ID: 956501985

View in Genome Browser
Species Human (GRCh38)
Location 3:69896862-69896884
Sequence GGCTGAACTGCAATGTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 121}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956501985_956501990 8 Left 956501985 3:69896862-69896884 CCTTCAAACATTGCAGTTCAGCC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 956501990 3:69896893-69896915 TGAGGGACGTATCCCTGTAGTGG 0: 1
1: 0
2: 1
3: 2
4: 53
956501985_956501987 -10 Left 956501985 3:69896862-69896884 CCTTCAAACATTGCAGTTCAGCC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 956501987 3:69896875-69896897 CAGTTCAGCCTCAGAAGGTGAGG 0: 1
1: 0
2: 4
3: 26
4: 377
956501985_956501988 -9 Left 956501985 3:69896862-69896884 CCTTCAAACATTGCAGTTCAGCC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 956501988 3:69896876-69896898 AGTTCAGCCTCAGAAGGTGAGGG 0: 1
1: 0
2: 3
3: 16
4: 456
956501985_956501993 22 Left 956501985 3:69896862-69896884 CCTTCAAACATTGCAGTTCAGCC 0: 1
1: 0
2: 0
3: 6
4: 121
Right 956501993 3:69896907-69896929 CTGTAGTGGTTTGTGTTGAGTGG 0: 1
1: 0
2: 1
3: 19
4: 222

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956501985 Original CRISPR GGCTGAACTGCAATGTTTGA AGG (reversed) Intronic
903513921 1:23897207-23897229 TGCATAACTGCCATGTTTGAAGG - Intronic
907065788 1:51481862-51481884 ATCTGAAATTCAATGTTTGAAGG + Intronic
907593876 1:55702035-55702057 GGCTGCCCTGGAATGTATGAAGG + Intergenic
907965113 1:59321538-59321560 GGAGGAACTGCAATGTCTGGTGG + Exonic
909361189 1:74760501-74760523 GGCTGAACTGCAAGGATGAATGG - Intronic
910353179 1:86323352-86323374 GGCTGAACCACAATGAATGAAGG - Intergenic
910509849 1:87991533-87991555 TGCTGAACTTCAAGGTTTCAGGG + Intergenic
910521145 1:88123824-88123846 GTCAGAAATGCAATATTTGATGG - Intergenic
919550390 1:198978222-198978244 GGTTAAACTGCAATGTTTAATGG - Intergenic
1065856422 10:29834274-29834296 GGCTGCCCTGTAATATTTGAAGG + Intergenic
1065928674 10:30459124-30459146 GGCTGAACTGCATTCGTTGCAGG + Intronic
1066382062 10:34910448-34910470 GGCTGCTCTGCAATGTTTTGTGG - Intergenic
1067662300 10:48245392-48245414 GGCTGAACTGTAATGTGTCATGG - Intronic
1070443832 10:76474751-76474773 GTCTCAACAGCAATGTATGAGGG - Intronic
1075848299 10:125564938-125564960 GGCTGAGATGCAATGAGTGAAGG - Intergenic
1079372850 11:19866529-19866551 GGCTGAATTGAAATGTATCAAGG + Intronic
1080672009 11:34388876-34388898 GGCCGAACTGCTATAGTTGAAGG + Intergenic
1081060453 11:38468312-38468334 GGCTGGACTGCAATGTGCAATGG - Intergenic
1089176545 11:116552676-116552698 TGCTGAGCAGCAGTGTTTGAGGG + Intergenic
1098456639 12:70681645-70681667 GTTTGAACTGGAGTGTTTGAGGG - Intronic
1098806051 12:75020985-75021007 AGTTGGACTCCAATGTTTGAGGG - Intergenic
1098907169 12:76173825-76173847 GGCTAACCTGCAATGTTTTTTGG - Intergenic
1101033325 12:100680996-100681018 GGCTGAGCTGCAATGCAGGAAGG + Intergenic
1101238595 12:102815094-102815116 GGCTGCCTTGCAATGTTTCAAGG - Intergenic
1102473212 12:113171904-113171926 GGCTGAGCTGCGATGTTTAGTGG - Intronic
1102667020 12:114583309-114583331 GGACGAATTGCAATATTTGACGG - Intergenic
1103070928 12:117941239-117941261 GGCAGAAGTGGAATGTTTGGGGG - Intronic
1104484420 12:129137829-129137851 GGCTGCTCAGCAATGTTTGTAGG - Intronic
1112252071 13:97791493-97791515 GGCTGAGCTATAATGTTTGGTGG - Intergenic
1116469192 14:45267879-45267901 GACTCAACTGCAGTGTTTGTGGG + Intergenic
1117475770 14:56093322-56093344 TGCTGTGTTGCAATGTTTGAAGG - Intergenic
1118085616 14:62412653-62412675 GGTTGAACTGAGATGTGTGAAGG - Intergenic
1120119692 14:80664098-80664120 GGCTGAACCGCAATGTGAGGTGG - Intronic
1122384499 14:101334662-101334684 GGCTGACCTGAACCGTTTGAAGG - Intergenic
1124414681 15:29465279-29465301 TGCAGAACTTCAATGTTGGAAGG + Intronic
1131922620 15:97346311-97346333 GGCTGAACTGCAGTGGTGCATGG + Intergenic
1132038285 15:98504391-98504413 AGCTGAACTGCAAGGTTTTGGGG + Intronic
1134635815 16:15791001-15791023 GGCTGGAGTGCAGTGTGTGATGG + Intronic
1146829935 17:36059744-36059766 GCCTGGACTGGGATGTTTGAAGG + Intergenic
1153191949 18:2550544-2550566 AGCCAAACTGCAAAGTTTGAAGG + Intronic
1153265368 18:3263554-3263576 AGATGAACTGCAATTTCTGAAGG + Intronic
1155892029 18:31282043-31282065 GGCAGAAATGCACAGTTTGAGGG + Intergenic
1156553903 18:38046112-38046134 GGCTGACCTGCAATCTTTTGAGG - Intergenic
1157431022 18:47626871-47626893 GGCAGAAATGGAAAGTTTGAGGG - Intergenic
1159288486 18:66385292-66385314 GGTTGAGCTGCACTTTTTGATGG - Intergenic
1160124558 18:76158844-76158866 GGCTCAACTTAAATGTTAGAAGG + Intergenic
1162576650 19:11503216-11503238 GGCTGGACTGCAATGAGTGAGGG - Intronic
1166691959 19:44827482-44827504 TGCTCAACAGCAATCTTTGATGG + Intergenic
1167426994 19:49434490-49434512 GGCTGAACTCCTGTGTCTGAGGG - Intronic
1167968175 19:53165732-53165754 TGATGACCTGCAAGGTTTGAAGG + Exonic
1168238532 19:55078296-55078318 GGCTGGACTCCTAGGTTTGAGGG + Intronic
1168238750 19:55078888-55078910 GGCTGGACTCCTAGGTTTGAGGG + Intronic
929546631 2:42859325-42859347 AGCTCAGCTGTAATGTTTGAAGG - Intergenic
929663878 2:43817953-43817975 GGCTAAGCTGTAATGTTTGGTGG - Intronic
931995160 2:67832654-67832676 GGTTCAACTGCAATGATAGATGG - Intergenic
932969182 2:76517666-76517688 GGCTAAAGTGCAAAGTCTGAGGG - Intergenic
944261073 2:197677755-197677777 GGCAGAAATGGAATCTTTGAAGG + Intergenic
945509171 2:210679473-210679495 GGCTGACCAGCATTGTCTGATGG + Intergenic
947810673 2:233001955-233001977 GGCTGGAGTGCAATGGTTCAGGG - Intronic
1171849583 20:30298702-30298724 GGCTGAACTATGATGTTTGGTGG - Intergenic
1172652665 20:36515071-36515093 GGCAGAACTGGAATGTGGGAGGG + Intronic
1173661974 20:44741038-44741060 GGCTGAAGTGCAGTGGCTGATGG + Intergenic
1174131747 20:48349513-48349535 AGCTGATCTGCAATTTCTGAAGG + Intergenic
1175892703 20:62322555-62322577 GGCTGAGGGGCAGTGTTTGATGG - Intronic
1175902144 20:62364173-62364195 GGCCGCACTGCAAGCTTTGATGG + Intronic
1179019069 21:37621818-37621840 GGCTGGAAGGCCATGTTTGAAGG + Exonic
1182129576 22:27841037-27841059 GGGTCAACTGCAGTGTTTCACGG + Intergenic
1185142747 22:49112545-49112567 GGCTGAGCTGGAGTCTTTGATGG + Intergenic
949876618 3:8630011-8630033 GGCTGAACTACAAAGGCTGATGG + Intronic
950449235 3:13056271-13056293 GGCTGAACTCCAAGGATTGCAGG - Intronic
954636957 3:52076191-52076213 GGCTGATCTATAATGTTTGTGGG + Intronic
955193482 3:56783896-56783918 TGCTAAACTTCAATGTTTTAGGG - Intronic
956501985 3:69896862-69896884 GGCTGAACTGCAATGTTTGAAGG - Intronic
956929110 3:74022577-74022599 GGAAGAAATGAAATGTTTGATGG - Intergenic
958466667 3:94468627-94468649 GGCTGAAAAGCAATGTTTAATGG - Intergenic
959290875 3:104472285-104472307 GGAGGAACTGCAATGTTACATGG - Intergenic
960723748 3:120649689-120649711 GGCTGAGTTGCAGTGTCTGAGGG + Intronic
965877349 3:173342461-173342483 GGCAAAACTGCAATATTTAAGGG + Intergenic
965906168 3:173709232-173709254 GGCTGAACTCCAGTGTTAGAAGG - Intronic
967593087 3:191300562-191300584 GGCTGTATTGCAATGTGAGAAGG + Intronic
969929163 4:10613421-10613443 GGCTGAACTGGAATGCCTGCAGG + Intronic
973682780 4:53338414-53338436 AGCTGAACTGTAATGTGTGTTGG - Intronic
974858162 4:67485397-67485419 GGCTGAATCTCAAAGTTTGAAGG - Intronic
976612937 4:87048456-87048478 GTGTGAAGTGAAATGTTTGAAGG + Intronic
979743433 4:124179734-124179756 TGCTGAGCTGCCATGTCTGAAGG + Intergenic
981336090 4:143570356-143570378 GGAGGCACTGCACTGTTTGAGGG + Intergenic
982781626 4:159497202-159497224 GGCTGAATTTTAATGTATGAAGG - Intergenic
983434882 4:167700235-167700257 GCAGTAACTGCAATGTTTGAGGG - Intergenic
985045046 4:185932184-185932206 AGCTGAACAGCAATGCTTGCGGG + Intronic
985864589 5:2504491-2504513 GGCTGAGATGCCATGTTTGAAGG + Intergenic
987182041 5:15378174-15378196 GCTTGAAGTCCAATGTTTGAGGG + Intergenic
987900287 5:24002240-24002262 AACCAAACTGCAATGTTTGAGGG - Intronic
988389037 5:30603326-30603348 AGCTGAAGTGCAATTTTTAAGGG + Intergenic
990017296 5:51079547-51079569 GGCTGAGCTGCAATATGTAAAGG + Intergenic
991417545 5:66407770-66407792 GTCTGAACTGCAAGGGATGATGG + Intergenic
992985349 5:82223201-82223223 ACCTGAAGTGCAATCTTTGAAGG - Intronic
994034236 5:95180317-95180339 GGCCCAACTGGAATGTTTGGAGG - Intronic
1003564155 6:7208400-7208422 GGGTGAACTGCAGGGTTGGAGGG - Intronic
1007172009 6:39870665-39870687 GGAAGTACTGCAATGGTTGAGGG - Intronic
1008610330 6:53179595-53179617 GGCTGATCTGAAATGATAGAAGG - Intergenic
1009402985 6:63278027-63278049 GGCTGAAGTGCAATGTGGGGGGG - Intronic
1010543247 6:77118480-77118502 GGCAGGACAGCAATGTTTGGAGG - Intergenic
1010739036 6:79478121-79478143 TGATTAACTGCAAAGTTTGATGG - Intergenic
1012325763 6:97914994-97915016 GGCTGCACAGCAAAGATTGATGG - Intergenic
1012361342 6:98384555-98384577 GGCTGATTTTCAGTGTTTGAAGG + Intergenic
1024283314 7:47736973-47736995 GGCTCAACTGCATTGTCTTAGGG + Intronic
1029593780 7:101525854-101525876 GGCTGGACTGCCATGTAGGAGGG - Intronic
1031559113 7:123216229-123216251 GGTAGAACTGCAGTGTGTGAAGG - Intergenic
1039798285 8:40933560-40933582 GGCTGAGCTTTAATGTTTCAGGG + Intergenic
1042628097 8:70782111-70782133 GGTTGAACTTCAAAGTCTGATGG + Intronic
1043100554 8:76039863-76039885 GGCTGACCTGCAATGAAAGATGG - Intergenic
1043418041 8:80071564-80071586 GACTGAAGTGCAATGTCAGATGG - Intronic
1044547233 8:93473317-93473339 AGCAAAACTGCAAAGTTTGAGGG - Intergenic
1046865614 8:119146860-119146882 GGCTAAACTATAATGTTTGGTGG - Intergenic
1048950523 8:139492885-139492907 GGCTGAAAAGCAAAGGTTGATGG - Intergenic
1053194824 9:36108944-36108966 AGCTGAACTACTATGGTTGAAGG - Intronic
1053787361 9:41661996-41662018 GGCTGAACTATGATGTTTGGTGG - Intergenic
1054157766 9:61652771-61652793 GGCTGAACTATGATGTTTGGTGG + Intergenic
1054175638 9:61873335-61873357 GGCTGAACTATGATGTTTGGTGG - Intergenic
1054477540 9:65583776-65583798 GGCTGAACTATGATGTTTGGTGG + Intergenic
1054661901 9:67707475-67707497 GGCTGAACTATGATGTTTGGTGG + Intergenic
1058939628 9:109801130-109801152 TGCTGAGCTGAAATGTTTCACGG - Intronic
1189368240 X:40406617-40406639 TTCTGCACTGCAATGTGTGATGG + Intergenic
1199949498 X:152696566-152696588 GCCTAACCTGGAATGTTTGAAGG - Intergenic
1199951671 X:152712232-152712254 GTCTAACCTGGAATGTTTGAGGG - Intergenic
1199954317 X:152731425-152731447 GCCTAACCTGGAATGTTTGAGGG - Intronic
1199958012 X:152756216-152756238 GTCTAACCTGGAATGTTTGAGGG + Intergenic
1199960178 X:152771883-152771905 GCCTAACCTGGAATGTTTGAAGG + Intergenic