ID: 956500858

View in Genome Browser
Species Human (GRCh38)
Location 3:69883576-69883598
Sequence TGGATTGGTGGGCTACAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956500858 Original CRISPR TGGATTGGTGGGCTACAGAT TGG Intronic
902284977 1:15401944-15401966 AGGATTCCTGGGCAACAGATGGG - Intergenic
903587809 1:24429661-24429683 TGGCTTGATTGGCTACAGATAGG + Intronic
904202254 1:28828188-28828210 TTGATCCGTGGGCTACAGAATGG + Intronic
907281990 1:53354546-53354568 TGAATAGGTGAGTTACAGATTGG - Intergenic
907287413 1:53390717-53390739 AGGGCTGGTGGACTACAGATTGG - Intergenic
907802591 1:57785307-57785329 TTGATTGATGGGCTGCAGAATGG - Intronic
907941598 1:59093533-59093555 TGGGTTGGAGGGGTCCAGATGGG + Intergenic
909484408 1:76157323-76157345 TGGAGTAGGAGGCTACAGATAGG - Intronic
917491898 1:175505122-175505144 TGGGTTTGGGGGCTGCAGATTGG - Intronic
917562195 1:176170404-176170426 TTGATTTATGGGCTACAGAATGG + Intronic
917669541 1:177259927-177259949 TTGATTCATGGGCTACAGAATGG - Intronic
917918481 1:179728559-179728581 TGAATTCGTGGTCTCCAGATGGG + Intergenic
918508911 1:185288818-185288840 TGGATTGGTGTCCTACAATTTGG + Intronic
919075574 1:192808935-192808957 CGGATTGGTCGGCTGCAGACTGG - Intergenic
920176496 1:204105000-204105022 TGGGTTGGTGGGGTTCAGAGGGG + Intronic
923094605 1:230764774-230764796 TGGATTGAGAGGTTACAGATAGG + Intronic
1068127162 10:52854794-52854816 TTGATTTGTGGGCTACAGAATGG - Intergenic
1073681578 10:105710144-105710166 TTGATTGATGGGCTGCAGAATGG - Intergenic
1075115866 10:119626795-119626817 TGGATGGAGGGGCCACAGATGGG + Intergenic
1078846563 11:15124095-15124117 TGGATAGCTGGGTGACAGATGGG - Intronic
1080206529 11:29735849-29735871 TGGGTGGGTGGGGGACAGATGGG + Intergenic
1083606614 11:63982712-63982734 TGGAAGGGTGGGCCACACATGGG - Intronic
1085233912 11:74996783-74996805 TTGATCCGTGGGCTACAGAATGG + Intronic
1087966030 11:104416927-104416949 TCGATTTGTGGGCTGCAGAATGG + Intergenic
1088804890 11:113343450-113343472 TTGATATGTGGGCTACACATAGG + Intronic
1115493080 14:33977640-33977662 TGGATTGATGTGCTACAGAATGG + Intronic
1117542087 14:56758046-56758068 CTGATGGGTGGGCTACAGAGAGG - Intergenic
1118197598 14:63641918-63641940 AGGATTGGTCGGCTGCAGAGAGG + Intergenic
1119277106 14:73367795-73367817 TGGATTCGTGTGGTACTGATAGG + Intronic
1120744311 14:88140154-88140176 TGGAAGGGTGTGCTAGAGATGGG - Intergenic
1124580574 15:30951030-30951052 TGGGTTGGTTGACCACAGATGGG + Intronic
1124958551 15:34376824-34376846 AGGATAGTTGGGCTACAGCTGGG - Intergenic
1126321760 15:47431564-47431586 TGGAGTTGTGGGCTGGAGATAGG + Intronic
1126391780 15:48164012-48164034 TTGATTGATGGGTTACAGAGTGG - Intronic
1127705073 15:61538875-61538897 TTGATCGATGGGCTACAGAATGG + Intergenic
1129181812 15:73882469-73882491 AGGAAGGGTGGGCTACTGATAGG - Intronic
1131913675 15:97237763-97237785 TTGCTTGGTGTGTTACAGATGGG + Intergenic
1132818250 16:1846207-1846229 TGAATTGCTGTGCTTCAGATGGG + Intronic
1133196530 16:4174844-4174866 TGGATTTGAGGTCTCCAGATTGG - Intergenic
1135335492 16:21598400-21598422 TGGGGTGGTGAGCCACAGATGGG - Intronic
1140732923 16:77872507-77872529 TTGGTTGGTGGGCTTCAGGTTGG - Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1147425723 17:40345122-40345144 GAGATTGGTGGGAGACAGATGGG - Intronic
1149216979 17:54369117-54369139 TAGCTTGATTGGCTACAGATGGG - Intergenic
1151328425 17:73392794-73392816 TGCATTGGTGAGCTTCTGATGGG + Intronic
1157117406 18:44875002-44875024 TGTATTGGTTTGCTACAGATGGG + Intronic
1157608658 18:48942169-48942191 TGGCTTGGGGGGCTTCAGCTTGG - Intronic
1160681793 19:415039-415061 TGGATGGCTGGGTTACTGATGGG + Intergenic
1161632816 19:5367399-5367421 TGGGTGGATGGGTTACAGATGGG + Intergenic
1163603287 19:18261202-18261224 CAGATTGGTGGGCTACACTTGGG + Intronic
925303421 2:2833000-2833022 TGGATTGATGGGTTAGAGAGGGG - Intergenic
927521431 2:23701055-23701077 AGTATTTGTGGGCAACAGATTGG - Intronic
929973578 2:46608645-46608667 TTGATCCGTGGGCTACAGAATGG + Intronic
930216903 2:48707048-48707070 GGTGTTGGTGAGCTACAGATGGG + Intronic
931020744 2:58042012-58042034 AGGATGGTTGGGCTACAGTTTGG - Intronic
934059081 2:88277544-88277566 TGGATCTATGGGCTACAGAATGG - Intergenic
938851682 2:135266998-135267020 TAGATGGTTGGGCTACAGCTTGG - Intronic
938871932 2:135487068-135487090 TGGATACATGGGCTACAGAATGG + Intronic
943578609 2:189658689-189658711 TTGTATGGTGGGCTGCAGATGGG + Intergenic
945330475 2:208534002-208534024 TTGATTCTTGGGCTACAGAATGG - Intronic
948327863 2:237141077-237141099 TGGATTGGTGGGCTGCACCTGGG - Intergenic
1170083452 20:12502531-12502553 TGGATTGGTGGGCTGCTGATTGG + Intergenic
1170280514 20:14641580-14641602 TTGATTGATGGGCTACAGAATGG + Intronic
1174484918 20:50855115-50855137 TGGAATGGAGGGCTGAAGATGGG - Intronic
1175077936 20:56391881-56391903 GGGGTGGGTGGGCTTCAGATTGG - Intronic
1175360673 20:58409266-58409288 GGGATTGGTGCACTGCAGATGGG + Intronic
1184614990 22:45631914-45631936 TGCATTGGTGGGTTTCAGTTTGG - Intergenic
951231721 3:20186882-20186904 TGGATTGGGGGGAAAAAGATGGG - Intergenic
951333123 3:21389268-21389290 TTGATTTGTAGGCTACAGAATGG - Intergenic
951362628 3:21742586-21742608 TGGATTGGAGGGCAAGAGAAAGG + Intronic
954285973 3:49619461-49619483 TGGACTGGTGGCCTAGATATTGG + Intronic
955164346 3:56496217-56496239 TGGATCCATGGGCTACAGAATGG + Intergenic
956500858 3:69883576-69883598 TGGATTGGTGGGCTACAGATTGG + Intronic
956822814 3:72969100-72969122 TGGACTCGTGGGCTAGGGATGGG + Intronic
958615915 3:96493687-96493709 TGGAATGGTGGGCTGCATGTGGG + Intergenic
960480198 3:118178873-118178895 TGGTTTGGTGAGCCACAGAAGGG - Intergenic
964840773 3:160991171-160991193 TGGGCTGGTGGGCCACAGATTGG + Intronic
967603822 3:191420542-191420564 TGCATTGTTGGGGTTCAGATGGG + Intergenic
969334031 4:6496328-6496350 TGGGCTGGTGGGGTCCAGATGGG - Intronic
971462095 4:26910820-26910842 TGGTGTGGTGGGGTACAGGTGGG + Intronic
971644104 4:29174171-29174193 TTGATTCATGGGCTACAGAATGG - Intergenic
976415437 4:84768732-84768754 TTGATTCATGGGCTACAGAATGG - Intronic
976479844 4:85528455-85528477 TGGATTGGAGGGAGAAAGATGGG + Intronic
978426031 4:108583644-108583666 TGGATTGATGGGCACCTGATAGG - Intergenic
981940568 4:150277823-150277845 TGGAATCATGGGCTACAAATAGG - Intronic
982488084 4:155993113-155993135 TTGATTGATGGGCTGCAGAATGG + Intergenic
984279811 4:177656808-177656830 TTGATTCATGGGCTACAGAATGG - Intergenic
984444056 4:179811840-179811862 TGGATTGGAAGGCTACTTATTGG - Intergenic
985348943 4:189037075-189037097 TGGACTGGTGATCTAAAGATGGG - Intergenic
987513929 5:18881204-18881226 GGGATTGGTTGGCTACAAAATGG - Intergenic
990632551 5:57686462-57686484 AGGATAGGTGGACTACAGAAGGG - Intergenic
994232740 5:97327258-97327280 TGGTTTGATGTGCTCCAGATAGG - Intergenic
997503770 5:134399585-134399607 TGGATCGGTGGCCTACCTATGGG - Intergenic
998899222 5:146834741-146834763 TGGATTGGAAGGCTACATAGTGG - Intronic
999059531 5:148618504-148618526 TGCCTTGGTGGGTTACAGGTTGG + Intronic
999145781 5:149392495-149392517 TGCATTTTTGGGGTACAGATTGG - Intronic
1000462531 5:161540681-161540703 TTGATTTATGGGCTACAGAATGG + Intronic
1003316707 6:5019690-5019712 TGATTTGGTGACCTACAGATGGG + Intergenic
1008120685 6:47613375-47613397 TTGATTCATGGGCTACAGAATGG + Intronic
1009387314 6:63100924-63100946 TTGATTCATGGGCTACAGAACGG + Intergenic
1009573469 6:65420742-65420764 TTTATTGGTGGGCTACAAAAGGG + Intronic
1011115786 6:83890065-83890087 TGGATTGATGGGCTGCAGGATGG - Intronic
1013309330 6:108879088-108879110 TGGATGGGTGGATGACAGATGGG - Intronic
1014419319 6:121221382-121221404 TTGATTTATGGGCTACAGAATGG - Intronic
1015363412 6:132368308-132368330 TGGAGAGGTGGGCTGCAGAGTGG + Intronic
1015901029 6:138067107-138067129 TTGATCGGTGGGCTGCAGAATGG - Intergenic
1021275852 7:18649871-18649893 GGGATTGGGGTGCTAGAGATGGG + Intronic
1021940563 7:25674790-25674812 TGGATGAGTAGGATACAGATTGG + Intergenic
1024786075 7:52909513-52909535 TGGATTCATGGGCTGCAGAAAGG + Intergenic
1027024112 7:74838283-74838305 TGGGTTTGTGTGCTAAAGATAGG + Intronic
1027063819 7:75107038-75107060 TGGGTTTGTGTGCTAAAGATAGG - Intronic
1028836225 7:95377762-95377784 TTGTTTGGTGACCTACAGATGGG - Intronic
1030151023 7:106405042-106405064 TGGATTCCTGAGTTACAGATTGG - Intergenic
1030679792 7:112422913-112422935 TGGATCAGTGGGCGAGAGATGGG + Intergenic
1031132755 7:117851691-117851713 TGGTTTGGTGGACTGTAGATAGG - Intronic
1031698362 7:124889926-124889948 TTGATTTGTGGGCTGCAGAATGG - Intronic
1032278385 7:130480748-130480770 GGGGTAGGTGGGTTACAGATGGG + Intergenic
1033141007 7:138826650-138826672 TTGATTGATGGGCTGCAGAATGG - Intronic
1034099673 7:148439893-148439915 TAGATTGGTGGGCTCCACAGGGG - Intergenic
1034828884 7:154291693-154291715 TGGAATTTTTGGCTACAGATTGG + Intronic
1039206169 8:35157946-35157968 TGGGTTGGAAGGCTACATATGGG + Intergenic
1039832462 8:41225979-41226001 GAGATTGGTGACCTACAGATGGG - Intergenic
1041926235 8:63239814-63239836 TGGATTCATGGGCTGCAGAATGG + Intergenic
1042023199 8:64393416-64393438 TGGAATGGTAGGATATAGATAGG - Intergenic
1045480030 8:102584398-102584420 CTGATTGGAGGGCTTCAGATTGG + Intergenic
1048861216 8:138725454-138725476 GCATTTGGTGGGCTACAGATGGG + Intronic
1049436210 8:142587383-142587405 TGGAGTGGGGGGCTGCAGAGCGG + Intergenic
1050349509 9:4726886-4726908 TTGATGCGTGGGCTACAGAATGG + Intronic
1050649918 9:7765032-7765054 TTGATCTGTGGGCTACAGAATGG - Intergenic
1052051899 9:23858642-23858664 TGGTTTGGTTGGCTGCAGCTAGG - Intergenic
1052558003 9:30044891-30044913 GGGATAGGTGGGAGACAGATGGG + Intergenic
1052591839 9:30506977-30506999 TTGATTCATGGGCTACAGAATGG + Intergenic
1056074854 9:83027876-83027898 CGGATTGATGGGCTGCATATTGG + Intronic
1058223620 9:102333335-102333357 TGGATCCATGGGCTACAGAATGG + Intergenic
1061282616 9:129606179-129606201 TGGATTGGGGAGATATAGATGGG - Intergenic
1185715939 X:2342201-2342223 TGGATATGTGGCCGACAGATAGG - Intronic
1186994862 X:15109519-15109541 TTGATTGATGGGCTGCAGAATGG - Intergenic
1187202960 X:17153760-17153782 GCAAATGGTGGGCTACAGATAGG + Intergenic
1190088558 X:47417740-47417762 GGGGGTGGTGAGCTACAGATCGG - Intergenic
1192814830 X:74579458-74579480 TGGATTCATGTACTACAGATAGG + Intergenic
1195370465 X:104167262-104167284 GGGATTCGTAGGGTACAGATGGG - Intronic
1197195758 X:123699462-123699484 AGGATTGGTGAGATACACATGGG - Intronic
1201575719 Y:15459672-15459694 CGGAATGGTGGACAACAGATAGG + Intergenic