ID: 956493291

View in Genome Browser
Species Human (GRCh38)
Location 3:69797145-69797167
Sequence ATTCACATGTGGCATTAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956493291_956493295 13 Left 956493291 3:69797145-69797167 CCAATTTAATGCCACATGTGAAT 0: 1
1: 0
2: 1
3: 19
4: 182
Right 956493295 3:69797181-69797203 ACACCTATCCCAGGTGCTGAAGG 0: 1
1: 0
2: 1
3: 12
4: 141
956493291_956493299 28 Left 956493291 3:69797145-69797167 CCAATTTAATGCCACATGTGAAT 0: 1
1: 0
2: 1
3: 19
4: 182
Right 956493299 3:69797196-69797218 GCTGAAGGTCAGAGTGATACAGG 0: 1
1: 0
2: 2
3: 17
4: 173
956493291_956493294 4 Left 956493291 3:69797145-69797167 CCAATTTAATGCCACATGTGAAT 0: 1
1: 0
2: 1
3: 19
4: 182
Right 956493294 3:69797172-69797194 AATTGTATTACACCTATCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956493291 Original CRISPR ATTCACATGTGGCATTAAAT TGG (reversed) Intronic
901587387 1:10308817-10308839 AGTGAAATGTGGCATAAAATAGG - Intronic
904422369 1:30402525-30402547 ATTCACAGGATGAATTAAATGGG - Intergenic
906618031 1:47248297-47248319 AATTAAATGTGGCCTTAAATTGG + Intergenic
907618463 1:55950004-55950026 ATTGCCATCTGGCATTAAACAGG + Intergenic
908659403 1:66421078-66421100 ATTTCCATGTGGTATTTAATGGG + Intergenic
911493486 1:98599077-98599099 ATTCACATGGGCGAGTAAATGGG + Intergenic
911522690 1:98947340-98947362 ATTGACATGTGGCTTTATAATGG - Intronic
913395100 1:118360479-118360501 TTTTATATGTGGCATGAAATAGG - Intergenic
916134948 1:161643752-161643774 TTTCACATTTCACATTAAATGGG + Intronic
916544224 1:165786633-165786655 ATTTACATGTGACATTAAAAGGG + Intronic
924891778 1:248290277-248290299 ATTCATAAGTGGAATTAAATAGG - Intergenic
1063086886 10:2827760-2827782 TTTAAAATGTGGCTTTAAATAGG + Intergenic
1063669684 10:8089958-8089980 ATTCCCGTGTGGCATAAAATAGG + Intergenic
1065082829 10:22144087-22144109 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1065343976 10:24731025-24731047 ATTCACATCTGGGCTTAAGTAGG + Intergenic
1065949633 10:30640431-30640453 GATCACATATGGCATTTAATTGG - Intergenic
1066232080 10:33445202-33445224 ATTCACATGTCTTACTAAATTGG + Intergenic
1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG + Intergenic
1068482787 10:57615297-57615319 GTTTACATGTTGCATAAAATGGG - Intergenic
1068500720 10:57837984-57838006 ATTTTCTTGTGGCATTTAATGGG - Intergenic
1070397024 10:76020241-76020263 ATGCACATGTGGCTTTTATTTGG + Intronic
1072303485 10:94084925-94084947 ATCCATTTGTGGCATTAAACAGG + Intronic
1072371234 10:94768070-94768092 ATTCCCTTGTGGTATTTAATGGG + Intronic
1076649970 10:131981214-131981236 TTTAAAATATGGCATTAAATGGG - Intronic
1077354868 11:2110955-2110977 ATTCACATGTTGCAATATGTGGG - Intergenic
1080584458 11:33668471-33668493 ATTAAAATGTGGCATTGGATAGG - Exonic
1080803659 11:35632402-35632424 CTTCACATGTGGCATTCTCTGGG + Intergenic
1081243953 11:40740829-40740851 ATTCACATGTGGAAAGAAATTGG - Intronic
1084419814 11:69054686-69054708 AGTCACATGAGGCATGACATGGG - Intronic
1087798256 11:102477081-102477103 ATTCACAGGAGGCATTGTATAGG - Intronic
1090707933 11:129356556-129356578 AATCACATGAGACTTTAAATTGG - Intergenic
1093875249 12:24342071-24342093 AACCATATGTGGCAGTAAATTGG - Intergenic
1096445061 12:51682112-51682134 ATTAATATGTTGCATTACATTGG + Intronic
1096760108 12:53834473-53834495 TTTCACATGTGTTATTTAATTGG - Intergenic
1096934124 12:55251525-55251547 ATTAAAATGTGGCATTTGATAGG + Intergenic
1097249832 12:57626471-57626493 ATTCTCATGGGGCAGGAAATGGG - Exonic
1097764538 12:63510405-63510427 ATTCACATGCAGAATAAAATTGG + Intergenic
1100008031 12:89917778-89917800 ATAAACACTTGGCATTAAATGGG - Intergenic
1101805905 12:108063549-108063571 ATTCCCATGTGGCTGCAAATAGG + Intergenic
1102580482 12:113883350-113883372 ACCCACATGTGGCATCAAAGAGG - Intronic
1104197632 12:126556211-126556233 ATTCAAATGTAGAATTACATAGG - Intergenic
1105762915 13:23530125-23530147 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1108822176 13:54366241-54366263 ATTTATATCTGGCTTTAAATTGG - Intergenic
1111369768 13:87301872-87301894 ATTAACAGCTGGCATTAATTTGG - Intergenic
1114734436 14:25029646-25029668 TTTCACATGAAGCATTATATAGG - Intronic
1114826312 14:26084757-26084779 AGTCACACTTAGCATTAAATGGG - Intergenic
1115424464 14:33240915-33240937 ATTCACAAATGGCAATTAATTGG - Intronic
1116032711 14:39591935-39591957 ATTCACACTTGGCATTACAGAGG - Intergenic
1117548834 14:56813930-56813952 ATTCATGTGTGGCACTAACTAGG + Intergenic
1121257038 14:92538714-92538736 ATTCATATGTGGCATTGAGCTGG - Intronic
1125932762 15:43612080-43612102 ATTCAGATGTGGGATTAGAGAGG - Intronic
1125945861 15:43711542-43711564 ATTCAGATGTGGGATTAGAGAGG - Intergenic
1128072029 15:64803629-64803651 ATTCTCATGTAGGATGAAATCGG + Intergenic
1128467713 15:67926792-67926814 AATGACATGTGGCATTTAAGGGG + Intergenic
1129637285 15:77333922-77333944 ATTCAGAAGTGGGATGAAATAGG - Intronic
1130709014 15:86261144-86261166 AGTCACATGTGGAATGAATTAGG + Intronic
1130735407 15:86543139-86543161 ATTCAAATGTGGAGATAAATTGG - Intronic
1131566653 15:93491978-93492000 ATACACATCTTGCATAAAATAGG - Intergenic
1139275433 16:65723533-65723555 ATTCACATGTACCAGTAAAAGGG + Intergenic
1143740932 17:8953566-8953588 GCTCACATTTGGCATCAAATGGG + Intronic
1144070008 17:11662637-11662659 ATTCTCAAGTGGCATTCAAGTGG - Intronic
1144568014 17:16376234-16376256 ACTTACATGAGGCATTAAAGTGG + Intergenic
1146405305 17:32531455-32531477 ATTCAATTTTGGGATTAAATTGG + Intronic
1148625277 17:49064594-49064616 ATTCACATGGGTCATGAAGTGGG - Intergenic
1150325631 17:64254669-64254691 ATTCACTTGTAGCATGAAACAGG - Intronic
1150604985 17:66683280-66683302 ATTCACATTTTTCTTTAAATTGG - Intronic
1157120085 18:44900993-44901015 ATTCACATGTTAAATTAAAAAGG - Intronic
1158686746 18:59621544-59621566 ATTCATACCTGGCATTACATGGG + Intronic
1159698899 18:71598513-71598535 AGTCACATGCTGCATTATATTGG - Intergenic
1164422770 19:28111237-28111259 AGCCACATGTAGAATTAAATTGG + Intergenic
1164867541 19:31617303-31617325 ATTCACATTTGTAATTAAACTGG + Intergenic
926902722 2:17772996-17773018 ATTCACATTTCTTATTAAATGGG + Intronic
928976284 2:37089870-37089892 AGTCACATGTGGAAATAAACAGG + Intronic
929994750 2:46818255-46818277 AATGAGATGTGGCTTTAAATAGG - Intronic
936802475 2:116285271-116285293 ATTTCCTTGTGGCATTTAATGGG - Intergenic
937550198 2:123078448-123078470 AGCCACATGTGACACTAAATAGG - Intergenic
940192132 2:151053038-151053060 ATTGACATGTGGGATGAAACTGG - Intergenic
940548685 2:155123592-155123614 ATTCACATGTTACATTATACTGG - Intergenic
941601222 2:167546041-167546063 TTTCACTTGTGGCATCATATTGG + Intergenic
942846011 2:180426320-180426342 ATTTACATGTGGAATTTAAAGGG + Intergenic
943232587 2:185274166-185274188 ACTTACATGTGGAATTAAATAGG + Intergenic
944008079 2:194936091-194936113 ATTCACATATGGAAATAATTTGG + Intergenic
945212658 2:207399724-207399746 ATTCACAAGTGGCAAAAAGTAGG - Intergenic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
945607314 2:211950677-211950699 ACTCATATCTGGCATCAAATTGG + Intronic
946206382 2:218111895-218111917 ATTTCCATGTGGTATTTAATGGG + Intergenic
947870183 2:233431793-233431815 ATTTGCATATGGCAATAAATGGG - Intronic
948160660 2:235821305-235821327 GTATACATGTGGCTTTAAATTGG + Intronic
1169128445 20:3148387-3148409 ATACACATCTAGCATTGAATGGG + Exonic
1171022337 20:21597278-21597300 ATTCACAGGTGGGATCACATAGG + Intergenic
1172990700 20:39034392-39034414 ACACACATAGGGCATTAAATTGG - Intronic
1175594374 20:60219005-60219027 AGTCACATGCAGCATGAAATTGG - Intergenic
1178115713 21:29414203-29414225 ATACACATGTTTGATTAAATCGG - Intronic
1179207563 21:39296776-39296798 ATAAACACTTGGCATTAAATGGG - Intronic
1179366970 21:40767669-40767691 ATTTGCATCTGGCATTCAATTGG - Intronic
1181973687 22:26713128-26713150 ATACATATATGGCATTAAAATGG - Intergenic
1182172000 22:28240349-28240371 ATTCTGCTGTGGTATTAAATTGG + Intronic
949740601 3:7229309-7229331 ATTAACATGTGGAAATAATTTGG - Intronic
949873322 3:8607651-8607673 GTTCACATGTGACATTAAACAGG + Intergenic
951073967 3:18366805-18366827 ATTTACAGGTGGCATATAATGGG - Intronic
953391714 3:42537595-42537617 ATTCTCATATGGCCTAAAATGGG + Intergenic
955129410 3:56149846-56149868 ACTCAGATGTGGAATTAATTGGG + Intronic
955475444 3:59331407-59331429 GTTCATATGTTGCATTAAATGGG + Intergenic
956316169 3:67939778-67939800 ATTCATATGTGGAATTCAACTGG - Intergenic
956493291 3:69797145-69797167 ATTCACATGTGGCATTAAATTGG - Intronic
957352416 3:79042874-79042896 ATTGACATTTGGCAGTAAAATGG - Intronic
957514714 3:81235154-81235176 ATTCACATGTGGCAGAGAAGAGG - Intergenic
958851737 3:99334921-99334943 ATTAACATGTGGCATTAGTGTGG - Intergenic
959247574 3:103894089-103894111 ATTTGCATGAGGCAATAAATTGG + Intergenic
959822151 3:110748753-110748775 AATTTCATGTGGCAGTAAATAGG - Intergenic
960814784 3:121661392-121661414 ATTCTCTTCTGGCATTCAATTGG - Intergenic
963290560 3:143482880-143482902 GTTCACTCGTGGCATTAACTAGG + Intronic
963687657 3:148457676-148457698 TTCCACTTGTGGCATCAAATGGG + Intergenic
967456960 3:189699386-189699408 ATTCACTTGTCCCATGAAATTGG + Intronic
971089711 4:23327142-23327164 ATTCATATTTGGCATTGAAAAGG + Intergenic
972079945 4:35138191-35138213 TTTCACATGTGGCAATTAATGGG - Intergenic
972659666 4:41103746-41103768 ATTCACATGTGACGTTAAAGTGG - Intronic
974293178 4:59960900-59960922 TTTCACATTTTGCCTTAAATTGG - Intergenic
975363258 4:73497116-73497138 TCTCTCATGTGGCATAAAATTGG - Intronic
978700316 4:111635884-111635906 TTTCACATCAAGCATTAAATGGG - Intergenic
978732397 4:112044147-112044169 ATTGACATATGACATAAAATTGG - Intergenic
982574884 4:157097266-157097288 CTCTACATGTGGCATAAAATAGG + Intronic
982833132 4:160088233-160088255 ATTCACATATAGAATAAAATTGG - Intergenic
983745278 4:171190532-171190554 ATTCACAGGTTGCAGGAAATAGG + Intergenic
986091991 5:4518054-4518076 ATTCTCATATGTCATTGAATAGG - Intergenic
988812658 5:34801026-34801048 AGTTACATGATGCATTAAATAGG - Intronic
989090139 5:37721914-37721936 ATTCACATGTGAAATTTACTGGG + Intronic
989103666 5:37841217-37841239 ATTCACATGGGGCATGGAATTGG + Intergenic
989305075 5:39945593-39945615 ATTCACATGTGGGATTTTCTAGG + Intergenic
989544487 5:42657384-42657406 ATTCATTTCTGGCATTAAAAAGG - Intronic
989758234 5:44982314-44982336 ATTTACATTTGGCATTAAATGGG - Intergenic
989957738 5:50375634-50375656 ATTTCCTTGTGGCATTTAATGGG - Intergenic
990116996 5:52401661-52401683 ATTTACTTGTGGTATTTAATGGG - Intergenic
990149751 5:52802733-52802755 ATTTGTATGTGGCATTAATTTGG + Exonic
990170401 5:53042184-53042206 TTTCACATGTGGCAGTGGATAGG - Exonic
991246365 5:64512451-64512473 ATTCACATGTAGTATGAAGTCGG + Intronic
991532709 5:67633523-67633545 ATTCACATGTGGAAATATATTGG + Intergenic
991990353 5:72332270-72332292 ATACACAGGTGTCATTAAATAGG - Intronic
994177757 5:96730330-96730352 ATATACATGTGGCATTTAAGTGG - Intronic
994289028 5:98005023-98005045 ATTAACATGAGGAATTAAACAGG + Intergenic
995436260 5:112139347-112139369 TTTCACTTGTGGCATCATATTGG + Intergenic
998030892 5:138867034-138867056 AATCAGATGTAGCTTTAAATGGG + Intronic
1000028459 5:157380760-157380782 ATTCACATGGTGAATTACATTGG - Intronic
1001749901 5:174120920-174120942 ATTCCCCTCTGGTATTAAATAGG + Intronic
1004577422 6:16910600-16910622 ATTCAGATGTGTAATAAAATTGG - Intergenic
1005529644 6:26689886-26689908 AATCTCATGTGGAATTACATGGG - Intergenic
1005541152 6:26811761-26811783 AATCTCATGTGGAATTACATGGG + Intergenic
1006263862 6:32899236-32899258 ACTTACATGTGGCATCATATTGG + Intergenic
1009011960 6:57853832-57853854 AATCTCATGTGGAATTACATGGG + Intergenic
1010529978 6:76956348-76956370 TTCCACTTGTGGCATTACATTGG + Intergenic
1011521469 6:88211344-88211366 GTTCTCATTTGGAATTAAATGGG - Intergenic
1011730385 6:90256541-90256563 ATTCACATGAGGTCTTAAATGGG - Intronic
1013160431 6:107538640-107538662 ATACACATGAGGCAGTGAATAGG - Intronic
1014828730 6:126076349-126076371 ATTCACTGATGGCATTATATGGG - Intergenic
1015753279 6:136582637-136582659 ATTCTAATTTGGCTTTAAATTGG + Intronic
1016299591 6:142615263-142615285 TTGTACATGTAGCATTAAATAGG - Intergenic
1016636501 6:146298206-146298228 TTTCACATATGACTTTAAATTGG + Intronic
1017655147 6:156620482-156620504 AATCACATGAGGCCTTAAAGGGG + Intergenic
1020401728 7:7786184-7786206 AATCACATGTTGCATTTACTCGG + Intronic
1021358232 7:19680927-19680949 ATTATCATGTGACATCAAATAGG + Intergenic
1023047576 7:36224131-36224153 TTTAAAAAGTGGCATTAAATAGG + Intronic
1024653586 7:51430101-51430123 AATGACATGTGGAAATAAATTGG - Intergenic
1026705596 7:72689365-72689387 AATGACATGTTGCATTTAATTGG - Intronic
1027656559 7:80937264-80937286 GCTCATAAGTGGCATTAAATGGG - Intergenic
1028531908 7:91847868-91847890 AATGAAATGTGGCATTAAATAGG - Intronic
1029295092 7:99534168-99534190 ACACACACTTGGCATTAAATTGG - Intronic
1030823663 7:114127169-114127191 AGTCCCATGTGGCAATAAACGGG - Intronic
1031654844 7:124341985-124342007 ATTCACAACTGGTATTAATTAGG + Intergenic
1032226245 7:130034129-130034151 AATAATATGCGGCATTAAATTGG - Intronic
1034981856 7:155484319-155484341 ATTAACATTTGGCATCAAACAGG - Intronic
1035795532 8:2353234-2353256 ACTAACATGAGGCATTACATGGG - Intergenic
1036736546 8:11323051-11323073 AAACACAAATGGCATTAAATAGG - Exonic
1039113450 8:34065493-34065515 ATTCACATGTGTCATTATGCTGG - Intergenic
1040972127 8:53146840-53146862 ATTCACATGTGGGATTGTGTGGG + Intergenic
1041225714 8:55695815-55695837 ATTCACACATTGCATGAAATAGG - Intergenic
1042586936 8:70350452-70350474 ATTAAAATGTGAAATTAAATTGG + Intronic
1043650783 8:82588902-82588924 ATTAACATGTTGCATTAATGTGG - Intergenic
1044291281 8:90473378-90473400 ATTCAAATGTGGCATTAGTATGG - Intergenic
1045576406 8:103425686-103425708 TTTCACATAAGGCATCAAATTGG + Intronic
1046303068 8:112323688-112323710 ATACACCTGTGTTATTAAATTGG + Intronic
1046478996 8:114789491-114789513 ATTCATATGTGGCAATGAAGAGG - Intergenic
1047263926 8:123287866-123287888 ATTCCCAGTTGGCACTAAATAGG - Intergenic
1050345684 9:4683731-4683753 ATTCACATGTGAAATTATAAGGG + Intronic
1051935657 9:22439847-22439869 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1052302600 9:26971014-26971036 AATGACATGTGCCATGAAATGGG + Intronic
1052457089 9:28713766-28713788 ATTCATATCTGGCATTGACTGGG + Intergenic
1055129432 9:72757716-72757738 TTTCACTTGTGGCATCATATCGG + Intronic
1056274443 9:84980035-84980057 AAGCAAATGTGGCAATAAATGGG - Intronic
1059738404 9:117125472-117125494 GTTCACATGTGGCATTAATGTGG + Intronic
1059792891 9:117659868-117659890 AATTTCATGGGGCATTAAATTGG - Intergenic
1060870265 9:127034359-127034381 ATACACCAGGGGCATTAAATGGG - Intronic
1190459342 X:50656450-50656472 ATTCACATGCGGAATGAAATTGG - Intronic
1194404621 X:93479914-93479936 ATTAACATCTTGCATTAAGTTGG - Intergenic
1195271436 X:103235053-103235075 AATCACCTGTTGCATTTAATTGG - Intergenic
1196749355 X:119100911-119100933 ATTAATATCTGGAATTAAATGGG + Intronic
1197588625 X:128381726-128381748 ATTCACATGCAGAATAAAATTGG + Intergenic
1200959648 Y:8985166-8985188 ATTAACGTGTGGTATTTAATGGG - Intergenic
1201059809 Y:10035940-10035962 ATGCACATGGGGCATCAGATTGG - Intergenic
1201515629 Y:14816443-14816465 ATTTCCTTGTGGCATTTAATGGG + Intronic
1201744635 Y:17358200-17358222 TTTCCCATGTGGCATAAAATGGG + Intergenic
1202258255 Y:22942608-22942630 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1202411245 Y:24576366-24576388 ATTTCCTTGTGGCATTTAATGGG - Intergenic
1202459536 Y:25093706-25093728 ATTTCCTTGTGGCATTTAATGGG + Intergenic