ID: 956503356

View in Genome Browser
Species Human (GRCh38)
Location 3:69910845-69910867
Sequence AAAAATCCACAGAAGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 437
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956503356_956503362 20 Left 956503356 3:69910845-69910867 CCTTGTCCCTTCTGTGGATTTTT 0: 1
1: 0
2: 2
3: 37
4: 397
Right 956503362 3:69910888-69910910 TAAGACTTTGAGAGCCTGTTGGG 0: 1
1: 10
2: 258
3: 1461
4: 1874
956503356_956503363 24 Left 956503356 3:69910845-69910867 CCTTGTCCCTTCTGTGGATTTTT 0: 1
1: 0
2: 2
3: 37
4: 397
Right 956503363 3:69910892-69910914 ACTTTGAGAGCCTGTTGGGAAGG 0: 1
1: 10
2: 240
3: 1467
4: 2132
956503356_956503361 19 Left 956503356 3:69910845-69910867 CCTTGTCCCTTCTGTGGATTTTT 0: 1
1: 0
2: 2
3: 37
4: 397
Right 956503361 3:69910887-69910909 TTAAGACTTTGAGAGCCTGTTGG 0: 1
1: 12
2: 299
3: 1621
4: 2113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956503356 Original CRISPR AAAAATCCACAGAAGGGACA AGG (reversed) Intronic
901000436 1:6146440-6146462 ACAAAGTCACAGAAGGGAGATGG + Intronic
901146120 1:7065682-7065704 AAGAATCCAGAAAAGGGAGATGG + Intronic
901883274 1:12206371-12206393 AAAAAAAGACAGAAGAGACAGGG + Intronic
902285143 1:15403431-15403453 TCAAATCCACAGAAGGGTCATGG - Intergenic
902674897 1:18001840-18001862 GAGAAACGACAGAAGGGACAAGG - Intergenic
902883827 1:19390725-19390747 AAAAAACCCCAGAAGGTAGAAGG + Intronic
902956670 1:19929388-19929410 AAAATTCCAAAGAAGAGAAAAGG - Intergenic
903839570 1:26228733-26228755 AAACATCAAAAGAAGGCACAGGG - Intergenic
904292373 1:29496547-29496569 AGAAATACAGAGAAGGCACATGG - Intergenic
904947606 1:34210945-34210967 AAAAATCCACAAAGGGGGCTGGG - Intronic
904972575 1:34430542-34430564 AAAAGTCCACAGACAGGACTTGG + Intergenic
905250637 1:36646099-36646121 AAAATTCCACGGAACTGACATGG + Intergenic
905277387 1:36827309-36827331 AAATATCCACAGAAGCCCCAGGG - Intronic
906972799 1:50534567-50534589 AAAAATCAACAGAAGAGGCTGGG - Intronic
908215747 1:61949902-61949924 AAAAAAGCAAAGAAGGGACCAGG + Intronic
908681518 1:66667026-66667048 AAAAATCCAGACAAGGAAAAGGG + Intronic
909494535 1:76263751-76263773 ACAAATTCACAGAAAGAACATGG - Intronic
911855382 1:102869432-102869454 AGAAATCCACATAAGTAACAAGG - Intergenic
912488796 1:110049819-110049841 AAAAAAGTACAGAAGGGACAGGG - Intronic
912544985 1:110444246-110444268 AAAAAGGCACAGAAGGGCAAGGG + Intergenic
913157527 1:116114684-116114706 CAAAATCTGCAGATGGGACAGGG - Intronic
913471716 1:119194380-119194402 AAAAATGCTTAGAAGGTACATGG + Intergenic
913956111 1:143295617-143295639 AAAAATACACAGAAGAGTAAGGG - Intergenic
913981321 1:143519823-143519845 AAAAATACACAGAAGAGTAAGGG + Intergenic
914075693 1:144346478-144346500 AAAAATACACAGAAGAGTAAGGG + Intergenic
914103485 1:144620018-144620040 AAAAATACACAGAAGAGTAAGGG - Intergenic
914890700 1:151620041-151620063 AAAACTTCAGAGAAGGGGCAAGG + Intronic
915757483 1:158276740-158276762 AAGAACCCACAAAAGGGAGATGG + Intergenic
915833299 1:159151663-159151685 AAAAATCCATAGAAGTGGCCGGG + Intergenic
916393269 1:164356868-164356890 AAAATTCCACAAAATTGACAGGG - Intergenic
916898220 1:169190204-169190226 AAAAATCAACAGTAGGGGAATGG + Intronic
919342728 1:196334415-196334437 AAAAATTCACAAAATGGACATGG - Intronic
919566153 1:199191389-199191411 AAAAATCCACACAAGGACTATGG + Intergenic
919684692 1:200472971-200472993 ATAGATCCATACAAGGGACAAGG + Intergenic
919972580 1:202590674-202590696 AAGAGTCCACATAAGGGAGATGG + Exonic
920257084 1:204662937-204662959 AAAAGGCCTCAGAAGGGAAATGG + Intronic
920874830 1:209825251-209825273 AATAATGCAGAGTAGGGACAGGG + Intergenic
920947011 1:210539163-210539185 AAGGATCCACACAAGAGACAAGG + Intronic
921859352 1:220025486-220025508 AAAATCTCACAGAGGGGACAAGG + Intronic
921885960 1:220306175-220306197 CAAAATCAACACAAGGAACACGG + Intergenic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
923749266 1:236732390-236732412 AAATATTCACAGAGGGGAAAAGG - Intronic
924054150 1:240108738-240108760 AAAAATGCACAGAAGGGGCCTGG + Intronic
924133530 1:240938187-240938209 AAAAATCCACAGATGTGGGAGGG - Intronic
1062766132 10:66679-66701 AAAAATCAACAGGCTGGACATGG + Intergenic
1063516509 10:6701424-6701446 AAATATGCACAGAATGGCCATGG - Intergenic
1063858375 10:10281306-10281328 AAAATTGCACAGAAGGCTCATGG - Intergenic
1063903904 10:10763599-10763621 AACAAGCCACAAAAGAGACATGG - Intergenic
1064674776 10:17749924-17749946 GGAAAGCCACAGAAGGGACGGGG + Intergenic
1065571172 10:27072310-27072332 AAGAATCCACAGAAGGAGCTGGG - Intronic
1065941630 10:30569515-30569537 AAAATTGAACAGAAGGTACAGGG + Intergenic
1066249339 10:33617932-33617954 TGAAAGCCACAGAGGGGACAGGG - Intergenic
1066782030 10:38961410-38961432 AAAAATACACAGAAGTGTAAGGG + Intergenic
1067429466 10:46233582-46233604 AAAAATGGAAAGCAGGGACAAGG + Intergenic
1067734601 10:48839642-48839664 TAAAAACCACAGAAAAGACAAGG + Intronic
1069063261 10:63916081-63916103 GAAAATCCACAGAAGGGGCCTGG - Intergenic
1069090919 10:64197498-64197520 AAAACTCCAGAGAACGGCCAGGG + Intergenic
1069253245 10:66298601-66298623 AAATATCCACGAAAGGGAAATGG - Intronic
1069487435 10:68833063-68833085 AAAAACCCACAGAAGTGGCTAGG - Intronic
1071311870 10:84350438-84350460 AAAAATGCACAGAACAGACCTGG - Intronic
1071930308 10:90462282-90462304 TAAAATCTACAGAAGGGTCCTGG - Intergenic
1071973662 10:90933466-90933488 AAAAAGCCACAGAAGGTTCTTGG + Intergenic
1072204798 10:93193752-93193774 AAGAACACACAGAAGGAACAAGG + Intergenic
1072409561 10:95187463-95187485 AAAAGTCCTCAGAAGGCTCAGGG - Intergenic
1073390996 10:103176223-103176245 GAGAATCCACAGGAGGGAGAGGG - Intronic
1073723102 10:106197612-106197634 AAAAAACAACAGAAGGAAAATGG - Intergenic
1073864392 10:107785134-107785156 GAAAAGCCAAAGAAGGGACAAGG - Intergenic
1074351307 10:112739632-112739654 AAAAATCTACAGCAGAGACAAGG - Intronic
1074480540 10:113816191-113816213 ATAAATCTACAGAATGTACAGGG + Intergenic
1075377430 10:121990101-121990123 AAAAATCCACAGAAGGTTGAAGG - Intronic
1075385090 10:122049669-122049691 AAAAATCAGAAGAAGGGAAAGGG - Intronic
1075894726 10:125984993-125985015 CAAAAGCCACAGCAGGGACCAGG - Intronic
1076371833 10:129960181-129960203 AAAATTCCACGGAAGGGGGAGGG + Intronic
1077616171 11:3675700-3675722 AACTATCCACAGAAGGAAGAGGG - Exonic
1078218632 11:9333308-9333330 AAAAATCCACGGGAAGGACTTGG - Intergenic
1078600124 11:12723027-12723049 AAAAATCCACAATAAGCACAAGG - Intronic
1078763401 11:14270668-14270690 AAGTATTCACAGAAGGGAAAAGG + Intergenic
1079534868 11:21501866-21501888 AAAATGCCAGAGAAGGGGCAAGG - Intronic
1079913521 11:26339677-26339699 ATGAAGTCACAGAAGGGACAGGG - Intronic
1080310817 11:30889673-30889695 AAAAATACACAGCATGGAAAAGG + Intronic
1080836610 11:35945464-35945486 AAAAATCCACAGCAGTCACCAGG - Intronic
1081124541 11:39306903-39306925 ACAAATCAACAGAATGGAAAAGG + Intergenic
1081900029 11:46619732-46619754 AAAAATCCTCTGAAGGGGCCGGG + Intronic
1082697967 11:56393920-56393942 AAAAATCCACAAAAGCCAGATGG - Intergenic
1084615426 11:70232513-70232535 AAAAAACGACAGAGGGTACATGG - Intergenic
1085392288 11:76188681-76188703 AAACAGACACAGAAGGGAGAGGG + Intronic
1086267425 11:85017929-85017951 AAAAAACCACATAAGGAACACGG + Intronic
1086906551 11:92424909-92424931 AAAAAATCACAGAAAGGAGAGGG - Intronic
1089290713 11:117436497-117436519 ACACATCCATTGAAGGGACATGG - Intronic
1089982710 11:122785610-122785632 AGAAATCCAGAGGAAGGACAGGG + Intronic
1090307118 11:125701045-125701067 AAAAAACCACAGATGGATCATGG + Intergenic
1090444888 11:126755749-126755771 AAAAGTGCAAAGAAGGGGCATGG - Intronic
1093159857 12:15733767-15733789 AAAATTCTAGAGAAGGGACTAGG + Intronic
1093840839 12:23898484-23898506 AGAAATCAACAGAAAGGTCATGG - Intronic
1095573945 12:43713410-43713432 AAATGTCCACAAAAGGAACATGG - Intergenic
1097357015 12:58613265-58613287 TAAAATCCTCAGAAGATACAGGG + Intronic
1097940104 12:65294804-65294826 AAAAACCCACAGAAACCACATGG - Intronic
1098256745 12:68624496-68624518 AAAAATCCTCAGACCAGACACGG + Intronic
1098344099 12:69482884-69482906 AAAACCCCACAGAAGGCAAATGG - Intronic
1099378466 12:81923924-81923946 AAAAATCTACAAAATGAACAGGG - Intergenic
1100433101 12:94547685-94547707 AAAAAGACAAACAAGGGACAAGG + Intergenic
1101096836 12:101350779-101350801 AAAGAACCACAGAAGGGAACAGG - Intronic
1101494142 12:105237307-105237329 CAAAATCAACAGAGGGGATATGG + Intronic
1101715679 12:107309850-107309872 AGAATTCCACAGGAGGGACATGG + Intergenic
1102559243 12:113750325-113750347 GACCATTCACAGAAGGGACATGG - Intergenic
1103172752 12:118835661-118835683 GGAAACACACAGAAGGGACACGG + Intergenic
1104205166 12:126631924-126631946 ACCAAACCACAGAAGGGACAGGG - Intergenic
1106812420 13:33372626-33372648 ACTATTCCACAGAAGGCACATGG + Intergenic
1107412086 13:40167225-40167247 AAAAATCCAGGGAAGGCAAATGG - Intergenic
1107662571 13:42654178-42654200 AAAAAGCCCCTGAAGGGAAATGG + Intergenic
1108273299 13:48783858-48783880 AAATATCCACAAAAGGAGCAAGG + Intergenic
1108403507 13:50076046-50076068 AAAAAGTTACTGAAGGGACAGGG + Intergenic
1109255607 13:60077205-60077227 AAAAATCCTCAAAAATGACAGGG + Intronic
1109986569 13:69993918-69993940 AAATATCCAGAGTAGAGACATGG + Intronic
1110366586 13:74693448-74693470 ACAAATTCACAGAAGTGAAAAGG + Intergenic
1111498017 13:89078279-89078301 AACATTCCACAGAAGTGAAATGG - Intergenic
1112130032 13:96513249-96513271 AAAAATACACAGAAAGATCAAGG - Intronic
1112676876 13:101711777-101711799 AAAAATGCACAGAAGGGAGATGG + Exonic
1113461638 13:110486042-110486064 ACAAGCCCACAGAAGGGCCACGG - Intronic
1115256081 14:31403743-31403765 AACAATCAACAGAAGACACAGGG + Intronic
1115489982 14:33950068-33950090 AAAGATCCAAAGGAGGGAAAGGG - Intronic
1115622978 14:35159031-35159053 AGAAATCCACAGAAGAACCACGG + Intronic
1116064561 14:39966446-39966468 GAAAAGCACCAGAAGGGACATGG + Intergenic
1116176378 14:41475532-41475554 AAAAAGACACAGAAGATACAAGG - Intergenic
1116576318 14:46580756-46580778 AAGAAACCACAGCAGGGCCACGG - Intergenic
1116965614 14:51011647-51011669 AAAAATGAAAAGAAGGAACAAGG - Intronic
1118109615 14:62702225-62702247 AAAATTCCACTGTTGGGACAGGG + Exonic
1118192505 14:63593549-63593571 AAAAACCTACAGTAGGGACCGGG - Intergenic
1118438447 14:65791878-65791900 AAAAAGCCACAGTTGGGCCATGG - Intergenic
1118930533 14:70236239-70236261 TAGACTCCAAAGAAGGGACAAGG - Intergenic
1118954331 14:70466013-70466035 TAGACTCCAAAGAAGGGACAAGG + Intergenic
1119040839 14:71273007-71273029 AAAAATACACAGAACACACACGG - Intergenic
1120929979 14:89838480-89838502 AAAAAAACACAGAAGACACAAGG + Intronic
1121952645 14:98185084-98185106 AAAAAGCCACAGAAGGCCCTGGG + Intergenic
1122345623 14:101057780-101057802 AAAAATGGACAGATGGGAAAAGG - Intergenic
1122458214 14:101872995-101873017 AAAAATTAACAGAATAGACATGG - Intronic
1122748997 14:103919085-103919107 AAAAATCCAGAGAATGGACTGGG + Intronic
1202938618 14_KI270725v1_random:119145-119167 AAAAATACACAGAAGAGTAAGGG - Intergenic
1123823829 15:24060955-24060977 AAAAATCCACAGAATAGGTATGG - Intergenic
1123972212 15:25517902-25517924 AAAAATGCACAGAGGGGGCCGGG - Intergenic
1124811451 15:32943195-32943217 AAATATCCACATAGGGTACACGG + Intronic
1125041760 15:35195872-35195894 AGATAGCTACAGAAGGGACAAGG - Intergenic
1125521188 15:40348601-40348623 AGAAAGCCACAGAATGGAGAAGG - Intergenic
1125621212 15:41064012-41064034 AAAAATGGACAGAAGAGAAATGG + Intronic
1125841930 15:42810634-42810656 AATAATCCAAAGAAGAGATATGG + Exonic
1126166499 15:45658505-45658527 GAAAATCCACAGAAAGCACTGGG + Intronic
1126978155 15:54209214-54209236 AGAAACCCAAAGAAGGGAAAAGG + Intronic
1127998164 15:64167244-64167266 ATAAACCCACATAAGGGCCATGG + Exonic
1130226665 15:82064161-82064183 AAACATCCAGAGAAGGGATAGGG - Intergenic
1130975412 15:88769688-88769710 AAATATCAAGAGGAGGGACAAGG - Intergenic
1132182199 15:99765035-99765057 AAACATCCACACAAAGCACATGG + Intergenic
1133576933 16:7100695-7100717 AAAAATGTACAAAATGGACAAGG + Intronic
1136378537 16:29879715-29879737 AAACAGCCTCTGAAGGGACAGGG + Intronic
1136463840 16:30428786-30428808 AAAAAACAAAAGAAGGGAAAAGG + Intronic
1136700619 16:32136846-32136868 AAAAATACACAGAAGAGTAAGGG + Intergenic
1136767039 16:32790619-32790641 AAAAATACACAGAAGAGTAAGGG - Intergenic
1136801110 16:33080082-33080104 AAAAATACACAGAAGAGTAAGGG + Intergenic
1136947871 16:34677210-34677232 AAAAATACACAGAAGAGTAAGGG + Intergenic
1137085123 16:36110948-36110970 AAAAATACACAGAAGAGTAAGGG - Intergenic
1137221669 16:46458433-46458455 AAAAATACACAGAAGAGTAAGGG - Intergenic
1138139107 16:54551623-54551645 ACAAATCTATAGAAGGGAGAAGG - Intergenic
1138968208 16:62111466-62111488 AAGAATTCACAAAAGAGACAAGG - Intergenic
1140210950 16:72969754-72969776 AAAAAAACACAGAAGGGAACTGG - Intronic
1140399631 16:74660465-74660487 AAAAAACCAAAAAACGGACAGGG + Intronic
1140520697 16:75578652-75578674 AAAGATGCACAGAAGTGATATGG - Intergenic
1140522349 16:75592731-75592753 AAAAAACCAGGGAGGGGACAAGG + Intergenic
1140777297 16:78261498-78261520 AAAAATCTGCAGAAGAGAAATGG - Intronic
1141102974 16:81211420-81211442 AAAAAACCTCAGCAGGGACGTGG - Intergenic
1141319167 16:82990516-82990538 AAAAACCCACACAAACGACAAGG - Intronic
1141498077 16:84423951-84423973 AAGAAGCCCCAGAAGGGACTGGG - Intronic
1142337769 16:89501332-89501354 AAAAATACACAGCAGGGACGGGG + Intronic
1203069434 16_KI270728v1_random:1052865-1052887 AAAAATACACAGAAGAGTAAGGG - Intergenic
1142576373 17:911206-911228 AAAAATCCCAAGCAGGGGCAGGG - Exonic
1143060465 17:4196226-4196248 AAGAATCAACAGCAGGGAAAGGG + Intronic
1143478346 17:7215570-7215592 AAAAATCCACCGAAACTACAGGG + Intronic
1144250136 17:13408026-13408048 CCCAAGCCACAGAAGGGACAAGG - Intergenic
1145324142 17:21785231-21785253 AAAAATACACAGAAGAGTAAGGG - Intergenic
1145326465 17:21833562-21833584 AAAAATACACAGAAGAGTAAGGG + Intergenic
1147262438 17:39216530-39216552 GAACATCCAGAGAAGGGAAATGG + Intronic
1148243634 17:46016065-46016087 ACAAAGTCACAGAGGGGACATGG - Intronic
1148286852 17:46400913-46400935 AAAAATCCACAGAAGTCATCTGG - Intergenic
1148309020 17:46618503-46618525 AAAAATCCACAGAAGTCATCTGG - Intronic
1149081308 17:52660958-52660980 AAGATTCCACAGAAGTGAGAGGG - Intergenic
1149957506 17:61069103-61069125 AAAAAACCAAAGAAGTGACTTGG + Intronic
1150015091 17:61548405-61548427 GAAAAACGACAAAAGGGACAAGG - Intergenic
1150200955 17:63357033-63357055 TACAATTCACAGAAGGGACTTGG - Intronic
1152602348 17:81270779-81270801 TAAAACCCACAAAAGGGACTTGG - Intronic
1152959000 18:66259-66281 AAAAATCAACAGGCTGGACATGG + Intronic
1153311898 18:3685264-3685286 AAAAATCCAAAGATGGGGCCTGG + Intronic
1153561224 18:6373691-6373713 AAAATCCCACAGAAAGTACAAGG + Intronic
1154154671 18:11934663-11934685 AAAAATAGACAGAAGGGGCCGGG + Intergenic
1154516551 18:15173622-15173644 AAAAATACACAGAAGAGTAAGGG - Intergenic
1154948384 18:21184555-21184577 AGAAATGCCCAGGAGGGACAAGG + Intergenic
1155410999 18:25544726-25544748 AAACTTCCCCAGAAGCGACATGG - Intergenic
1155584722 18:27351873-27351895 AAAAATCCTCAGACTGGGCATGG + Intergenic
1156039759 18:32807344-32807366 GAAAATCCACACAAAGAACATGG + Intergenic
1156506271 18:37596427-37596449 AAAAAGCCACAGAGGGTAAAGGG - Intergenic
1158545429 18:58392232-58392254 AAAAACCAACACGAGGGACATGG - Intronic
1158787698 18:60735477-60735499 AAAAATCCTCAGAATCGATAAGG - Intergenic
1159542526 18:69796184-69796206 AAAATTCCAAAGAAGGGTCCTGG + Intronic
1159595938 18:70382921-70382943 AAAAAACAACAGGAGGGAAAGGG + Intergenic
1159957319 18:74528828-74528850 ATAAATACACAGAAGCAACAAGG - Intergenic
1161407033 19:4096403-4096425 AGAAACCCACAGAAGGCCCAGGG + Intronic
1161735466 19:5989747-5989769 AAATATCCAGAGGAGTGACAAGG - Intergenic
1162650838 19:12087782-12087804 AAAAATCAACAGAAAGAAAAGGG - Intergenic
1162783017 19:13016881-13016903 AAAACACCACAGAAGGGCCATGG - Intronic
1163230035 19:15995527-15995549 AGAAATTCACAGAAGTAACAAGG + Intergenic
1163502224 19:17683111-17683133 ATCACTCCACAGAAGGGACTTGG + Intronic
1165219388 19:34302582-34302604 AAAAATCCACAGGACAGGCAGGG - Intronic
1165271078 19:34708126-34708148 TAAAAACCACAGAAGGTCCAAGG + Intergenic
1165498986 19:36172466-36172488 AAAAATCCATTGAGGGGAAAAGG - Intergenic
1165572488 19:36787041-36787063 AAAAATGTTCAAAAGGGACAGGG + Intergenic
1168673614 19:58260236-58260258 AGAAATCCACAGAATGAACTGGG - Intronic
925554939 2:5120641-5120663 AAAAACCCACAGACGAGAGAAGG - Intergenic
926137398 2:10346450-10346472 AAAAAGCCACAGAGGGGACTGGG - Intronic
926310400 2:11670566-11670588 ACAAATCAACACAAGGGCCAAGG - Intergenic
926588079 2:14711156-14711178 AATAATACACAGCAGGGAAATGG - Intergenic
926855588 2:17252465-17252487 AAAAAGCCACAGAATAGGCAGGG + Intergenic
926932103 2:18050986-18051008 AAAAATGCACACAATTGACAAGG - Intronic
926997229 2:18749166-18749188 ATAAATCCACAGCAAGAACAGGG - Intergenic
928433802 2:31240759-31240781 AAAAATGCCCAGAATGAACAGGG - Intronic
928744290 2:34393585-34393607 AAAAACCCACAGCAGGGGCGGGG - Intergenic
928854515 2:35788554-35788576 GAAAATGCCCAGAAGGGAGAAGG + Intergenic
929325546 2:40606469-40606491 AAAAGCCAACTGAAGGGACAGGG - Intronic
930702664 2:54474703-54474725 AAAAATATACAAAAGGGATAAGG + Intronic
930837107 2:55806032-55806054 AAGAATCCACAGAAAAGCCAGGG + Intergenic
931449921 2:62359975-62359997 ACAACACCACAGAAGAGACAAGG - Intergenic
931554566 2:63487951-63487973 AGAAATCCACAGACGAGAAAGGG + Intronic
931578837 2:63751637-63751659 AGAGAGCCAGAGAAGGGACATGG - Intronic
931956965 2:67438348-67438370 AAAAAACCTCTGAAGGGTCATGG - Intergenic
931989731 2:67777911-67777933 AAGAATCCACCGAAGGATCATGG + Intergenic
932230493 2:70080219-70080241 AAAAAAAAACAGAAGGGGCAGGG - Intergenic
932901090 2:75700887-75700909 AAAAACACACAGTAGAGACATGG + Intronic
934506184 2:94896605-94896627 GAAAAGCCACAGAAGAGGCAGGG + Intergenic
935388746 2:102528436-102528458 AAAAATCTTAAAAAGGGACAGGG + Intronic
937142767 2:119616496-119616518 AGGAAGCCACAGAAGGGAGATGG - Intronic
937889179 2:126923435-126923457 AAAAATACACAGAAAGAAAAGGG - Intergenic
939428253 2:142069062-142069084 AAAAATACAGAGAAGGGAGAAGG - Intronic
940557511 2:155249574-155249596 AAAACTCTACAGGAGGTACAAGG + Intergenic
941173301 2:162165692-162165714 CAAAATCCACAGATGAGACCAGG + Intergenic
941413229 2:165186586-165186608 GATAATTCACAGAAGGGACCTGG - Exonic
941678422 2:168368986-168369008 AATAATCCACACAAGAGAAATGG + Intergenic
942003222 2:171671740-171671762 AGAAATCCAGAGAAAGGAAAAGG + Intergenic
943122068 2:183748956-183748978 ACAAATCCAGAAAAGGTACAGGG + Intergenic
944248719 2:197559719-197559741 AAGAATCCACAAAAGGGAAAAGG - Intergenic
944498202 2:200329722-200329744 AAAGATCCACAGACGTGGCAAGG - Intronic
945646263 2:212498970-212498992 AATAACCCACAGCAGGGTCATGG + Intronic
945787377 2:214258901-214258923 AAAAATACTCAGTAGGGAAATGG - Intronic
945926422 2:215809860-215809882 AAAAAAAAAAAGAAGGGACAGGG + Intergenic
946025023 2:216666451-216666473 AAAAGTTCAAAGAATGGACAAGG - Intergenic
946236645 2:218328393-218328415 ATAAAGCCAGAGAGGGGACAGGG - Intronic
946713055 2:222525864-222525886 AAAAACCCACACAAGGGACCAGG - Intronic
948150749 2:235742869-235742891 AAAAATCTACAGAAGAGGCTAGG + Intronic
1168797899 20:623800-623822 AAATATACACAAAAGGCACAGGG - Intergenic
1168964552 20:1891483-1891505 AGGAATCGACAGAAGGCACAAGG + Intergenic
1171485944 20:25486246-25486268 AAAAATCCAAAAAAAGGAAAGGG + Intronic
1172634052 20:36397480-36397502 ATAAATCCAAAGAAGGGAGAAGG - Intronic
1172876367 20:38166721-38166743 AAATATCCACTGAAGCAACACGG - Intergenic
1172912129 20:38417700-38417722 AAAATTCCACAAAGGGGACCAGG + Intergenic
1173837212 20:46133851-46133873 AAAAATCCACAAAAGTGGCCGGG + Intergenic
1175051788 20:56162248-56162270 AAAAAAACCCAGAAGTGACAGGG + Intergenic
1175481009 20:59310878-59310900 AAAAATCCAGAAAAGTTACATGG - Intronic
1175499929 20:59442396-59442418 AAAAATTCACGGAAAGGTCATGG - Intergenic
1176111225 20:63411621-63411643 AAAAAGCCACAAGAGGGAGAAGG - Intronic
1176584697 21:8569988-8570010 AAAAATACACAGAAGAGTAAGGG + Intergenic
1177155886 21:17501017-17501039 AAACAGCCACAGCAGGGACGGGG + Intergenic
1177414968 21:20781198-20781220 AAAATGCCACAGAAAAGACAGGG + Intergenic
1177738923 21:25129579-25129601 AAAAAAACAGAGAAGGGACCAGG + Intergenic
1178753298 21:35324378-35324400 AGAAATAAACAGAAGGGACAGGG - Intronic
1178855660 21:36248459-36248481 AACATTCCAGAGAAGGGCCATGG - Exonic
1178896455 21:36562681-36562703 AAAAAAGCACAGAATGGATAGGG - Intronic
1179427505 21:41293588-41293610 AAAAGTTCACAGAAGGAAGATGG - Intergenic
1180267508 22:10546890-10546912 AAAAATACACAGAAGAGTAAGGG + Intergenic
1181368197 22:22396257-22396279 CAAAATCCACAGAAATGACCAGG - Intergenic
1181371629 22:22423528-22423550 CAAAATCCACAGAAGTTACCAGG - Intergenic
1185035055 22:48470412-48470434 AAAAATCCAGAGAAGGGTTAGGG - Intergenic
950837772 3:15936893-15936915 AAAAATCCATAAAAGGGAAAAGG + Intergenic
951265527 3:20561338-20561360 AAAGATTAACAGAAGGGAAAAGG + Intergenic
951791311 3:26487891-26487913 AAAAATGGACTGAAGTGACAGGG + Intergenic
952659999 3:35834008-35834030 AAAAGGCCACAGAAGGAAAAGGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
953487071 3:43310524-43310546 AATAATCCAAGAAAGGGACAGGG - Intronic
953779475 3:45854094-45854116 AAGAAACCACAGAAAGGAGAGGG - Intronic
953981476 3:47415271-47415293 AAGAAGGCACAGGAGGGACATGG + Intronic
955921997 3:63966934-63966956 AAAAATCCCCACAAGTGACATGG - Intronic
956034977 3:65080810-65080832 CAAAATCCACTGGTGGGACAAGG - Intergenic
956503356 3:69910845-69910867 AAAAATCCACAGAAGGGACAAGG - Intronic
957682828 3:83459732-83459754 AGAAGTCCACAGAAAGGAAAGGG + Intergenic
958816101 3:98917674-98917696 GAAAACCCAAAGAATGGACAGGG - Intergenic
961313061 3:126016138-126016160 AAAACTCATCAGAATGGACAGGG + Intronic
961818856 3:129565065-129565087 AGAAAACCACAGATGGGACAAGG + Intronic
963754895 3:149224558-149224580 AAAAATAAACAGGAGGGAGAAGG + Intergenic
964141766 3:153410557-153410579 ACAAATACACAGAAGAGAGAAGG + Intergenic
964276286 3:155012023-155012045 AAAAAACCCCACAAAGGACAGGG - Intergenic
966118103 3:176489289-176489311 AAGAATGGGCAGAAGGGACAGGG + Intergenic
966181161 3:177189746-177189768 AAAAATTTACTGAAGGGAGATGG + Intronic
966669695 3:182513313-182513335 AAAAATCCATAGAAGAGGCTGGG - Intergenic
967738827 3:192983117-192983139 AAAAAAACAGAGAAAGGACAGGG - Intergenic
968056268 3:195694268-195694290 CATAATCCCCAAAAGGGACAAGG - Intergenic
971790984 4:31169448-31169470 AAAAATCCAGAGGAAAGACATGG - Intergenic
975331725 4:73123477-73123499 AATACTCCACACAAGAGACAAGG - Intronic
975760051 4:77611075-77611097 TAAAATCCAGAGCAGGGATAAGG - Exonic
975951262 4:79774518-79774540 AAAAAACCACAAAAGGTAAATGG + Intergenic
975971024 4:80037036-80037058 AAACCACCACACAAGGGACAAGG + Intronic
976325697 4:83769348-83769370 AGAAATACACAGAAGGGGGAAGG - Intergenic
976754784 4:88486426-88486448 AAAAATGCACAAAAAGGAAAGGG + Intronic
977480955 4:97574736-97574758 AAAAATCCACAGAAGCAGAAAGG - Intronic
977561599 4:98538420-98538442 AAAGGTCCACAGGATGGACAGGG + Intronic
978184397 4:105839864-105839886 AAATTTCTACAGTAGGGACAGGG + Intronic
981506381 4:145504800-145504822 AAAAATTCACAAAATGGAAAGGG - Intronic
981647299 4:147014582-147014604 AAAAAAACACAGGAGGGATATGG + Intergenic
983116107 4:163818403-163818425 AAAATTCCACAGAATCAACAAGG - Intronic
984343108 4:178484223-178484245 AAATATGCACAGAATGGATATGG + Intergenic
985139284 4:186822192-186822214 ACAAAACCACCGAAAGGACAGGG - Intergenic
985729086 5:1536717-1536739 GAAAATCCACTGAAGGGTAAGGG - Intergenic
985983773 5:3495526-3495548 AAATATTCACAGATGAGACAAGG - Intergenic
986425589 5:7628102-7628124 AAAATTCCACAGTTTGGACAAGG + Intronic
986601333 5:9476148-9476170 AAATGTCCACAGAAGTGACCTGG - Intronic
986797849 5:11230053-11230075 AAAAATCCGCAAAAGGGACATGG + Intronic
990250902 5:53914037-53914059 AAACACTCACAGAAGGGAAAAGG - Intronic
990462880 5:56046170-56046192 AAAAATCCATAGAAGTGAGAAGG - Intergenic
991021532 5:61984504-61984526 AAAAATGCAGGGAATGGACAAGG + Intergenic
992090549 5:73312436-73312458 TAAAATCCACAGAAGAGAAGGGG + Intergenic
993714435 5:91261411-91261433 AGAAAACCACAGAAGGGATAAGG + Intergenic
994064893 5:95528186-95528208 AAAAATAAACAGAAGTGATATGG - Intronic
994260811 5:97656390-97656412 AAACATGCACAGAAGGAAGAGGG + Intergenic
994639785 5:102393163-102393185 GAGAATGCACAGAAGGGATAAGG - Intronic
995997520 5:118319719-118319741 AAAGATCCACAGAAGTGGCCAGG + Intergenic
997430305 5:133833749-133833771 AAAAAGACCCAGAAAGGACAAGG - Intergenic
999648942 5:153746766-153746788 AAAAATACACAGAAGGAAATGGG + Intronic
999733944 5:154498674-154498696 GAAAGTCCTCAGAAGGGGCAGGG - Intergenic
999838196 5:155397327-155397349 CAAACTCCACACAAGGGAAAGGG - Intergenic
999977489 5:156926197-156926219 AAAAATCCACAGTAGTGGCCAGG - Intronic
1000651733 5:163826410-163826432 AAAAATGCATCCAAGGGACAGGG - Intergenic
1002796023 6:471545-471567 AAACATCCCCAGGTGGGACAGGG - Intergenic
1003511951 6:6789191-6789213 AAAAAACCTCAGCAGGCACAAGG + Intergenic
1003724437 6:8744483-8744505 AAAAATCCAAAGATTGGAAATGG - Intergenic
1003990485 6:11481856-11481878 ACAAATACACAGAAGGAACATGG + Intergenic
1004294527 6:14398111-14398133 AAAAATCCACAGCAGTATCATGG - Intergenic
1004662426 6:17722061-17722083 AAAAATGTACAGAAGGGAAGAGG - Intergenic
1004790200 6:19017172-19017194 CAAAATCAACACATGGGACAGGG + Intergenic
1006042593 6:31268572-31268594 AAGTTTCCACTGAAGGGACAAGG + Intergenic
1006052184 6:31353694-31353716 AAGTTTCCACTGAAGGGACAAGG + Intronic
1006483179 6:34315136-34315158 AAAAATCCACATTAAGGACCAGG + Intronic
1008070048 6:47090382-47090404 AAAAATTAACTGAAGGCACAAGG - Intergenic
1008161358 6:48079953-48079975 AAAAATCATCATAAGGGGCAGGG - Intergenic
1008827080 6:55709132-55709154 AAAAGTTCACAGAAAAGACAAGG + Intergenic
1009298493 6:61985042-61985064 AACAAGCCACAGGAGGGACTAGG - Intronic
1010047500 6:71463501-71463523 AATAATCCAGAAAAGGGATACGG + Intergenic
1010189279 6:73178290-73178312 AAAAATCTACAGGAGGGGCCAGG + Intronic
1012468976 6:99548516-99548538 AAAAATCAATAGAAGGGGCTGGG + Intronic
1013275505 6:108581060-108581082 CAACTTCCACAGAAGGGGCAGGG - Intronic
1013547690 6:111175166-111175188 AAGGATTCAGAGAAGGGACATGG - Intronic
1014347197 6:120287388-120287410 ACAAATCCACAGAAGGAAAAGGG - Intergenic
1014622287 6:123683188-123683210 AAAAATCAACAAAAGTTACATGG + Intergenic
1014963758 6:127720943-127720965 AAAATTCTATAGAAAGGACATGG - Intronic
1016348340 6:143140446-143140468 AAAAAGGTACAGAAAGGACAGGG - Intronic
1016370039 6:143364361-143364383 AAAAATCCAGAACAGGGGCAGGG + Intergenic
1017802522 6:157910595-157910617 AAAAAACAAGAGAAGGGAGAGGG - Intronic
1018368492 6:163146324-163146346 GAAAATCAACAGAAGGCACCAGG - Intronic
1018655960 6:166036281-166036303 AAAATTAAACAGAAGGAACATGG - Intergenic
1019975609 7:4578997-4579019 AAAAGCCCATAGAAGGGGCATGG - Intergenic
1020246785 7:6435546-6435568 TAAAGGCCACAGAAGGAACAGGG + Intronic
1020614170 7:10437751-10437773 AAAAATCCCAAGAAGGTACATGG + Intergenic
1020623208 7:10543815-10543837 AAGAATCCACAGAATTGATACGG + Intergenic
1022889882 7:34685815-34685837 AAAAATACAGAGAAGGTAAAAGG + Intronic
1022991049 7:35707540-35707562 AAAAAGCCACAGAAGCATCATGG + Intergenic
1023229544 7:38011885-38011907 AAAAATGGACAAAAGAGACATGG + Intronic
1024182588 7:46910806-46910828 AAAAATGCAAAGATGGTACACGG + Intergenic
1024815166 7:53260511-53260533 AAAAATCGAAAGAAGGAACTTGG - Intergenic
1025024490 7:55505241-55505263 AATAATCCACAGTCGGGTCAGGG + Intronic
1025483241 7:61012875-61012897 AAAAATACACAGAAGAGTAAGGG + Intergenic
1025489265 7:61091912-61091934 AAAAATACACAGAAGAGTAAGGG - Intergenic
1026381227 7:69801298-69801320 AAAAATAAACAGAAAGGAGATGG + Intronic
1028831433 7:95330950-95330972 AAAAATCCAAAGAAAGGAGAAGG + Intergenic
1029035335 7:97513983-97514005 CAGAATGCACAGAAGGGGCATGG - Intergenic
1029510252 7:100990069-100990091 TATATTCCACAGAAGGCACAAGG + Intronic
1030666973 7:112289325-112289347 CAACATACACAGAAGGCACATGG - Intronic
1031944572 7:127825733-127825755 AAAAAAATACAGAAGAGACATGG - Intronic
1032191002 7:129765868-129765890 AGTAAGCCACAGAAGGGACCTGG + Intergenic
1032822591 7:135538117-135538139 AGAAATCCAGATAAGAGACAGGG - Intergenic
1033634390 7:143197251-143197273 AACAATCAGCAAAAGGGACAAGG + Intergenic
1033684967 7:143630462-143630484 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033688140 7:143709681-143709703 AAAAATGCACAGAAGGAAGAAGG - Intronic
1033699646 7:143827159-143827181 AAAAATGCACAGAAGGAAGAAGG + Intergenic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1035951034 8:4021356-4021378 AAAAATCCCCAGATGCGACACGG - Intronic
1035973279 8:4277296-4277318 AAAAATCCACTGAAGGGAACGGG + Intronic
1037151938 8:15647373-15647395 AAAAATGAACATAAGAGACAAGG - Intronic
1037459646 8:19096082-19096104 ACAAACCCACAGAATGGGCAGGG + Intergenic
1038288093 8:26224291-26224313 AAAAATCCAGAAAAGGGGCTGGG + Intergenic
1039346225 8:36708622-36708644 AGAATTCAACAGAAGGGACCTGG - Intergenic
1039538047 8:38337162-38337184 AAAAATCCACAAAACTGATACGG + Intronic
1041657588 8:60369519-60369541 AAAAATTTACAGAAGTGACCTGG + Intergenic
1042365663 8:67933733-67933755 GAAAATACACAGAAGAGAGAAGG + Intergenic
1042413568 8:68492876-68492898 AAAAATCCACAGAAAGGCTTTGG + Intronic
1042669906 8:71250058-71250080 AAATATCCACAAAAGACACAAGG - Intronic
1043384588 8:79735640-79735662 AAAAAGTCAAAGAAGGGAAATGG + Intergenic
1043415423 8:80043421-80043443 AAAAATGCAAAGAAAGGAAAAGG + Intronic
1046190733 8:110791122-110791144 AAAAATTCACAGAGAGGCCAGGG + Intergenic
1046525989 8:115382888-115382910 AAGAATCCCCAGAGGGGAAAGGG + Intergenic
1046732032 8:117736234-117736256 AAATATGCACACAGGGGACAGGG + Intergenic
1046900452 8:119518254-119518276 ATAAATCCAAAGAATGTACAGGG - Intergenic
1047204156 8:122789958-122789980 AAAGAGCCACAGAACGGAAACGG + Intronic
1048778992 8:137980435-137980457 AAAAATACACAGAAGCCAAAAGG - Intergenic
1048912120 8:139145473-139145495 AAAAATACACAAAGGGGAAAGGG - Intergenic
1051329400 9:16008009-16008031 GATAATCCACAGAATGGAAAAGG - Intronic
1051509539 9:17862134-17862156 ACAAATCCTCAGGAGAGACAGGG - Intergenic
1052404998 9:28048227-28048249 AATAATCCACAGAAGAAACTCGG + Intronic
1053162698 9:35824646-35824668 AAAAAAAAACAGAAGGGTCATGG - Intronic
1053383243 9:37666489-37666511 TAAAGTGCACAGAAGGGAGATGG - Intronic
1053417461 9:37955781-37955803 AAAAATCCACAGACTGGGCCGGG - Intronic
1053822943 9:41988221-41988243 AAAAATTCAAAGAAGGTAAAAGG - Intronic
1054607631 9:67199144-67199166 AAAAATTCAAAGAAGGTAAAAGG + Intergenic
1055195304 9:73584208-73584230 AAAAATCCACCCAAGTTACAAGG + Intergenic
1055664884 9:78543387-78543409 AAAAAGTCACAGAAGGAAAAAGG - Intergenic
1056569993 9:87806555-87806577 AAATATCAAGAGAAAGGACATGG + Intergenic
1056786050 9:89593275-89593297 ACAAAGCCACAGAAGGGAGTAGG - Intergenic
1057292399 9:93815060-93815082 AGAAATCCATAGAAGAGAAAAGG + Intergenic
1058244491 9:102605907-102605929 AAAAATCAACAAATGGGATAAGG + Intergenic
1058269809 9:102957331-102957353 AAAAAAGCACAGAAGAGAAATGG - Intergenic
1062332452 9:136050725-136050747 GACACTCCAGAGAAGGGACACGG + Intronic
1203614602 Un_KI270749v1:47510-47532 AAAAATACACAGAAGAGTAAGGG + Intergenic
1186094761 X:6088091-6088113 GCAAATCCACAAAAGGGAAAAGG + Intronic
1186273268 X:7913229-7913251 AAAAACCCACTGAAAGGAGAGGG + Intronic
1188605338 X:32022154-32022176 AAAAATCCAGAAAAGGGGCCTGG + Intronic
1189313393 X:40035770-40035792 AAGCATCCATAGAAGAGACAGGG - Intergenic
1192563783 X:72145751-72145773 AAAAGTCCACAGAAGTAACAAGG - Intergenic
1192796125 X:74425199-74425221 AAAAAGCCACAGAAGTTAGAAGG + Intronic
1192796754 X:74429854-74429876 ACACCTCCACACAAGGGACATGG - Intronic
1193310064 X:79996636-79996658 AATTTTCCACAGAAGTGACAAGG + Intergenic
1194931140 X:99888463-99888485 AAAAATCCAAAGCAAGCACAAGG + Intergenic
1197634933 X:128904147-128904169 AAAACTCACCAGCAGGGACAAGG + Intergenic
1199835382 X:151585107-151585129 AAAAATGCACATAAAGGGCAAGG + Intronic
1200147412 X:153933809-153933831 AAAATTGAACAGAAAGGACATGG - Intronic
1201448660 Y:14085353-14085375 AAATACCCACTGAAAGGACAGGG - Intergenic
1201550574 Y:15212756-15212778 AAAAATGAACAGAAGGTGCAAGG + Intergenic