ID: 956494895

View in Genome Browser
Species Human (GRCh38)
Location 3:69814586-69814608
Sequence CTGGTTCATCCCAACAATTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 333}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956494895 Original CRISPR CTGGTTCATCCCAACAATTT GGG (reversed) Intronic
900259964 1:1721890-1721912 CTTGTTAATCCCAGCACTTTGGG + Intronic
902139520 1:14341150-14341172 CCTGTTAATCCCAACACTTTGGG - Intergenic
903165924 1:21520387-21520409 CCTGTTAATCCCAACATTTTGGG - Intronic
903600865 1:24538670-24538692 CTGGTTAATCCCAGCACTTTGGG - Exonic
904008680 1:27377687-27377709 GTGGCTCATCCCAGCACTTTGGG - Intergenic
904183092 1:28680782-28680804 GTGGCTCATCCCAGCACTTTGGG + Intronic
904853486 1:33477439-33477461 CTGTGTCATCCCAACAAGTCTGG - Intronic
905207928 1:36353479-36353501 CTGGTTCACCCCAACAAGGGTGG + Intronic
905564332 1:38951634-38951656 CTGGTTCATCCCACAAAATTAGG + Intergenic
906711564 1:47934247-47934269 CTGGTTCATCCCACCACACTAGG + Intronic
908551415 1:65212419-65212441 GTGGCTCATCCCAGCACTTTGGG - Intronic
909594741 1:77393953-77393975 CCTGTTCATCCCAGCACTTTGGG + Intronic
910273071 1:85418256-85418278 CTTTTTCGTCCCAACAATTCAGG + Intronic
910298862 1:85682955-85682977 CTGTATAATCCCAGCAATTTGGG + Intronic
911034107 1:93520781-93520803 GTGGCTCATCCCAGCACTTTGGG + Intronic
911097873 1:94070077-94070099 TTGAATCATCCCAACAACTTGGG + Intronic
911491964 1:98580840-98580862 TTGCTTTATCCCACCAATTTTGG + Intergenic
914781786 1:150792209-150792231 CTGGTTAATCCTAGCACTTTGGG + Intergenic
915073407 1:153290625-153290647 CGGGGTAATCCCAACACTTTGGG + Intergenic
916415685 1:164589947-164589969 GTCTTTCATCCCAACATTTTGGG + Intronic
916563558 1:165953996-165954018 CTGGGTGATCCCAGCAGTTTGGG - Intergenic
916749633 1:167712840-167712862 GTGGCTCAACCCAACACTTTGGG + Intergenic
917224081 1:172763304-172763326 TTGGTTCTTTCCAACAATTATGG + Intergenic
918239279 1:182607632-182607654 CTGGTTCATGACAAAAACTTTGG + Intergenic
918265038 1:182834086-182834108 GTGGGTGATCCCAACACTTTGGG - Intergenic
918376400 1:183913453-183913475 GTGGCTCATCCCAGCACTTTGGG - Intronic
918811451 1:189126205-189126227 TTGCTTCATCCCATCAGTTTCGG - Intergenic
919087498 1:192937878-192937900 CTTGTTAATCCCAGCACTTTGGG + Intergenic
919269351 1:195318863-195318885 GTGGCTCATCCCAGCACTTTGGG - Intergenic
920493982 1:206441090-206441112 GTCGCTCATGCCAACAATTTAGG - Intronic
921151282 1:212405030-212405052 GTGGCTCATCCCAGCACTTTGGG - Intronic
922138333 1:222854834-222854856 CTTGTTCATCCCAAGCAGTTAGG - Intergenic
922162687 1:223089976-223089998 CTGTTTCATCCCCACATTCTCGG - Intergenic
924165278 1:241275098-241275120 CTGGTTCAGCAAAGCAATTTTGG + Intronic
1069013204 10:63397791-63397813 CTGTATAATCCCAACATTTTGGG - Intronic
1069494718 10:68893405-68893427 CTGGTTCCTCCCTACATTTCAGG + Intronic
1069927688 10:71862447-71862469 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1069975448 10:72209222-72209244 GTGGCTCATCCCAACACTTTGGG + Intronic
1070025472 10:72627369-72627391 CTTGTTAATCCCAGCACTTTGGG - Intergenic
1070204847 10:74247494-74247516 GTGGCTCATCCCAACATTTTGGG - Intronic
1071220535 10:83459984-83460006 ATGCCTCATCCCAACAGTTTGGG + Intergenic
1073003970 10:100307396-100307418 GTGGGTCATCCCAACACTTTAGG + Intronic
1074091620 10:110264621-110264643 GTGGCTCATCCCAGCACTTTGGG - Intronic
1077071740 11:677205-677227 CTGTTTAATCCCAGCACTTTAGG - Intronic
1077578220 11:3400361-3400383 ATGTGTAATCCCAACAATTTGGG + Intergenic
1078248187 11:9595498-9595520 GTGGTTCAGCCAAACACTTTAGG - Intergenic
1078974150 11:16451772-16451794 CTGATGCCTCCCAACACTTTGGG + Intronic
1078995023 11:16688231-16688253 ATGGCTCATCCCAACACTTTGGG - Intronic
1081501099 11:43667409-43667431 GTGGTTCATCCCAGCATTTTGGG - Intronic
1081508426 11:43742399-43742421 GTGGCTCATCCCAATACTTTGGG - Intronic
1082097165 11:48140287-48140309 GTGGGTAATCCCAACACTTTAGG - Intronic
1084129628 11:67123233-67123255 CTTGTTAATCCCAGCACTTTGGG - Intronic
1084380000 11:68805742-68805764 CTGGTCCATTACAACCATTTAGG + Intronic
1085014616 11:73165123-73165145 CTGGTTCAACCCAAAAAGCTTGG + Intergenic
1085084805 11:73659917-73659939 CTAGTGCAGCCTAACAATTTTGG + Intronic
1086004075 11:82015514-82015536 CTGCTTCCTTACAACAATTTAGG + Intergenic
1086824960 11:91485203-91485225 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1087385725 11:97465720-97465742 CTGCTTCAACCCAAAAATGTTGG + Intergenic
1088278274 11:108111927-108111949 CTGTACCATCCCAACACTTTGGG + Intergenic
1088296428 11:108300979-108301001 CTGCTTGAGCCCAAGAATTTGGG - Intronic
1088634612 11:111807823-111807845 ATGGGTCATCCCAGCACTTTGGG + Intronic
1088883637 11:113990602-113990624 TTAGTTAATCCCAACACTTTGGG + Intergenic
1089312075 11:117565023-117565045 CCTGTTAATCCCAACACTTTGGG - Intronic
1089523272 11:119079832-119079854 GTGGCTCATCCCAGCACTTTGGG - Intronic
1089896943 11:121940160-121940182 CCTGTTAATCCCAACACTTTGGG - Intergenic
1091207184 11:133829904-133829926 CCAGTTCCTCCCAACAATTTTGG + Intergenic
1091644070 12:2260216-2260238 CTGGTTAATCCCAGCACTTTAGG + Intronic
1092069706 12:5622702-5622724 GTGGCTCATCCCAGCACTTTGGG + Intronic
1093468419 12:19475048-19475070 GTGGTTAATCCCAGCACTTTGGG - Intronic
1096023452 12:48341219-48341241 CTGGTTCATTCCACCAATTGTGG + Exonic
1096697375 12:53358422-53358444 CTGTTTAATCCCAGCACTTTGGG + Intergenic
1097928221 12:65155454-65155476 GTGGCTCACCCCAACACTTTGGG + Intergenic
1098338330 12:69425973-69425995 GTGGTTCACCCCAGCATTTTGGG + Intergenic
1099227502 12:79987114-79987136 CTGGAACATTGCAACAATTTGGG - Intergenic
1099467225 12:83002574-83002596 CTTTTTCATCCCAAAAATTATGG + Intronic
1101482320 12:105109867-105109889 GTGGCTCACCCCAACACTTTAGG - Intronic
1102128693 12:110507101-110507123 GTGGCTCATCCCAGCACTTTGGG - Intronic
1102167398 12:110817692-110817714 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1102371298 12:112384052-112384074 GTGGGTAATCCCAACACTTTGGG + Intergenic
1102475224 12:113184563-113184585 CCTGTTAATCCCAACACTTTGGG + Intronic
1102477577 12:113198823-113198845 GTGGCTCATCCCAACCATTTGGG + Intronic
1102917011 12:116761606-116761628 CAGGTTCATCCCAGCAACCTGGG + Intronic
1103756224 12:123209529-123209551 CCTGTTCATCCCAGCTATTTGGG - Intronic
1103777577 12:123377740-123377762 CCTGTTAATCCCAACACTTTGGG + Intergenic
1105301435 13:19138762-19138784 CTGGTTAATTCCAGCACTTTGGG - Intergenic
1105698077 13:22910267-22910289 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1107080073 13:36365296-36365318 GTGGTTCATCCCAAAAAATGGGG - Intronic
1108225167 13:48282020-48282042 CCAATTCAACCCAACAATTTAGG - Intergenic
1108381310 13:49857240-49857262 CTGGGAAAGCCCAACAATTTGGG - Intergenic
1108489531 13:50967213-50967235 CTGGTTCATCTAAAGAGTTTAGG - Intronic
1108604929 13:52027997-52028019 CTGGTAAATCCCAGCACTTTGGG + Intronic
1108618297 13:52157424-52157446 CTGGTTCATGCCAGAAACTTGGG - Intronic
1109956629 13:69576438-69576460 TTGCTTCATCCCATAAATTTTGG - Intergenic
1110425143 13:75358587-75358609 CTTGTTAATCCCAGCACTTTGGG + Intronic
1110681520 13:78319213-78319235 TTGGCTCTTCCAAACAATTTTGG + Intergenic
1110686886 13:78386127-78386149 CTAGGTCATCCCAGCACTTTGGG + Intergenic
1112837285 13:103531660-103531682 CTTGTCCATCCCAAGAATTGGGG + Intergenic
1113313266 13:109153497-109153519 GTGGCTCATCTCAACACTTTGGG + Intronic
1114458060 14:22869915-22869937 CTTGTTAATCCCAGCACTTTGGG + Intergenic
1115484057 14:33892595-33892617 GTGGCTCATGCCAACACTTTGGG + Intergenic
1115531271 14:34330042-34330064 CAGGTGCATGCCAACAAGTTTGG - Intronic
1115869635 14:37785732-37785754 CTGGTTTATCCCCATATTTTTGG + Intronic
1117249339 14:53920100-53920122 CTATTTAATCCCAACATTTTGGG - Intergenic
1119020218 14:71104668-71104690 CTGGGTAATCCCAGCACTTTGGG + Intronic
1119377526 14:74206671-74206693 GTGGCTCATCCCAATACTTTGGG - Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1120869108 14:89321316-89321338 CTGGGTAATCCCAGCACTTTGGG + Intronic
1121194429 14:92057156-92057178 GTGGCTCATCCCAGCACTTTGGG + Exonic
1121198085 14:92093153-92093175 GTGGCTCATGCCAACAGTTTGGG - Intronic
1123865902 15:24519304-24519326 CTGGCTCATGCCAGCACTTTGGG + Intergenic
1125183757 15:36907525-36907547 CTGGTCCATCCAAACACTTCTGG - Intronic
1125199287 15:37086478-37086500 CTGGTTCTTCCAAATAAATTGGG + Intronic
1125623729 15:41088361-41088383 CTTGTTAATCCCAGCACTTTGGG - Intronic
1126283301 15:46981893-46981915 CTGGTTTTTTCCATCAATTTTGG - Intergenic
1127181241 15:56420563-56420585 CTGTTTAATCCCAGCACTTTAGG - Intronic
1127429308 15:58886545-58886567 GTGGCTCATGCCAACACTTTGGG - Intronic
1127449307 15:59101255-59101277 GTGGTTCATTCCAGCACTTTGGG + Intergenic
1128147777 15:65342032-65342054 CCTGTTAATCCCAACACTTTGGG - Intronic
1128329208 15:66744936-66744958 CTGGTTCTTGCCAAGAATCTGGG + Intronic
1128503258 15:68244792-68244814 GTGGTTCATGCCAGCACTTTCGG + Intronic
1129405742 15:75316139-75316161 ATGTGTAATCCCAACAATTTGGG - Intergenic
1132397621 15:101486221-101486243 GTGGCTCATCCCAGCACTTTGGG - Intronic
1132427166 15:101727462-101727484 ATAGTTAATCCCAACACTTTGGG - Intergenic
1133069789 16:3237810-3237832 GTGGCTCATCCCAGCACTTTTGG + Intergenic
1133124243 16:3634772-3634794 CCTGTTAATCCCAACACTTTGGG - Intronic
1133341625 16:5040262-5040284 CTGGTTCATGCCTATAATCTCGG + Intronic
1134447608 16:14342805-14342827 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1135226631 16:20664970-20664992 CAGGTGCATCTCAACGATTTTGG - Intronic
1136272438 16:29156389-29156411 CTGGGTAATCCCAGCACTTTGGG - Intergenic
1136332844 16:29592654-29592676 ATGGTTCATCTGAATAATTTTGG - Intergenic
1136358699 16:29763626-29763648 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1136447536 16:30332743-30332765 ATGGTTCATCTGAATAATTTTGG - Intergenic
1137241080 16:46654965-46654987 GTGGTTCATCCCAGCACTTTGGG - Intergenic
1137454128 16:48605287-48605309 CTGTGTAATCCCAACACTTTGGG - Intronic
1137631121 16:49946290-49946312 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1138509685 16:57501166-57501188 GTGGCTCATGCCAACACTTTGGG + Intergenic
1139416621 16:66816422-66816444 CTGGCTCATCCCAGCACTTTGGG - Intronic
1139461180 16:67123665-67123687 GTGGTTCATGCCAGCACTTTGGG - Intronic
1139971651 16:70780113-70780135 CTGGGTAATCCCAGCACTTTGGG - Intronic
1140548759 16:75840257-75840279 CTGGCACATCCCAGAAATTTGGG + Intergenic
1142650737 17:1349871-1349893 CCGGTTAATCCCAGCACTTTGGG - Intronic
1143902927 17:10187982-10188004 CAGTTTCATCCCAGCACTTTGGG + Intronic
1144681588 17:17199447-17199469 TTGGTTCATTCCAACAACCTAGG + Intronic
1144833946 17:18147188-18147210 CTGTTTCTTCCCTATAATTTGGG + Intronic
1146202213 17:30868762-30868784 CTGCTTAATCCCAGCACTTTGGG - Intronic
1146235361 17:31154994-31155016 GTGGCTCATCCCAGCACTTTCGG - Intronic
1146898502 17:36564001-36564023 CCTGTTAATCCCAACACTTTGGG - Intronic
1146976999 17:37122010-37122032 GTGGCTCATCCCAACACTTTGGG + Intronic
1147879464 17:43644654-43644676 GTGGCTCATCCCAGCACTTTGGG + Intronic
1148293219 17:46475321-46475343 CTGCTCCATGCCATCAATTTTGG - Intergenic
1148654268 17:49271572-49271594 GTGGCTCATGCCAGCAATTTGGG + Intergenic
1149326521 17:55535804-55535826 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1149469007 17:56901234-56901256 CTGCTTCATCCTGACATTTTAGG - Intronic
1149900158 17:60469066-60469088 CTAGTTTATCCCAGCACTTTGGG + Intronic
1150104577 17:62452867-62452889 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1150464064 17:65376917-65376939 CTGGATAATCCCAGCACTTTGGG - Intergenic
1151420714 17:73995501-73995523 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1151467067 17:74292678-74292700 GTGGTTCATCCCAGCACTTTGGG - Intronic
1151648220 17:75448390-75448412 CTGTTTAATCCCAGCACTTTGGG - Intronic
1152847082 17:82607847-82607869 GTGTCTCATCCCAACACTTTGGG + Intronic
1153187611 18:2502236-2502258 CTGGGTAATCCCAGCACTTTGGG - Intergenic
1153805984 18:8708423-8708445 CTGGATCTTCCCAACAACATAGG + Intronic
1154982464 18:21514694-21514716 CTTGGTAATCCCAACACTTTGGG - Intronic
1155320727 18:24616242-24616264 CTGGTAGCTCCCAACACTTTGGG - Intergenic
1156030537 18:32707526-32707548 ATTGTTTATACCAACAATTTAGG - Intronic
1157272767 18:46289343-46289365 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1157917688 18:51683781-51683803 CTTGTTAATCCCAGCACTTTGGG - Intergenic
1159749464 18:72282320-72282342 CTGGCTCACCCCAATATTTTGGG + Intergenic
1161776758 19:6267361-6267383 GTGGTTCATGCCAGCACTTTGGG - Intronic
1162130758 19:8524936-8524958 CTTGTTAATCCCAGCACTTTCGG + Intronic
1162586394 19:11561577-11561599 CTGGCCCATCCCAGCACTTTGGG + Intronic
1162848629 19:13413617-13413639 CCTGTTAATCCCAACACTTTGGG + Intronic
1163074300 19:14875556-14875578 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1163868928 19:19801529-19801551 CTGTTTAATCCCAGCACTTTGGG + Intronic
1164689618 19:30200874-30200896 CTGTGTAATCCCAACACTTTGGG + Intergenic
1165000128 19:32754207-32754229 CTGTTTAATCCCAGCACTTTGGG + Intronic
1165159723 19:33808873-33808895 CTTGGTCATCCCAGCACTTTGGG + Intronic
1165825503 19:38703497-38703519 CTGTTTAGTCCCAGCAATTTGGG - Intronic
1167341678 19:48920166-48920188 CTGGGTAATCCCAGCACTTTGGG - Intronic
1167916614 19:52744941-52744963 CTGGGTAATCCCAGCACTTTGGG + Intergenic
927671651 2:25073614-25073636 GTGGCTCATGCCAACACTTTGGG - Intronic
929609943 2:43263477-43263499 CGGATACATCCCAACATTTTAGG - Intronic
929848668 2:45559819-45559841 GTGGTTCATCCCAGTACTTTGGG + Intronic
929911524 2:46093651-46093673 CTGTGTAATCCCAGCAATTTGGG - Intronic
930212319 2:48653671-48653693 CTGGGTGATCCCAGCACTTTGGG + Intronic
930731224 2:54729874-54729896 CAGGCTAATCCCAGCAATTTGGG + Intronic
931280356 2:60785789-60785811 CTTGTTAATCCCAGCACTTTGGG - Intronic
931363559 2:61599239-61599261 GTGGCTCATCCCAGCACTTTGGG + Intergenic
931743784 2:65273835-65273857 TTGTGTAATCCCAACAATTTGGG + Intergenic
932128289 2:69164857-69164879 CTGTTTCATTCTAAAAATTTTGG - Intronic
933222964 2:79712535-79712557 CTGCCTCATCCCAAGGATTTGGG - Intronic
933298113 2:80513711-80513733 CTAGTTCTGCCTAACAATTTGGG - Intronic
934543630 2:95196482-95196504 CATGTTCATCCCAAAAAGTTCGG + Intergenic
935264008 2:101379272-101379294 CTAGTTCATCCCACCTAGTTAGG - Intronic
937598299 2:123696682-123696704 CTGGTGCATGCTAATAATTTTGG - Intergenic
939258890 2:139781454-139781476 CTTGATCACCCCAACAACTTGGG - Intergenic
941356615 2:164500977-164500999 CATGTTCATCCTAATAATTTTGG + Intronic
941825136 2:169886708-169886730 GTGGCTCCTGCCAACAATTTAGG - Intronic
943215561 2:185029063-185029085 ATGCTTCATCCCAGCACTTTGGG - Intergenic
943818458 2:192286703-192286725 CTGGGTAATGCTAACAATTTGGG + Intergenic
944040422 2:195347824-195347846 CTTGTTAATCCCAGCACTTTGGG + Intergenic
945583014 2:211620844-211620866 GTGGCTCATCCCACCACTTTGGG + Intronic
945847187 2:214959744-214959766 CTGGGAGATCCCAGCAATTTGGG - Intronic
946223825 2:218251469-218251491 CTCCTTAATCCCAACACTTTGGG - Intronic
948548723 2:238753080-238753102 GTGGCTCATCCCAGCACTTTGGG - Intergenic
1169011420 20:2254076-2254098 ATGGCTCATCCCAGCACTTTGGG - Intergenic
1172306917 20:33887232-33887254 CTGGTGTATCCCAGCATTTTGGG + Intergenic
1172878150 20:38178780-38178802 CCGGGTAATCCCAACACTTTGGG + Intergenic
1174589931 20:51636828-51636850 CGGGGTAATCCCAACACTTTGGG + Intronic
1175115024 20:56676049-56676071 ATGGTGGATCCCAGCAATTTGGG - Intergenic
1175214743 20:57386085-57386107 GTGGGTAATCCCAACACTTTGGG - Intergenic
1177450717 21:21261685-21261707 TTGCTGTATCCCAACAATTTTGG - Intronic
1180925018 22:19547752-19547774 CTGTATCATCCCAGCACTTTGGG - Intergenic
1180932472 22:19601981-19602003 CCTGTTAATTCCAACAATTTGGG - Intergenic
1183338230 22:37263204-37263226 GTGATTCATCCCAGCACTTTGGG + Intergenic
1184083193 22:42240314-42240336 CTGGTTTACCCAAACAATTCAGG + Intronic
1184793186 22:46714009-46714031 CCTGTTAATCCCAACACTTTGGG + Intronic
1184830160 22:46980438-46980460 CTGGGTAATCCCAGCACTTTGGG - Intronic
949751747 3:7359592-7359614 TTGGGTAATCCCAACACTTTGGG - Intronic
950803808 3:15578938-15578960 CTGGTTCATACCCAGAATTAGGG - Intronic
951208608 3:19949458-19949480 CCGGTAAATCCCAACACTTTGGG - Intronic
952118321 3:30211518-30211540 GTGGTTCATGCCAGCACTTTAGG + Intergenic
953512593 3:43557843-43557865 GTGGCTCATCCCAACACTTTGGG + Intronic
954896799 3:53982027-53982049 GTGGTTCATCCCAGCACTTTGGG - Intergenic
956494895 3:69814586-69814608 CTGGTTCATCCCAACAATTTGGG - Intronic
956500727 3:69881979-69882001 CTGGTTCTTACAAACAACTTGGG - Intronic
956541091 3:70340517-70340539 ATTGTTTGTCCCAACAATTTAGG - Intergenic
956801427 3:72762932-72762954 GTGGCTCATCCCAGCACTTTGGG - Intronic
958012133 3:87893270-87893292 GGGGTTGATACCAACAATTTTGG - Intergenic
963297378 3:143560632-143560654 CCTTTTCATCCCAACAATATTGG + Intronic
963319994 3:143801161-143801183 CTGACTCATCCCAACCCTTTTGG + Intronic
965571157 3:170175376-170175398 GTGGCTCATCCCAGCACTTTGGG + Intronic
965613604 3:170570185-170570207 GTGGTTCATGCCAGCACTTTGGG + Intronic
966387694 3:179418208-179418230 CTGATTAATCCCAGCACTTTGGG + Intronic
966742565 3:183248003-183248025 GTGGGTCTTCCCAACATTTTCGG - Intronic
966987382 3:185193999-185194021 TTGGTTCTTCACATCAATTTGGG - Intronic
967454143 3:189662232-189662254 TTGCTGCATCCCAACGATTTTGG + Intronic
969565158 4:7972951-7972973 CAGGCGCATTCCAACAATTTGGG + Intronic
970655526 4:18226131-18226153 ATGGTTAATCCCAGCACTTTGGG - Intergenic
972152296 4:36108155-36108177 CCTGTTCATCCCACCACTTTGGG - Intronic
975395833 4:73872190-73872212 CTGGATCATCCCAAGAAGCTGGG + Intergenic
975636381 4:76453524-76453546 GTGGCTCATCCCAGCACTTTGGG - Intronic
975737294 4:77393806-77393828 CTGCTCCATGCCAACAATCTGGG + Intronic
976223102 4:82773828-82773850 GTGGCTCATCCCAGCACTTTGGG + Intronic
976327543 4:83789650-83789672 CTGTGTAATCCCAGCAATTTGGG + Intergenic
978451979 4:108844146-108844168 ATGGCTCATGCCAACACTTTGGG - Intronic
978572278 4:110151176-110151198 CTGGTTGGTCCCAAGCATTTTGG - Intronic
979234674 4:118386227-118386249 ATGCTTAATCCCAACACTTTAGG + Intergenic
979914074 4:126407734-126407756 TTGGTGCATCCCAAAGATTTTGG - Intergenic
982164366 4:152601754-152601776 CTGGTAAATCCCAGCACTTTGGG + Intergenic
982377767 4:154713293-154713315 GTGGTTCATCCCAGCACTTTGGG + Intronic
983814683 4:172108750-172108772 ATGGCTCATCCCAGCACTTTGGG + Intronic
983919521 4:173331078-173331100 CCTGTTAATCCCAACACTTTGGG + Intergenic
986197641 5:5552724-5552746 CAGTGTCATCCCAGCAATTTGGG - Intergenic
986575410 5:9207584-9207606 CTGACTGATACCAACAATTTAGG - Intronic
987023187 5:13896027-13896049 GTAGATCATCCCAATAATTTAGG + Intronic
987336331 5:16900997-16901019 GTGGCTCATGCCAACACTTTGGG - Intronic
990004907 5:50934762-50934784 GTGGCTCATCCCAGCACTTTGGG + Intergenic
991679232 5:69122135-69122157 CCTGTTAATCCCAGCAATTTGGG + Intronic
993713310 5:91249452-91249474 GTGGCTCATGCCAACACTTTGGG - Intergenic
994367708 5:98934242-98934264 ATGGCTCATCCCAGCACTTTGGG + Intergenic
996870307 5:128183933-128183955 TTGGTTGATCCCAAGCATTTGGG - Intronic
997178427 5:131802870-131802892 CTTGTTAATCCCAACACTTTGGG + Intergenic
997244047 5:132331071-132331093 CTGGGTAATCCCAGCACTTTGGG + Intronic
998732146 5:145090761-145090783 CTGGCTCATGCCAACCCTTTTGG - Intergenic
1000054196 5:157589680-157589702 CTGTATAATCCCAGCAATTTGGG - Intergenic
1000313774 5:160069602-160069624 CTGTGTAATCCCAACACTTTGGG + Intronic
1000613346 5:163399831-163399853 CCTGTTAATCCCAGCAATTTGGG + Intergenic
1001156999 5:169281217-169281239 GTGGCTCATCCCAGCACTTTGGG + Intronic
1001708831 5:173761773-173761795 CTGGTTCATCCCAGCATTTTGGG + Intergenic
1002343836 5:178534519-178534541 CCTGTTAATCCCAGCAATTTGGG + Intronic
1002497847 5:179627624-179627646 CTGGCATATCCCAGCAATTTGGG - Intronic
1002609786 5:180408852-180408874 GTGGCTCATCCCAGCACTTTGGG + Intergenic
1004274118 6:14220836-14220858 ATGGTTCATCCCAGCACTTTGGG - Intergenic
1004389720 6:15199726-15199748 CTGCTCCATCCTAACAATTGAGG - Intergenic
1004607747 6:17209627-17209649 ATGGGTAATCCCAACACTTTGGG - Intergenic
1005468311 6:26136980-26137002 CCTGTTAATCCCAGCAATTTGGG - Intronic
1006881990 6:37348329-37348351 GTGGTTCACACCAACACTTTGGG + Intergenic
1008805081 6:55417152-55417174 CTGGTTCATCTTGATAATTTGGG + Intergenic
1008943952 6:57076630-57076652 CTGTCTCATCCCAGCACTTTGGG - Intergenic
1009017779 6:57923503-57923525 CCTGTTCATCCCAGCACTTTGGG + Intergenic
1010054391 6:71547667-71547689 CTCAATCATCACAACAATTTTGG - Intergenic
1010106170 6:72170600-72170622 GTGGCTCATCCCAGCACTTTGGG - Intronic
1010421098 6:75676815-75676837 CTGGTTCCTTCCAATAACTTAGG + Intronic
1011070467 6:83376235-83376257 ATGGCTCATGCCAACACTTTGGG + Intronic
1012641395 6:101621191-101621213 CCTGTAAATCCCAACAATTTGGG + Intronic
1015059649 6:128948080-128948102 CTAGTTCATAGCAAGAATTTAGG - Intronic
1015639798 6:135319214-135319236 GTGGCTCATGCCAACACTTTGGG + Intronic
1015884615 6:137904092-137904114 GTGGCTCATGCCAACAATTTGGG - Intergenic
1016549248 6:145258510-145258532 GTGGTTCACACCAGCAATTTAGG + Intergenic
1016936671 6:149453023-149453045 ATGGGTAATCCCAACACTTTGGG + Intronic
1017107701 6:150903681-150903703 CTGGGTAATCCCAGCACTTTGGG - Intronic
1018608149 6:165620761-165620783 CTGGGTAATCCCAACCCTTTGGG + Intronic
1020815575 7:12901431-12901453 CTGGTACATTCAGACAATTTCGG + Intergenic
1021064341 7:16155075-16155097 CTGGCTCATCCCAGCATTTTGGG - Intronic
1022344123 7:29497339-29497361 CTGGTTAATACCAGCAATTAGGG - Intronic
1022656151 7:32320982-32321004 CTGATTCAGGCCACCAATTTTGG + Intergenic
1024885657 7:54139264-54139286 CTGTCTCTTCCCAACATTTTGGG + Intergenic
1025754067 7:64317589-64317611 ATGGTTCCTTCCAACAAATTTGG + Intronic
1025805503 7:64827501-64827523 ATGGTTAATCCCAGCACTTTGGG - Intronic
1025814620 7:64900017-64900039 GTGGCTCATCCCAGCACTTTGGG - Intronic
1027150359 7:75729207-75729229 CTCAATAATCCCAACAATTTGGG + Intronic
1028922825 7:96325775-96325797 GTGGTTCATGCCTATAATTTCGG - Intergenic
1029293631 7:99521453-99521475 CCTGTTAATCCCAACACTTTGGG - Intronic
1029648442 7:101873445-101873467 CTTGGTAATCCCAACATTTTGGG - Intronic
1030065073 7:105653186-105653208 GTGGCTCATCCCAGCACTTTGGG + Intronic
1030120559 7:106106584-106106606 GTGGTTCATCTCAGCATTTTGGG + Intronic
1031319803 7:120310675-120310697 GTGGCTCATCCCAGCACTTTGGG + Intronic
1032033744 7:128506083-128506105 GTGGCTCATCCCAGCACTTTGGG - Intronic
1032208393 7:129889722-129889744 CTATTTAATCCCAACACTTTGGG + Intronic
1033274972 7:139964957-139964979 GTGGCTCATCCCAGCACTTTGGG + Intronic
1034144562 7:148857490-148857512 CTTGTTAATCCCAGCACTTTGGG + Intronic
1034183213 7:149154728-149154750 GTGGCTCATCCCAGCACTTTGGG + Intronic
1035091252 7:156313457-156313479 CTGCTTCATCCCACAAATTTTGG + Intergenic
1035831313 8:2697303-2697325 CTGCTTCATGCCACTAATTTTGG + Intergenic
1037796656 8:22001053-22001075 GTGGCTCATCCCAGCACTTTGGG + Intronic
1037943354 8:22971442-22971464 GTGGCTCATCCCAGCACTTTGGG - Intronic
1039726573 8:40223852-40223874 TTGGCTCATCCCAGCACTTTGGG - Intergenic
1040452642 8:47563429-47563451 CTGTATAATCCCAACATTTTGGG - Intronic
1043531381 8:81154724-81154746 CCTGTTAATCCCAACACTTTGGG - Intergenic
1044691633 8:94885976-94885998 GTGGTTAATCCCAGCACTTTGGG - Intronic
1046340256 8:112845075-112845097 CTGGTTCTTACCAACAAAGTAGG - Intronic
1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG + Intronic
1047415666 8:124662807-124662829 CTGTTTCCTCCCAAGAATTTTGG - Intronic
1049822177 8:144642224-144642246 CCTGTTAATCCCAGCAATTTGGG + Intergenic
1049920566 9:359881-359903 CTCTTTCAGCCAAACAATTTTGG - Intronic
1051410546 9:16785655-16785677 GTGGCTCATCCCAGCACTTTGGG - Intronic
1051677571 9:19573602-19573624 CTGCTTTAGCCCAACATTTTAGG - Intronic
1052058325 9:23927768-23927790 CCTGTTAATCCCAACACTTTGGG - Intergenic
1052742155 9:32403653-32403675 CTGGTTTAATCCAAAAATTTTGG + Intronic
1053080142 9:35168930-35168952 CCTGTTAATCCCAACACTTTAGG - Intronic
1053208749 9:36209800-36209822 TTGGTTCATTCAAACAATGTGGG + Intronic
1053231524 9:36414423-36414445 CCTGTTCATCCCAGCACTTTGGG + Intronic
1055043138 9:71897269-71897291 GTGGCTCATCCCAGCACTTTGGG + Intronic
1055564489 9:77554600-77554622 ATACTTCATCCAAACAATTTTGG + Intronic
1056524853 9:87433430-87433452 CTCCTTCCTCCCAACACTTTTGG + Intergenic
1056638237 9:88348700-88348722 CTGGCCAATCCCAACACTTTGGG - Intergenic
1056663556 9:88562491-88562513 GTGGCTCATCCCAGCACTTTGGG + Intronic
1056690664 9:88806267-88806289 ATGGGTAATCCCAACACTTTGGG - Intergenic
1057622374 9:96647663-96647685 CTGGTTCATGCCACCAATCCTGG + Intronic
1057962347 9:99468964-99468986 CCTGTTAATCCCAGCAATTTGGG + Intergenic
1058524660 9:105844874-105844896 GTGGCTCATGCCAACACTTTGGG + Intergenic
1058968690 9:110060360-110060382 CTGGCCCATCCCAGCACTTTGGG - Intronic
1059135122 9:111798337-111798359 GTGTGTAATCCCAACAATTTGGG + Intergenic
1059526857 9:115000110-115000132 CTTTTTCCTCCCACCAATTTCGG + Intergenic
1060842864 9:126807893-126807915 CTTGTTAATCCCAGCACTTTGGG - Intronic
1061562696 9:131416363-131416385 CCTGTTAATCCCAACACTTTGGG - Intronic
1062515887 9:136935472-136935494 CTTGTTAATCCCAGCACTTTGGG - Intronic
1187049623 X:15682904-15682926 GTGGCTCATCCCAGCACTTTTGG + Intergenic
1187314409 X:18179420-18179442 CTTGTTAATCCCAGCAATCTGGG - Intronic
1187759881 X:22570653-22570675 TTGTTTCATCCCACAAATTTTGG - Intergenic
1188320612 X:28732610-28732632 TTGTTTCATCCCAGCACTTTGGG + Intronic
1189451524 X:41136418-41136440 CCTGTTAATCCCAACACTTTGGG - Intronic
1191637894 X:63397562-63397584 ATGATTGATCCCATCAATTTAGG + Intergenic
1192889732 X:75377235-75377257 GTGGCTAATCCCAACACTTTGGG + Intronic
1193094767 X:77535275-77535297 CTTATTCATACCAACAATTTGGG - Intronic
1194875368 X:99180681-99180703 CAGGTGCATCCCAGCAACTTGGG - Intergenic
1196708216 X:118735805-118735827 GTGGCTCATCCCAGCACTTTGGG - Intronic
1197207494 X:123802515-123802537 GTGGCTCATCCCAACACTTTGGG + Intergenic
1198180940 X:134208432-134208454 GTGGTTCATCCCAACACTTTGGG - Intergenic
1198249544 X:134866840-134866862 CTGGTTAATCCTACCACTTTGGG - Intergenic
1199759144 X:150891958-150891980 CTGGGTAATCCCAGCACTTTGGG + Intronic