACGCAGAGGAGGTGG - Intronic
1057904907 9:98975798-98975820 CTGTGGATGTTTAGAGGAGGGGG + Intronic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1058338938 9:103869892-103869914 CTGTTGTGCTGGAGAGGATGTGG - Intergenic
1058935163 9:109763306-109763328 CTATGGAGATGGAGAGAAAAGGG - Intronic
1058940741 9:109810537-109810559 CTGTTTAGATGGAGAGGTGGAGG + Intronic
1059118285 9:111618232-111618254 GTGGGGAGAGGGAGAGGAGAGGG + Intergenic
1059208077 9:112485529-112485551 CTCTAGAGATGGAGAGGGGTTGG + Intronic
1059368043 9:113801813-113801835 CTGGGGTGAGGGAGAGAAGGCGG + Intergenic
1059710956 9:116867260-116867282 CCGAGGAGAGGGAGAGAAGGTGG + Intronic
1059763353 9:117360502-117360524 CTGGGGATATGGAGATGAGCAGG + Intronic
1059853450 9:118368749-118368771 ATGGGGAGAGGGAGAGAAGGAGG + Intergenic
1059880119 9:118679057-118679079 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1059880133 9:118679105-118679127 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1059956496 9:119521484-119521506 CTGTGGAAGTCCAGAGGAGGCGG - Intronic
1060041363 9:120304352-120304374 CCGTGGAGATGGAGAGGGAGAGG - Intergenic
1060317577 9:122526897-122526919 CTGTGGAGTAGCAGAGGGGGTGG + Exonic
1060804366 9:126565185-126565207 CTGTGGAGATGGTGGGGTTGGGG - Intergenic
1061271281 9:129544840-129544862 CTGGGGAGGTGGAGAGTAGGAGG - Intergenic
1061433045 9:130543307-130543329 CTGGGGACATGCAGAGGAGGGGG - Intergenic
1062016938 9:134295780-134295802 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016946 9:134295807-134295829 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062016954 9:134295834-134295856 CGGTGGAGATAGAGGGGAGCTGG - Intergenic
1062059192 9:134485894-134485916 CTGTGGCGAGGGACAGGAGTGGG - Intergenic
1062064118 9:134517229-134517251 CCAAGGAGAGGGAGAGGAGGCGG - Intergenic
1062147383 9:134997182-134997204 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062147392 9:134997219-134997241 CTGTGAAGATGGCGGGGAGCAGG + Intergenic
1062448038 9:136603972-136603994 CTGGGGATGAGGAGAGGAGGAGG + Intergenic
1062678701 9:137764104-137764126 CTACGGAGAAGGAGAAGAGGAGG - Intronic
1203776435 EBV:75693-75715 CTGTGGTGAGGGATAGAAGGGGG + Intergenic
1203732255 Un_GL000216v2:101191-101213 CTGTAGCTAAGGAGAGGAGGAGG + Intergenic
1185553612 X:1003155-1003177 ATGTAGAGAGGGAGAGGTGGGGG - Intergenic
1186071398 X:5825391-5825413 CTATTAAGATGAAGAGGAGGAGG + Intergenic
1186219526 X:7334590-7334612 TTGAGGACATGCAGAGGAGGTGG - Intronic
1186224721 X:7386513-7386535 CGTTTGAGATGGAGTGGAGGAGG - Intergenic
1186441478 X:9590845-9590867 CTGTGGGGGTGGGGAGGATGGGG + Intronic
1186480741 X:9894854-9894876 CTGCGGAGAGGGGGAGGGGGAGG - Exonic
1186630154 X:11340008-11340030 CTGTGGAGATGGAGAAGGGATGG - Intronic
1187235049 X:17459214-17459236 CTGCGGAGACTGTGAGGAGGTGG + Intronic
1187265202 X:17725921-17725943 CCGTGGAGATGCAGTGGATGGGG - Exonic
1187567035 X:20461021-20461043 CTGTAGAGATGGAGAACAGATGG - Intergenic
1188633726 X:32401525-32401547 CTATGGAGATAGAGAGTAGAAGG + Intronic
1189354107 X:40298581-40298603 CTGGGCAGATGGAGAGGGGGAGG - Intergenic
1189552002 X:42102851-42102873 CTGGGGAGAAGGAGAGCATGGGG - Intergenic
1189602320 X:42640360-42640382 ATGAGCAGATGGAGAGGAAGAGG - Intergenic
1190073829 X:47300948-47300970 AAGAGGAGAAGGAGAGGAGGAGG + Intergenic
1190109718 X:47582242-47582264 CCAGGGAGAGGGAGAGGAGGCGG + Intronic
1190184361 X:48221772-48221794 GTGGGGAGAGGGAGAGGGGGAGG - Intronic
1190505439 X:51120472-51120494 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1190839343 X:54130032-54130054 CTGGGGAGAGGGAGAGGGAGAGG + Intronic
1191059507 X:56279694-56279716 CAGTGGAGATGGAGAGAAGGAGG + Intronic
1191136292 X:57068542-57068564 GTGGGGAGAAGGAGAGGACGAGG - Intergenic
1191676394 X:63796174-63796196 TTATGGGTATGGAGAGGAGGGGG - Intergenic
1191894361 X:65976060-65976082 CCGTGGAGAGGGAGAGGGAGAGG + Intergenic
1191911774 X:66159337-66159359 CGGTGGAGATAGAGAGAAGTGGG + Intergenic
1192163193 X:68803982-68804004 CAGTGAGAATGGAGAGGAGGGGG + Intergenic
1192204759 X:69088497-69088519 CTGTGGAGTCAGAGAGGCGGTGG - Intergenic
1192464261 X:71342553-71342575 GTGGGGAGAGGGAGAGGGGGAGG + Intergenic
1195224015 X:102773610-102773632 CTGTGGAGATAGAGAGTAGAAGG - Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195720766 X:107865695-107865717 CTTGGGATATGGAGAAGAGGAGG - Intronic
1196626605 X:117884412-117884434 CTGTGGAGATAGAGAATAGAAGG + Intergenic
1196852355 X:119949501-119949523 CTGTGGAGGTGGAGTGGGGCAGG - Intergenic
1197335334 X:125204494-125204516 AGGAGGAGAGGGAGAGGAGGAGG + Intergenic
1198131302 X:133697920-133697942 CAGAGGGGAAGGAGAGGAGGGGG + Intronic
1198249976 X:134870459-134870481 ATGAGGAGAGGGAGAGGAGTTGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198491130 X:137142650-137142672 CTGTGGAAATCCAGATGAGGTGG + Intergenic
1198576524 X:138016166-138016188 ATGGGGATATGAAGAGGAGGAGG - Intergenic
1198618584 X:138482863-138482885 CAGAGTAGAGGGAGAGGAGGAGG - Intergenic
1199599930 X:149535832-149535854 AGGAGGAGAAGGAGAGGAGGAGG - Intergenic
1199650703 X:149944419-149944441 AGGAGGAGAAGGAGAGGAGGAGG + Intergenic
1199650774 X:149944769-149944791 AAGAGGAGAAGGAGAGGAGGGGG + Intergenic
1199771887 X:150980411-150980433 CTGGGGGGATGGGGAGGAGCAGG + Intergenic
1200006586 X:153089303-153089325 AGGTGAAGATGGACAGGAGGTGG - Intergenic
1200080010 X:153571656-153571678 CTCCGGAGGTGGGGAGGAGGGGG - Intronic
1200292302 X:154885644-154885666 CTGGAGGGATGGAGAGGTGGTGG + Intronic
1200339139 X:155381381-155381403 CTGGAGGGATGGAGAGGTGGTGG + Intergenic
1200347330 X:155459311-155459333 CTGGAGGGATGGAGAGGTGGTGG - Intergenic
1201224735 Y:11807873-11807895 AGGAGAAGATGGAGAGGAGGAGG - Intergenic
1201948159 Y:19535210-19535232 CCGTGGAGAGGGAGAGGGAGAGG - Intergenic
1202628683 Y:56886367-56886389 CTGTAGCTAAGGAGAGGAGGAGG - Intergenic