ID: 956499795

View in Genome Browser
Species Human (GRCh38)
Location 3:69869895-69869917
Sequence CCTCAGCTGGAGAAGGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 11, 3: 25, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956499795_956499803 23 Left 956499795 3:69869895-69869917 CCCATGTCCTTCTCCAGCTGAGG 0: 1
1: 0
2: 11
3: 25
4: 241
Right 956499803 3:69869941-69869963 AACTTTAAGTTATGTTGAAATGG 0: 1
1: 0
2: 3
3: 49
4: 519

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956499795 Original CRISPR CCTCAGCTGGAGAAGGACAT GGG (reversed) Intronic
900509725 1:3052833-3052855 CCACAGATGGGGAAGGCCATAGG + Intergenic
901451817 1:9340558-9340580 CCACAGCTGGAGGAGGACCAAGG - Intronic
902110492 1:14074412-14074434 CCTCAGCTGGAGATGGTCAAGGG - Intergenic
904342158 1:29843616-29843638 CCTCAGCTGGTCAAGGTCACAGG - Intergenic
904789641 1:33009605-33009627 CCTCAGCTGAAAAAGGAAGTTGG - Intronic
905022286 1:34826120-34826142 CCTTATCTGAAGAAGGCCATGGG - Intronic
905276144 1:36819451-36819473 CCTCAGCTGGAGCAGGAGGTGGG + Intronic
905490996 1:38343673-38343695 CCTCAGCTGCAGAAGCAAAGAGG + Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906441951 1:45854919-45854941 CACCAGGTGGAGAAGCACATAGG + Intronic
907353911 1:53856448-53856470 GCCCAGCTGGAGAGGGACAGAGG - Intronic
908301581 1:62766219-62766241 CCTCAGCTGGAAATGGGCACAGG + Intergenic
908305043 1:62804702-62804724 CCTAAGATGGAGAAGTACTTGGG + Intronic
909268045 1:73587371-73587393 AGTCAGCTAGAAAAGGACATTGG - Intergenic
916649996 1:166825967-166825989 CCTTAGCTGGATGGGGACATTGG + Intergenic
917118655 1:171626562-171626584 CCTCAGCTGGAGAAGGAGGTGGG - Intergenic
919850321 1:201668047-201668069 CCTCAGCAGGAGGAAGACATGGG - Intronic
923292631 1:232561508-232561530 CCTGTGGTAGAGAAGGACATCGG - Exonic
924421598 1:243914999-243915021 CCTCTGGTGGAAAAGGACCTTGG + Intergenic
924909321 1:248493068-248493090 CCAAAGCCAGAGAAGGACATGGG + Intergenic
924914783 1:248554993-248555015 CCAAAGCCAGAGAAGGACATGGG - Intergenic
1063190115 10:3685792-3685814 CCTCACCTGGAGAAAACCATTGG + Intergenic
1063585626 10:7349829-7349851 CCTCAGTTGGTGATGGACAGGGG - Intronic
1067689147 10:48490171-48490193 CCTCATCAGGAGAATGAAATGGG + Intronic
1067944044 10:50679392-50679414 CCTCATCTGGACAAAGACGTTGG - Intergenic
1068805564 10:61190920-61190942 CCACAGCTGGAAAAGTACTTTGG + Intergenic
1070422416 10:76250174-76250196 CTTCAGCTGGAGAAGGGGAGAGG + Intronic
1070734307 10:78852793-78852815 GCTCAGCTGATGAAGGACAAAGG + Intergenic
1070865536 10:79706261-79706283 CCTCATCTGGACAAAGACGTTGG - Exonic
1070879329 10:79844392-79844414 CCTCATCTGGACAAAGACGTTGG - Exonic
1071004217 10:80863904-80863926 CCTAAGCTGGAGAGGGAAACTGG - Intergenic
1071632437 10:87228482-87228504 CCTCATCTGGACAAAGACGTTGG - Exonic
1071645888 10:87360700-87360722 CCTCATCTGGACAAAGACGTTGG - Exonic
1072190311 10:93072678-93072700 CCTCACCTGGATGAGGACAGTGG + Intergenic
1074036522 10:109744880-109744902 CCTCACATGGAGAAGAACTTGGG - Intergenic
1076550482 10:131274747-131274769 GCTCAGCTGGAAAAGCACAAGGG - Intronic
1078955685 11:16191959-16191981 CTTCAGCTGGAGCAGGCCCTGGG - Intronic
1079088054 11:17461329-17461351 CCCCATCTGGATAAGGACTTTGG + Intronic
1082772200 11:57216755-57216777 CCTCAGCTGGAGTATTTCATGGG - Intergenic
1084771936 11:71349051-71349073 CTTCACCTGGGGAAGCACATAGG - Intergenic
1085165718 11:74398073-74398095 CCTCAGCTGGACACGGCCATCGG - Exonic
1086824208 11:91475416-91475438 CGTCAGCTGGTGAAGGACCTCGG - Intergenic
1087094579 11:94306859-94306881 CCCCTGCTGGAGAATCACATGGG + Intronic
1088107682 11:106224605-106224627 CCTGAACTGGAAAAGGACAAAGG + Intergenic
1088242119 11:107783671-107783693 CCTCATCTGGAGAGGGGCAGAGG - Intergenic
1089391366 11:118104255-118104277 CCTTACTTGGAGAAGGACTTAGG + Intronic
1089590962 11:119540487-119540509 GCTGAGCTGGAGAAGCACAGTGG - Intergenic
1089773854 11:120822331-120822353 CCTCAGCTAGAGAAGAAGAAAGG + Intronic
1089844132 11:121445296-121445318 CCTGAGCTGTAGCAGGAGATGGG + Intergenic
1091272478 11:134327387-134327409 CCTGAGATGGGGAAGGTCATGGG - Intergenic
1092061858 12:5557593-5557615 CCTCAGCTGGTGATGGTCACAGG - Intronic
1092077965 12:5688904-5688926 CAACAGCAGGAAAAGGACATAGG - Intronic
1096614563 12:52824416-52824438 CATCAGAGGGTGAAGGACATGGG + Intronic
1096844955 12:54401398-54401420 CCTCAGAAGGAGGAGGACCTGGG - Exonic
1097671752 12:62548018-62548040 CTTCAGCAGGAGGAGGACAGAGG + Intronic
1101789171 12:107912251-107912273 CCTGAGCAGGACAAGGACCTTGG - Intergenic
1102695823 12:114798564-114798586 CCACAGCTGGAGAGGAACAGTGG + Intergenic
1106548719 13:30752904-30752926 ACTCAGCTGGTGAAGAACACAGG + Intronic
1109818205 13:67616020-67616042 CATCAGTTGGTAAAGGACATGGG + Intergenic
1110796742 13:79647026-79647048 CTTCAGCAGGAGGAGGACATAGG - Intergenic
1111973385 13:94940518-94940540 CAGCAGCAGGAGAAGGCCATGGG + Intergenic
1112645938 13:101331716-101331738 CCTGAGCTGGAGATGAACTTTGG + Intronic
1113007430 13:105722917-105722939 CATGAGCTGGAGAAGGATATGGG - Intergenic
1117311983 14:54535227-54535249 CCTGAACTGGAGAAGAAAATTGG - Intronic
1118383820 14:65239064-65239086 TCTCAGCTGGTGGAGGACTTGGG + Intergenic
1121107722 14:91292087-91292109 CCTCAGTTGGGGCAGGACCTTGG - Intronic
1122233617 14:100319958-100319980 CCTCAGCTGGAGATAGCCAATGG - Intergenic
1123216580 14:106813754-106813776 CCTCAGCTGGAGCAGGACAGAGG + Intergenic
1123962120 15:25414404-25414426 CCTCATGTGGTGAAGGAAATGGG + Intronic
1124371385 15:29106607-29106629 CTGCAGCTGGAGAAGCACAAGGG + Exonic
1124435596 15:29646449-29646471 CCTCACGTAGAGAAGGACAGTGG - Intergenic
1127145480 15:56018822-56018844 CCTGAGCTATAGAAGGAAATAGG - Intergenic
1129362350 15:75031829-75031851 CCTGAGCTACAGAAGGAAATAGG + Intronic
1130046866 15:80452624-80452646 CCTCTTCTGGAAAAGGACTTGGG - Intronic
1131053676 15:89363399-89363421 ACTGAGCTGGAGAAGAATATGGG + Intergenic
1131436027 15:92422713-92422735 CCTCAGGTGGAAAAGAAGATGGG + Intronic
1132406319 15:101543561-101543583 CCTCAGCTGTAGAAGGACGAGGG - Intergenic
1135400627 16:22164045-22164067 CCTCAGGTGGAGAGGGAGGTCGG + Intergenic
1136074844 16:27809924-27809946 CCTGAGCTGGAGGAGAAGATGGG + Intronic
1136560982 16:31039093-31039115 TCTCAGCTGCAAAAGGGCATTGG - Intronic
1136671726 16:31864646-31864668 CCACAGCTGGAGGAGCACGTGGG - Intergenic
1137915997 16:52430822-52430844 ACACAGCTGGAGAAGATCATCGG - Intergenic
1140108393 16:71982086-71982108 CCAAAGCTGGAGAAGGAAGTTGG - Exonic
1143130855 17:4676080-4676102 CCGAAGCTGGAGAAGGACATGGG + Exonic
1143287642 17:5802112-5802134 CCTCAGGTGGATAAACACATTGG + Intronic
1143294533 17:5860799-5860821 CCTATGGTGGAGATGGACATGGG + Intronic
1144095881 17:11900373-11900395 GAACAGCTGGAGAAGGACAGAGG - Intronic
1144136470 17:12300198-12300220 CCTCACTTGGAGTAGGAGATGGG - Intergenic
1145058237 17:19716842-19716864 CCTCAGCAGGAGAAGGTCCAGGG + Intronic
1145737631 17:27244237-27244259 CCTCATCTCAGGAAGGACATGGG - Intergenic
1145979772 17:29004761-29004783 CTGCAGCGGGAGAAGGACGTGGG + Intronic
1146265188 17:31448176-31448198 CCACAGCAGAAGATGGACATGGG - Intronic
1146651232 17:34607802-34607824 CATCAGATGGAGAGGTACATAGG + Intronic
1148131816 17:45266778-45266800 CCTCAGCTGGAGGAGGGTAAGGG + Intronic
1148136952 17:45299509-45299531 CCTCAGGCGGAGAAGGAGAATGG + Intronic
1148806493 17:50266599-50266621 CCCCACCTGGAGCAGGACCTCGG + Intergenic
1149057415 17:52382481-52382503 CCTGAGCTGCAACAGGACATGGG + Intergenic
1150248208 17:63691544-63691566 GCTCTGCTTGAGAAGGACTTGGG + Intronic
1150356110 17:64486261-64486283 ACTCAACTGGAGAGGGACTTAGG + Intronic
1150549222 17:66193190-66193212 CCTCAGGAGGAGGAGGACATTGG + Intergenic
1152032390 17:77852582-77852604 CCTCAGCTGGTGAAGGACCAGGG - Intergenic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1158772357 18:60534752-60534774 TCACTGCTGGACAAGGACATTGG + Intergenic
1159653608 18:71005583-71005605 CCTCAGCTGGAGCAGGTCCATGG - Intergenic
1160009080 18:75089993-75090015 CCTCGGCTGGAGAAAGAAACAGG + Intergenic
1160323184 18:77915262-77915284 CCTGAGTTGGAGATGAACATTGG - Intergenic
1162788573 19:13051485-13051507 TCCCAGCTAGAGAAGGACAGGGG - Intronic
1162971415 19:14183387-14183409 CCTCAGCTGGAGCAGGCCAGTGG - Intronic
1163692983 19:18747100-18747122 CACCAGCTGGAGAAGGTCAGTGG + Exonic
1164010665 19:21200894-21200916 CCTCACCTGGAGGAGGACCATGG + Intergenic
1164908491 19:31986629-31986651 CCCCAGCAGGAGAAGGCCGTGGG + Intergenic
1166312656 19:41971500-41971522 CCTCACCTGTTGATGGACATGGG - Intronic
1167463381 19:49638103-49638125 CCTGAGCAGGAGAAGGAGACGGG - Intronic
1168512714 19:56986234-56986256 CTTCCCCTGGAGAAGGACATTGG - Intergenic
924959789 2:23950-23972 CCTCAGCAAGAGAAGGAGTTTGG - Intergenic
927213341 2:20651741-20651763 CCCCAGCTGGAGCAGGGCAACGG + Intergenic
927213583 2:20653245-20653267 CCTGGGCTGGAGACTGACATAGG + Intergenic
928915764 2:36468688-36468710 CGTCAGCTGGAGCTGGACAATGG + Intronic
929768309 2:44869337-44869359 ACGAAACTGGAGAAGGACATAGG + Intergenic
933267641 2:80199547-80199569 CCTGAGCAGGAGTAGCACATGGG + Intronic
934477194 2:94601672-94601694 CCACAGCTGGAGAAGGACGCTGG + Intronic
936261473 2:110962933-110962955 CCTCAGAAGGGGAAGGACCTGGG + Intronic
937121021 2:119440000-119440022 CTTCAGCTGAAGGAGGACACAGG + Exonic
937849681 2:126621207-126621229 AGTCAGCTGGGGAAGGACAGGGG + Intergenic
938252805 2:129828691-129828713 ACTCAGCTGAATAGGGACATTGG - Intergenic
944537271 2:200723491-200723513 CCCCAGCTGGAGAAATAAATTGG - Intergenic
944913746 2:204336262-204336284 CAACAGCTGGAGACAGACATAGG - Intergenic
945641531 2:212437342-212437364 TCTCAGCTGGAGAATGAACTTGG + Intronic
946686537 2:222277073-222277095 CCTCTGCTGAACAAGGACAAGGG + Intronic
947581913 2:231325519-231325541 CCCCAGCTGGAAATGGGCATTGG - Intronic
947837368 2:233185274-233185296 CCTCAGTTGGAGAAGGAGGCAGG - Intronic
948757686 2:240168879-240168901 CCACAGCTGGAGAAGTAACTAGG - Intergenic
1169135457 20:3194633-3194655 CCGAAGGTGGAGAAGGACCTGGG - Intronic
1169653214 20:7892952-7892974 CCTGAACTGCAGAAGGACAGAGG - Intronic
1171108288 20:22456841-22456863 CCTTACCTGGACAAGGACTTTGG + Intergenic
1171485839 20:25484972-25484994 CCTCAGCTGGCACAGCACATGGG - Intronic
1173421104 20:42901778-42901800 CCTGATTTGGAGAAAGACATTGG - Intronic
1173907630 20:46640391-46640413 CCCCAGCTAGAAAAAGACATTGG - Intronic
1174899710 20:54485546-54485568 ACTCACCTGTCGAAGGACATGGG + Intronic
1175876549 20:62232905-62232927 CCTCAGCTGGAGCTGGGGATGGG - Intronic
1176449164 21:6848486-6848508 CCTGATCAGGAGAAGGACAGTGG + Intergenic
1176827332 21:13713510-13713532 CCTGATCAGGAGAAGGACAGTGG + Intergenic
1179815731 21:43904789-43904811 CCACAGTGGGAGAAGGACACAGG - Intronic
1180106595 21:45622858-45622880 CCTCATCTGCAGGAGGACACTGG - Intergenic
1180118801 21:45731496-45731518 CCTCAGTTGGAGATGAACTTTGG - Intronic
1180235329 21:46455887-46455909 CCTCAGCTGGAGCAGTTCAGAGG - Intergenic
1180597469 22:16988111-16988133 GCTCAGCTGGAGAAGAGCAGAGG + Exonic
1181020701 22:20100724-20100746 CCCCAGGTGGAGAAGGACATGGG + Intronic
1181222940 22:21373644-21373666 CCTCTGCTGGGGCAGGAAATGGG + Intergenic
1181255801 22:21561976-21561998 CCTCTGCTGGGGCAGGAAATGGG - Intronic
1181514167 22:23401999-23402021 CCACACCTGGGGAGGGACATGGG - Intergenic
1182055003 22:27345644-27345666 CCTCAACTGGAGAAGGAAGAGGG - Intergenic
1182303338 22:29351128-29351150 CCTTGGCTGGAGAAGGAAAAGGG - Intronic
1182356358 22:29723924-29723946 CCACAGGTTGAGAAGGACATTGG + Intronic
1182413003 22:30202931-30202953 CCTGAGGTGGAGAAGGAGCTTGG + Intergenic
1183235660 22:36615014-36615036 CCTCTGCTAGAGAGGGAGATAGG - Intronic
1184450866 22:44582091-44582113 TCTGGGCTGGAGAGGGACATTGG - Intergenic
950034911 3:9878428-9878450 CCTCACCTGGAGAGGGACTTGGG + Exonic
953418340 3:42735723-42735745 CGACAGCTGGAGATGGAGATCGG - Exonic
953532641 3:43752394-43752416 CAACACCTGGAGAAGGACGTGGG + Intergenic
954363675 3:50135265-50135287 CCTCTGCTGGGGCAGGACAGAGG + Intergenic
954662485 3:52233509-52233531 CCTCAATTGGAGATGGACAGTGG + Intronic
955027992 3:55188939-55188961 CCTGAGATGGAGACGGCCATGGG + Intergenic
956499795 3:69869895-69869917 CCTCAGCTGGAGAAGGACATGGG - Intronic
957802801 3:85106836-85106858 CCAAAGCTGGAGAAAGTCATTGG + Intronic
960090093 3:113630225-113630247 GTTCAGCTGGAGCAGGACAGAGG + Intergenic
961054181 3:123773974-123773996 CCTCAGCTGGAGACAGGCAGTGG - Intronic
961321493 3:126079525-126079547 GCTCAGCTGGAGAAACACAAAGG + Intronic
962313106 3:134339715-134339737 ACTCAGGTGGAGAAGGAGACAGG - Intergenic
962454890 3:135555995-135556017 CCTCAGCTGGAAAAGGGCATTGG + Intergenic
963627127 3:147687819-147687841 CTTCTGCTGAAGCAGGACATAGG + Intergenic
964880507 3:161418024-161418046 TCTCAGCTGGATCAGGAGATTGG - Intergenic
968561653 4:1286344-1286366 CCTCTGCTGGTGAAGGGCAAAGG + Intergenic
968830522 4:2931176-2931198 CCTGAGCGGGAGAAGGGCAGTGG - Intronic
968871296 4:3244036-3244058 CCCCTGCTGGAGAAGCACTTAGG - Intergenic
968982337 4:3857035-3857057 TCTCAGCTGGAGAGGGTCAAAGG - Intergenic
971230715 4:24798823-24798845 CCTGTGCTGGAGAAGGACAGAGG - Intronic
975209221 4:71679618-71679640 CCTCAGCTTGACAATGACATAGG - Intergenic
975497398 4:75049671-75049693 CCTCAGATGGTAAAGGACAGAGG - Exonic
980448169 4:132938601-132938623 CCTGAGCTGAAGAGGCACATTGG + Intergenic
982126703 4:152189970-152189992 TCTCAACTGGAGAAGGGCAGTGG - Intergenic
982243804 4:153328567-153328589 GCTCAAATGGAGAAGGAAATGGG + Exonic
983590195 4:169400558-169400580 CTTCATCTGGAGCAGGAAATGGG - Exonic
985469469 5:29960-29982 CCTCAGCAAGAGAAGGTCTTTGG - Intergenic
985870271 5:2548819-2548841 CCTGAGGTGGAGAAGGACTCAGG - Intergenic
987909215 5:24120410-24120432 CATCAGCTGGGTAAGGATATAGG + Intronic
988716115 5:33829874-33829896 CCTCAGATGGAAAAGGACTGGGG - Intronic
991533170 5:67637667-67637689 CCTCAGCAGGAAGATGACATGGG + Intergenic
991977652 5:72198915-72198937 CCTGGCCTGGAGAAGGACAGTGG + Exonic
992882776 5:81127131-81127153 CCACAGCTGCAGCAGGACATGGG + Exonic
997475416 5:134139646-134139668 CCTCAGCTGGAGTTGGGCCTTGG + Intronic
998403763 5:141862319-141862341 CCTCAGATGGGGCAGGACTTGGG + Intronic
1000677152 5:164135513-164135535 GCTCATCTTTAGAAGGACATAGG - Intergenic
1001974788 5:175988613-175988635 CCTCTGCTGGAAAAGGAAAATGG + Intronic
1002242646 5:177855165-177855187 CCTCTGCTGGAAAAGGAAAATGG - Intergenic
1002527438 5:179822600-179822622 CCACAGTTGAAGACGGACATGGG + Intronic
1003570657 6:7254302-7254324 CCTCCACTGGAGGAGGGCATGGG + Intergenic
1004637037 6:17479110-17479132 CTTCAGCTGGAGACGTACAGTGG - Intronic
1005133418 6:22538472-22538494 CCCCAGCTGGAAAATGAAATAGG - Intergenic
1005911544 6:30314335-30314357 TCTGAGCTGGAGGAGGACAAAGG - Intergenic
1005988607 6:30889822-30889844 CCTGAGCTGGAGAATGCCAGGGG - Intronic
1006611550 6:35297234-35297256 ACAAAGCTGGAGAAGGAAATGGG - Intergenic
1007821156 6:44561516-44561538 CCTGAGCTGCAGAAGGAAAGCGG - Intergenic
1008000324 6:46353177-46353199 CCTGAGCTGGAGATGAACTTTGG - Intronic
1011477338 6:87760866-87760888 CCTTAACTGGAGAAGAAAATAGG - Intergenic
1013604612 6:111736194-111736216 CCACAGCTGGAGGAGAACAGTGG - Intronic
1013933106 6:115559202-115559224 CCTCAGCAGGAGGAAGACAGAGG - Intergenic
1014800738 6:125775805-125775827 CTTTGGCTGGAGGAGGACATAGG - Intergenic
1014815189 6:125927803-125927825 CCTCAGTTGGGGAAGGGGATAGG + Intronic
1015351612 6:132225935-132225957 GCTCAGCTGCCCAAGGACATGGG + Intergenic
1018388748 6:163327534-163327556 CCTCAGTGGGGGAAGGACACAGG + Intergenic
1019635178 7:2071623-2071645 CCTAAGCTGGGGAAGGAGAGGGG + Intronic
1020365783 7:7379143-7379165 GCGCAGCTGGAGAAGGACGAGGG + Intronic
1020782463 7:12534137-12534159 CCTCAGCTTGAGAACAACTTTGG + Intergenic
1021559517 7:21955990-21956012 ACGCATTTGGAGAAGGACATTGG - Intergenic
1021739453 7:23671255-23671277 CCTAAGCTGTGGAAGGACTTTGG + Intergenic
1022479265 7:30732620-30732642 CAAGAGCTGGAGAAGTACATGGG - Intronic
1022899281 7:34786567-34786589 CCTCTGCTGGATCAGGACAAGGG - Intronic
1023262353 7:38370675-38370697 AGTCAACTGGAGAAGGAAATCGG - Intergenic
1023527879 7:41123754-41123776 TCCCTGCAGGAGAAGGACATAGG - Intergenic
1024117718 7:46209255-46209277 CCACTGCTGGGGATGGACATGGG + Intergenic
1024123734 7:46270820-46270842 CCACAGCTGGGGACAGACATGGG - Intergenic
1026880093 7:73902342-73902364 CCCCTGCTGGAGAGGGACATGGG - Intergenic
1028983239 7:96989847-96989869 CCTCAACTGGAAAAGGAGTTGGG + Intergenic
1030005717 7:105117859-105117881 CCTCAGCTGGCGAATGCCTTCGG - Exonic
1030679113 7:112415634-112415656 CCTCTGCAGTAGAGGGACATGGG + Intergenic
1037126759 8:15361209-15361231 CCTCAGCAGCAGGAAGACATAGG - Intergenic
1037439764 8:18903679-18903701 CCTGAGCTGAAGGAGCACATTGG - Intronic
1037786967 8:21909060-21909082 CCTCAGCTGGGGAAAGAAAGAGG + Exonic
1038281341 8:26168045-26168067 CCTCAGAAGGAGAAGGAGGTGGG - Intergenic
1038648595 8:29381945-29381967 CCACAGCTGGTGAGGGACAAAGG - Intergenic
1040971996 8:53145143-53145165 CCTCACTTGGGGAAGGACATGGG + Intergenic
1042401505 8:68353953-68353975 CCTCAGATGCAGAAGGGGATTGG - Intronic
1042568344 8:70135192-70135214 CCTCAGCTGGAGAAGAGCGTGGG - Intronic
1043077042 8:75715516-75715538 CCTGTGCTGGAGCAGGACAAGGG + Intergenic
1044091290 8:88005216-88005238 GCTCAGCTGGACAAGGCTATTGG - Intergenic
1044782312 8:95755820-95755842 CCTAAACTGGAGTATGACATTGG + Intergenic
1045385475 8:101667707-101667729 CCAAAGCTGGAGAAGGAGCTGGG - Exonic
1045637306 8:104207244-104207266 CTGCAGCTGGACAAAGACATTGG - Intronic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1046774172 8:118146337-118146359 ACAAAGCTGGAGAAGTACATGGG + Intergenic
1048207190 8:132424549-132424571 CCTCATCAGGAGAAGGTCCTAGG + Intronic
1049302615 8:141879628-141879650 ACACAGCAGGAGTAGGACATGGG + Intergenic
1051208275 9:14713209-14713231 CCTGAGCTGGAGTAGGATGTTGG + Intergenic
1051548467 9:18303359-18303381 CCTCAGCCAGAGAATGAGATAGG + Intergenic
1052852778 9:33387880-33387902 CCACAGCTGGAGAAGGACGCTGG - Intronic
1053298694 9:36933652-36933674 CCCCAGCTGGAGGAGGATAGTGG - Intronic
1053680878 9:40484421-40484443 CCACAGCTGGAGAAGGACACTGG - Intergenic
1053930866 9:43112735-43112757 CCACAGCTGGAGAAGGACACTGG - Intergenic
1054282835 9:63140514-63140536 CCACAGCTGGAGAAGGACACTGG + Intergenic
1054293960 9:63319936-63319958 CCACAGCTGGAGAAGGACACTGG - Intergenic
1054391985 9:64624425-64624447 CCACAGCTGGAGAAGGACACTGG - Intergenic
1054503744 9:65891903-65891925 CCACAGCTGGAGAAGGACACTGG + Intronic
1055364277 9:75526786-75526808 TCTCAGCTGAGGAAGGACATGGG - Intergenic
1057355083 9:94325693-94325715 CCTCATCTGGACAAAGACGTTGG + Exonic
1057637867 9:96787643-96787665 CCTGAGTTGGAGATGGACTTTGG - Intergenic
1057652668 9:96931941-96931963 CCTCATCTGGACAAAGACGTTGG - Exonic
1060221116 9:121764651-121764673 CCTGAGCTGGAGGGGGACACAGG - Intronic
1061958862 9:133977887-133977909 CCTCAGCTGGCAAAGGGGATGGG + Intronic
1062195381 9:135270632-135270654 CCTCAGCTTCAGAAGGACAGAGG - Intergenic
1062731863 9:138114361-138114383 CATCAGCTGGAAAAGAACACAGG - Exonic
1203776470 EBV:75825-75847 CCCCAGATGGAGGAGGACAAGGG - Intergenic
1203520024 Un_GL000213v1:36030-36052 CCTGATCAGGAGAAGGACAGTGG - Intergenic
1186281771 X:8000718-8000740 CCACACCTGGATAATGACATAGG + Intergenic
1186696511 X:12039261-12039283 CCTCAGCTTGTGAAAGTCATGGG + Intergenic
1187899039 X:24010267-24010289 TCTAAGCTGGAGAAGGACAGAGG - Intronic
1188422805 X:30010066-30010088 ACTCAGCTGGAAGAGTACATTGG - Intergenic
1190153331 X:47966810-47966832 CCTGAGGTGGTGCAGGACATTGG - Intronic
1190214534 X:48470663-48470685 CCACAGTTGGAGGAGGACAAGGG + Intergenic
1190487431 X:50941840-50941862 CCTCTGCTGGTGGAGGACAGAGG + Intergenic
1190637959 X:52455113-52455135 TCGTAGCTAGAGAAGGACATGGG + Intergenic
1190678694 X:52805347-52805369 TCATAGCTAGAGAAGGACATGGG - Intergenic
1195368474 X:104149837-104149859 CTTAAGCAGGAGAAGTACATGGG - Intronic
1198312979 X:135438258-135438280 CTGCAGCTGGAGAAGGACCCTGG + Intergenic
1198678212 X:139153461-139153483 CCTCAGTTGGTGAAAGAAATGGG + Intronic
1198703731 X:139424369-139424391 CAGCAGCTTCAGAAGGACATTGG + Intergenic
1200062267 X:153488870-153488892 CCTCAGCTGCAGGAGGGCAGGGG + Intronic
1200892885 Y:8342435-8342457 CCAAAGCTGGAGAGTGACATTGG - Intergenic