ID: 956495607

View in Genome Browser
Species Human (GRCh38)
Location 3:69822717-69822739
Sequence GGGTGGGTGAATTCAAAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 189}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956495607 Original CRISPR GGGTGGGTGAATTCAAAATG TGG (reversed) Intronic
901824250 1:11850297-11850319 GGGTGGGAGAATCCAGAATCCGG + Intergenic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902267845 1:15281100-15281122 GGGTGCCAGGATTCAAAATGGGG - Intronic
904936677 1:34135229-34135251 GTGTGTGTGATTTCAACATGAGG - Intronic
905150646 1:35924481-35924503 GGGAGGCACAATTCAAAATGAGG + Exonic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
905769844 1:40630457-40630479 GGGTGACTGAATTCAAAGTCTGG - Intronic
906373129 1:45271302-45271324 GGTTGAGTGATTTCAATATGAGG - Intronic
906520787 1:46465833-46465855 GGGTGAGTGAAAAAAAAATGTGG + Intergenic
907582562 1:55585074-55585096 GGGTGGGGGAATTGAAGCTGTGG - Intergenic
909665085 1:78123310-78123332 TAGTGAGTGAGTTCAAAATGGGG + Intronic
912769229 1:112447334-112447356 GTGTGTGTGAATTAAAAGTGGGG - Intronic
914954787 1:152151799-152151821 GGGTGAAAGAATTCAAAATCTGG - Intergenic
915812011 1:158923131-158923153 GGGTAGGTGACTGCAAAGTGAGG + Intergenic
916847988 1:168672825-168672847 TGGTGGATGAATTCACATTGTGG + Intergenic
917195272 1:172457645-172457667 GGGTTGGTGCATTCTAAATGTGG - Intronic
917247578 1:173021363-173021385 GAGTGGGTAAAGTGAAAATGGGG - Intergenic
918057768 1:181037025-181037047 GGGTGGGTGTAATCAGACTGGGG + Intronic
920712441 1:208308170-208308192 GGCAGGGTGAATTCAACCTGAGG + Intergenic
924518027 1:244782268-244782290 GGGTGAGAGAATGCAAACTGAGG - Intergenic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1064003361 10:11681787-11681809 GGGTGGGTAAATCCAATCTGGGG - Intergenic
1068775374 10:60862942-60862964 TGGTGGGTGAAATAAAAATCAGG + Intergenic
1069887031 10:71630362-71630384 GGGTGGGTGAATTGACCCTGAGG + Intronic
1069928313 10:71866227-71866249 GGGTCGGTGAAGTTTAAATGAGG - Intergenic
1071887176 10:89963922-89963944 GGATGGGTGAACACAACATGAGG + Intergenic
1074101968 10:110360741-110360763 GGGAGGGTGGTTTGAAAATGTGG - Intergenic
1076200558 10:128554441-128554463 GGGTGGGTTAATGTAAACTGAGG + Intergenic
1078843608 11:15101801-15101823 GGGTGGGTGAAGAAAAAATTAGG + Intergenic
1079195148 11:18319741-18319763 GGGTGGGTGATATGAAAATGAGG + Intronic
1079953802 11:26837637-26837659 GGGTTATTGTATTCAAAATGTGG - Intergenic
1080415973 11:32070384-32070406 GGTGGGGTGAATGCAAAAGGAGG - Intronic
1082741598 11:56917351-56917373 GGGAGGCTGAATTCCAACTGTGG - Intergenic
1083003016 11:59314317-59314339 GGGTGGGTAAAATCAGAATGGGG - Intergenic
1083915721 11:65742395-65742417 GCGTGAGTCAATTCAAATTGAGG + Intergenic
1084879179 11:72158103-72158125 AGGTGGGACAATTCAAAGTGGGG - Intergenic
1085709225 11:78814048-78814070 GGGAGGGTGAATTCACTGTGGGG - Intronic
1086789030 11:91011255-91011277 GGGTGATTAAATTAAAAATGTGG + Intergenic
1088703468 11:112436429-112436451 TGATGAATGAATTCAAAATGTGG + Intergenic
1088915566 11:114225231-114225253 GGATGGGAGAATTTAAAAGGTGG + Intronic
1093861970 12:24176797-24176819 GGGATGGGGAATTCAAAATATGG - Intergenic
1094463534 12:30725109-30725131 GGTTGGGTGTAATAAAAATGGGG - Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1095331978 12:40977137-40977159 AGGTGGGACAACTCAAAATGGGG + Intronic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1098045985 12:66401100-66401122 GGGTGGCTGAATTCAGAGTGAGG + Intronic
1103114893 12:118318838-118318860 CAGTGGGTGAATGGAAAATGTGG + Intronic
1105672810 13:22639103-22639125 AAGTGGTTGATTTCAAAATGTGG + Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106792588 13:33170741-33170763 GGGTGGGGGAATATGAAATGAGG - Intronic
1107218969 13:37957185-37957207 GGATGGGAGAATGCATAATGAGG + Intergenic
1107608861 13:42092353-42092375 GGATGGGTGGATAAAAAATGTGG + Intronic
1108125194 13:47234902-47234924 GAGTGGCTGAGTTCTAAATGGGG - Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1108772509 13:53721548-53721570 AGGTGGGAGAAACCAAAATGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112204355 13:97309362-97309384 GGGGTGGTCAATTTAAAATGAGG + Intronic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1113670781 13:112174536-112174558 GGGTGGGGGAATAAAAAATGAGG + Intergenic
1114067042 14:19069565-19069587 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
1114095223 14:19330463-19330485 GGGTGGGTCATTTCAAAGTGAGG - Intergenic
1114733140 14:25015854-25015876 GGGAGGCTGAACTCAAAGTGAGG + Intronic
1115984152 14:39086189-39086211 TTGTGGTTGTATTCAAAATGTGG - Intronic
1116090565 14:40299569-40299591 GGGTGAGGGAATTCACCATGTGG + Intergenic
1121825769 14:97008400-97008422 GGGTGGGTGAATCCACTTTGGGG - Intergenic
1123465371 15:20511092-20511114 ATGTGGGTGGATTCAAAGTGAGG - Intergenic
1123652745 15:22489945-22489967 ATGTGGGTGGATTCAAAGTGAGG + Intergenic
1123683744 15:22782810-22782832 ACGTGGGTGGATTCAAAATGAGG + Intronic
1123743168 15:23298809-23298831 ATGTGGGTGGATTCAAAGTGAGG + Intergenic
1124276097 15:28327071-28327093 ATGTGGGTGGATTCAAAGTGAGG - Intergenic
1124306603 15:28584536-28584558 ATGTGGGTGGATTCAAAGTGAGG + Intergenic
1125642097 15:41239695-41239717 GGCTGCTTAAATTCAAAATGTGG - Intronic
1128320445 15:66690049-66690071 GGGTGAGATAATTCCAAATGAGG - Intergenic
1130074485 15:80676891-80676913 AGGTGGGACAACTCAAAATGGGG - Intergenic
1130850854 15:87792303-87792325 GGATGGGTGTTTTCCAAATGGGG - Intergenic
1131695752 15:94876030-94876052 AGGTGGGTGGTTTCAAAGTGTGG + Intergenic
1133637392 16:7681271-7681293 GGGTGGATGAATGGAAAAAGAGG + Intronic
1136653822 16:31696693-31696715 GGTTGGTTGGACTCAAAATGAGG - Intergenic
1137458708 16:48638344-48638366 AGGATGGTGAATTCAATATGAGG - Intergenic
1139860177 16:70014083-70014105 AGGTGGGTGAATTTTAAAAGAGG - Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1143403001 17:6657877-6657899 GGATGGGTTAATTCTGAATGTGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1150499099 17:65632768-65632790 TGGTTGGTCAATTCAAAGTGGGG - Intronic
1151063674 17:71126034-71126056 GGGTGGGGGTATTCTATATGTGG + Intergenic
1151120535 17:71788054-71788076 TGCTGGGTGAATTCACAGTGGGG + Intergenic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1156401041 18:36740948-36740970 CGGAGGGTGAATTGACAATGAGG + Intronic
1158084593 18:53635822-53635844 AGGTGGGACAATTCAAAGTGTGG - Intergenic
1158937687 18:62379785-62379807 GGGTGGGTGGCTTGAACATGAGG + Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1160115253 18:76073304-76073326 TGGTGGGTGAAGTAAAAAAGTGG - Intergenic
1161556431 19:4945237-4945259 GGGTGACTGAGTTCTAAATGAGG - Intronic
1161656342 19:5517876-5517898 GGGAGGGTGGATGGAAAATGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1162164736 19:8744614-8744636 GGTTGGGTGGATTGAAAGTGGGG + Intergenic
1162165807 19:8752082-8752104 GGTTGGGTGGATTGAAAGTGGGG + Intergenic
1162166873 19:8759538-8759560 GGTTGGGTGGATTGAAAGTGGGG + Intergenic
1162167939 19:8766998-8767020 GGTTGGGTGGATTGAAAGTGGGG + Intergenic
1162168878 19:8773292-8773314 GGTTGGGTGGATTGAAAGTGGGG + Intergenic
1162170624 19:8786060-8786082 GGTTGGGTGGATTGAAAGTGGGG + Intergenic
1166418298 19:42612285-42612307 AGGTGGGACAATTCAAAGTGGGG - Intronic
1167450659 19:49566644-49566666 GGGTGTGTGCATTTAAAATGTGG + Intronic
925398499 2:3554193-3554215 GAGTGTGTGAAAACAAAATGTGG - Intronic
927017873 2:18985585-18985607 GGGTGGGTAAATTAACAATTTGG + Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931026286 2:58116268-58116290 AGGTGGGGGAATACAAAAGGAGG + Intronic
932582540 2:73001153-73001175 GGGAGGCTGATGTCAAAATGAGG + Intronic
933401983 2:81809912-81809934 GGGTGGGTCATTGAAAAATGAGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
933770930 2:85743504-85743526 GGATTGTTGAATTCAAGATGGGG + Intergenic
935024946 2:99268047-99268069 AGGTGGGACAACTCAAAATGGGG - Intronic
936175890 2:110219427-110219449 AGGTGTGTGATTTCCAAATGTGG + Intergenic
937310545 2:120900130-120900152 GGGAGGGTGGTTACAAAATGAGG + Intronic
938484436 2:131689657-131689679 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
940031284 2:149264684-149264706 GGGAGCCTGGATTCAAAATGAGG + Intergenic
940905659 2:159167272-159167294 TGGTGGGTGCATTCACCATGAGG + Intronic
941994865 2:171592831-171592853 GTCTGGCTGAGTTCAAAATGGGG - Intergenic
943830936 2:192460842-192460864 GGGTTGGTAAAATTAAAATGGGG - Intergenic
945632557 2:212299996-212300018 GGGAGGGGGAAATGAAAATGTGG - Intronic
946183291 2:217961696-217961718 GGTTGGGTGAATGAAGAATGGGG - Intronic
946299474 2:218813929-218813951 GAGTGGGTGTATGCAAAATGTGG - Intronic
947282981 2:228476944-228476966 GGGATGGTGAATCCAAAAGGTGG - Intergenic
947311671 2:228809686-228809708 AGGTGGGTGATTTCCAACTGAGG - Intergenic
948372109 2:237495959-237495981 GGGTGAGGGACTTCAGAATGTGG - Intronic
1172780829 20:37436201-37436223 GGGGGGGTGAATGCATGATGGGG - Intergenic
1173285009 20:41662397-41662419 GGGTGAGTGAATTCAAGAAATGG + Intergenic
1175349012 20:58305058-58305080 GGATGGGTGAGTAAAAAATGAGG - Intergenic
1177589660 21:23146035-23146057 AGGTGGGACAACTCAAAATGGGG + Intergenic
1177783632 21:25645498-25645520 GGGTGGGGGGAGTCAAACTGGGG + Intronic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1178513077 21:33223299-33223321 GGGTGGGTTAATCCGAAGTGGGG + Intergenic
1179526942 21:41985233-41985255 GTGTAGGTGAAATCAAAATCTGG + Intergenic
1180485519 22:15792149-15792171 GGGTGGGTCATTTCAAAGTGAGG + Intergenic
1183181208 22:36261137-36261159 GGCTGGGTGACTTCAACATCTGG + Intronic
1184993427 22:48185529-48185551 GTGTGGGTGACTCCAAAAGGTGG + Intergenic
950244662 3:11405155-11405177 GGCTGGGTGAATTCTGAATCAGG + Intronic
950944734 3:16933481-16933503 GAGTGGGTGAAGTCAAAATGGGG - Intronic
951314306 3:21169593-21169615 GGAAGTGTGTATTCAAAATGGGG - Intergenic
951915595 3:27797818-27797840 GGGTGGGTGACTTCTAGAAGAGG + Intergenic
956105170 3:65809905-65809927 GGGGTGGGGAATTCAGAATGGGG - Intronic
956495607 3:69822717-69822739 GGGTGGGTGAATTCAAAATGTGG - Intronic
959614681 3:108334073-108334095 GGGAGGGTGCAATGAAAATGGGG + Intronic
961765486 3:129207224-129207246 GGGTGGGGGAAGGGAAAATGGGG - Intergenic
962008185 3:131369119-131369141 GGTTGAGTGAATGGAAAATGAGG + Intergenic
965763874 3:172109611-172109633 GGGTGGTTGAATTGAAACTTAGG + Intronic
968074282 3:195808041-195808063 GGCTTGGTGTATTCAGAATGTGG - Intronic
968930911 4:3578269-3578291 GGGTGGGTGAATAGAATAGGTGG - Intronic
970693233 4:18643971-18643993 AAGTTGGTGAATTCAAGATGGGG - Intergenic
971239761 4:24877704-24877726 GTTTGGGAGAATTCAAAATGTGG - Intronic
971835393 4:31756500-31756522 GTGGGGGGGATTTCAAAATGTGG - Intergenic
972854338 4:43088676-43088698 GGGTGAGAGAAATTAAAATGGGG + Intergenic
973168650 4:47111271-47111293 GGGTGGGAGAGTCCAAACTGGGG + Intronic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
977103078 4:92843354-92843376 GAGTTCTTGAATTCAAAATGAGG - Intronic
977343496 4:95790130-95790152 AGGTGGGACAATTCAAAGTGGGG + Intergenic
978485359 4:109247361-109247383 GGGAGGGAGGATTGAAAATGTGG + Intronic
981816337 4:148834922-148834944 GAGTGGGTGAAGACAAAAAGTGG - Intergenic
983162243 4:164430856-164430878 GGGTGGCTGAATTAAGATTGGGG - Intergenic
984097097 4:175447343-175447365 AGGTAGCTGAATTCAAAATCTGG + Intergenic
985333218 4:188864087-188864109 GGGTGGGTTATTTCCAAATTAGG - Intergenic
986030414 5:3888219-3888241 ATGTGGGTGAAATGAAAATGGGG + Intergenic
986081679 5:4400974-4400996 AGGTGGGTGAATACAGGATGGGG + Intergenic
987525142 5:19038647-19038669 GGTTGGTTGAATTCACAATGTGG + Intergenic
988247514 5:28706642-28706664 GTGTGTGTAAATTCAAAATCTGG - Intergenic
990069504 5:51763159-51763181 GGTTGGCTGAATTCAGAATGAGG - Intergenic
991208145 5:64073703-64073725 GGATGATTGAATTTAAAATGTGG - Intergenic
993019721 5:82577113-82577135 GGGTGGGTGTATTCTTACTGTGG - Intergenic
993128577 5:83866941-83866963 GGGTGGTTTAATACAATATGTGG - Intergenic
994008707 5:94874691-94874713 GGGTGTGTGAGTTGAAAGTGAGG - Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
997661777 5:135594727-135594749 GAGTGGGTGAATACAAAACCTGG + Intergenic
997877015 5:137558643-137558665 GGGTGGGTGAGAGCAAAAGGTGG + Intronic
998201956 5:140132081-140132103 GGGAGGGGGAAATGAAAATGTGG - Intergenic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1001833263 5:174807476-174807498 GAGTGGCTGAATTCATAATCCGG + Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1006125504 6:31835213-31835235 GGGCGAGTGATTGCAAAATGGGG + Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007324989 6:41053078-41053100 GGGTGGGGGAATGGAAAATCTGG - Intronic
1009509677 6:64534016-64534038 GGGTGGGTTAATTAGAAAAGTGG + Intronic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1011715954 6:90105170-90105192 GGGTCAGTGAATGCAACATGGGG - Intronic
1015051130 6:128841751-128841773 GACAGGGTGAAGTCAAAATGAGG - Intergenic
1015961471 6:138653910-138653932 GGGTTGGTGAAATCAAATTAGGG - Intronic
1016687133 6:146894686-146894708 GGGTGGATGAATGCAATCTGTGG + Intergenic
1020438750 7:8195230-8195252 GGATGTGAGAATACAAAATGGGG + Intronic
1020768153 7:12352219-12352241 GGGTGGGTGAATTCAACTGAAGG - Intronic
1021147457 7:17106630-17106652 CGGTGGGACAACTCAAAATGGGG - Intergenic
1021188847 7:17596938-17596960 GGGTGGCTGATTTGCAAATGTGG - Intergenic
1022495749 7:30852048-30852070 TAGTGGGTGAGTTCAAAGTGGGG + Intronic
1024520033 7:50297444-50297466 AGGTGGGAGAGTTCAAAAGGAGG + Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1026837950 7:73650528-73650550 GGCAGAGTGAATTCCAAATGGGG - Intergenic
1028092467 7:86720600-86720622 GGGTAGATGAATTCAGAAGGAGG - Intronic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1028581980 7:92418089-92418111 GGGTGGGAGCATTCTAAATATGG - Intergenic
1036289278 8:7473181-7473203 AGGTGGGACAATTCAAAGTGGGG + Intronic
1036541174 8:9713060-9713082 GGGTGTGTGATTTAAAAATTTGG + Intronic
1037473987 8:19238111-19238133 GAGAGGGTGAAGGCAAAATGCGG + Intergenic
1039558129 8:38491505-38491527 GGGTGCCTGAAGTTAAAATGAGG - Intergenic
1043818821 8:84838229-84838251 TGGTGGGTGATTTCAAATAGAGG + Intronic
1047786524 8:128158800-128158822 TGGAGGCTGAATTCAAATTGAGG + Intergenic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1055602701 9:77936362-77936384 GGGTCGGTGTATTAAAAATAAGG - Intronic
1056200071 9:84266934-84266956 GGGTGGATGAAGACAAAAGGAGG - Intergenic
1056249772 9:84735603-84735625 AGTTGGATGAATTCAATATGTGG + Intronic
1056254865 9:84788719-84788741 GGGTGGGGGAATTCGAGAGGTGG + Intronic
1056325946 9:85479251-85479273 GGGTGGGAGAATTGTAGATGGGG - Intergenic
1056395402 9:86176729-86176751 TGGTGGGTGAATTAGAGATGGGG + Intergenic
1057164339 9:92914279-92914301 GGATGGGTTAATTCTGAATGTGG + Intergenic
1057904704 9:98974744-98974766 GGGTGGGTGTATTCCCACTGGGG - Intronic
1058123813 9:101168692-101168714 GGGTGGGTGAATGGATAAAGTGG + Intronic
1058553704 9:106143228-106143250 GGCTGAGGAAATTCAAAATGTGG - Intergenic
1059805090 9:117790208-117790230 GTGTGGCAGATTTCAAAATGTGG - Intergenic
1185534627 X:850980-851002 AGGTGGGTGAATTCTGTATGAGG - Intergenic
1188344116 X:29043307-29043329 GAATGGATGAATTAAAAATGAGG - Intronic
1193274392 X:79569504-79569526 GGATGGCTGAAATCAAAATGTGG - Intergenic
1193716331 X:84938960-84938982 AGGTGGGACAATTCAAAGTGGGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1198212237 X:134527099-134527121 TGGAGGGTGAATGCAAAATGAGG - Intergenic