ID: 956506074

View in Genome Browser
Species Human (GRCh38)
Location 3:69941620-69941642
Sequence TTCCCTTGGCTGCAGTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1299
Summary {0: 1, 1: 0, 2: 0, 3: 46, 4: 1252}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956506074_956506078 17 Left 956506074 3:69941620-69941642 CCAGTACACTGCAGCCAAGGGAA 0: 1
1: 0
2: 0
3: 46
4: 1252
Right 956506078 3:69941660-69941682 ATTCACAGTGGTGCTCTAGTTGG 0: 1
1: 0
2: 0
3: 4
4: 88
956506074_956506077 5 Left 956506074 3:69941620-69941642 CCAGTACACTGCAGCCAAGGGAA 0: 1
1: 0
2: 0
3: 46
4: 1252
Right 956506077 3:69941648-69941670 GTGAACTGCACTATTCACAGTGG 0: 1
1: 0
2: 1
3: 5
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956506074 Original CRISPR TTCCCTTGGCTGCAGTGTAC TGG (reversed) Intronic
900508502 1:3043593-3043615 TTCCCTAGGCTGGAGTGCAATGG - Intergenic
900925588 1:5704194-5704216 TTGCCTAGGCTGCAGTGCAGCGG - Intergenic
901075383 1:6551557-6551579 TCGCCCAGGCTGCAGTGTACTGG - Intronic
901213830 1:7542473-7542495 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
901295002 1:8154389-8154411 TTCCCTGGGCTGGAGTGCAGTGG + Intergenic
901357352 1:8662656-8662678 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
901571312 1:10163096-10163118 TCGCCTTGGCTGGAGTGCACTGG + Intronic
901587210 1:10306715-10306737 TTGTCCTGGCTGCAGTGCACTGG - Intronic
901607313 1:10469558-10469580 TTACCCAGGCTGCAGTGCACTGG + Intronic
901956082 1:12786964-12786986 TTTCCCAGGCTGCAGTGTAGTGG + Intergenic
901979462 1:13023033-13023055 TTTCCCAGGCTGCAGTGTAGTGG + Intronic
902002621 1:13205905-13205927 TTTCCCAGGCTGCAGTGTAGTGG - Intergenic
902021855 1:13351668-13351690 TTTCCCAGGCTGCAGTGTAGTGG - Intergenic
902024942 1:13375955-13375977 TTACCTAGGCTGCAGTGCAGAGG - Intergenic
902034679 1:13448780-13448802 TTCCCCAGGCTGGAGTGTAGTGG + Intergenic
902322681 1:15679656-15679678 TCCCCTTGGCTTCATTGCACTGG + Intergenic
902356623 1:15906814-15906836 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
902424243 1:16306940-16306962 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
902444468 1:16453147-16453169 TTGCCTAGGCTGCAGTGTAATGG + Intronic
902482723 1:16720004-16720026 CTCCTTTGGCTGCAGCGTAGTGG + Intergenic
903109561 1:21118886-21118908 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
903437606 1:23363326-23363348 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
903465097 1:23546439-23546461 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
903502037 1:23805979-23806001 TTGCCTAGGCTGGAGTGCACTGG + Intronic
903696774 1:25213372-25213394 TTGCCTGGGCTGGAGTGTAGTGG - Intergenic
903881730 1:26514955-26514977 TTGCCTGGGCTGGAGTGCACTGG + Intergenic
903883414 1:26527814-26527836 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
903893850 1:26589533-26589555 TCCCCTAGGCTGCAGTGCAGTGG + Intergenic
903984469 1:27215714-27215736 TCACCTGGGCTGCAGTGTAGTGG - Intergenic
904075067 1:27834976-27834998 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
904159866 1:28515248-28515270 TTGCCTAGGCTGGAGTGTAATGG - Intronic
904174745 1:28619006-28619028 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
905134611 1:35788917-35788939 TCCCCTAGGCTGGAGTGTAGTGG + Intergenic
905487801 1:38317320-38317342 TTCCCTTGGCTGCTATTTTCTGG + Intergenic
905527675 1:38651375-38651397 TTGCCTAGGCTGGAGTGTAGCGG - Intergenic
905626732 1:39494388-39494410 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
905714789 1:40139621-40139643 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
906393064 1:45435772-45435794 TTGCCCAGGCTGGAGTGTACTGG + Intronic
906656250 1:47550381-47550403 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
907077236 1:51589991-51590013 TTCCCTGGGCTGGAGTGCAGGGG - Intronic
907876965 1:58499443-58499465 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
907892868 1:58651923-58651945 ATCCCTCGGCTTCAGTGTAGAGG + Intergenic
908618948 1:65953936-65953958 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
908694113 1:66817531-66817553 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
908859450 1:68466518-68466540 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
908906233 1:69014185-69014207 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
909310594 1:74142444-74142466 TTTCCTTGGTTGAAGTGGACTGG - Intronic
909462457 1:75933270-75933292 TTGCCTTGGCTGGAGTGCAATGG + Intergenic
909524749 1:76610406-76610428 TTCCCTGTTCTGCAGTGAACTGG - Intronic
909794212 1:79712872-79712894 TTCCCTTGTCTTCTGGGTACTGG + Intergenic
910571136 1:88704739-88704761 TTGCCTGGGCTGGAGTGTGCAGG - Intronic
910802852 1:91162795-91162817 TTGCCCTGTCTGCAGTGCACTGG + Intergenic
910920873 1:92345335-92345357 TTGCCTGGGCTGCAGTGCAGTGG - Intronic
910983713 1:92983663-92983685 TTCCCTAGGCTGGAGTGCAATGG - Intergenic
911470775 1:98315801-98315823 TTTCCCAGGCTGGAGTGTACTGG + Intergenic
911750814 1:101495726-101495748 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
912077509 1:105893833-105893855 TTCTATTGGCTGCATTTTACTGG + Intergenic
912227623 1:107753597-107753619 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
912377591 1:109223762-109223784 TTGCCTAGGCTGGAGTGTAATGG - Intronic
912537815 1:110388748-110388770 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
912810187 1:112788200-112788222 TTGCCTAGGCTGCAGTGTAGTGG - Intergenic
912922499 1:113882898-113882920 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
912949099 1:114108207-114108229 TCTCCTTGGCTGCAGTGCACAGG + Intronic
913385089 1:118250859-118250881 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
913955157 1:143283376-143283398 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
913982279 1:143532064-143532086 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
914222719 1:145694855-145694877 GTCCCCAGGCTGGAGTGTACTGG - Intronic
914426543 1:147583315-147583337 TTCCCCAGGCTGGAGTGTATGGG + Intronic
914429210 1:147604684-147604706 TTGCTTTGGCTGCAGAGCACTGG + Intronic
914734516 1:150402634-150402656 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
914738978 1:150447372-150447394 TTGCCTAGGCTGGAGTGTAATGG + Intronic
914786202 1:150833972-150833994 TTGCCTAGGCTGGAGTGTAATGG + Intronic
915126247 1:153667080-153667102 TTGCCCTGGCTGGAGTGTAATGG - Intronic
915428622 1:155847832-155847854 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
915435617 1:155903411-155903433 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
915566833 1:156719208-156719230 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
915567646 1:156724989-156725011 TTGCCCAGGCTGGAGTGTACTGG + Intronic
915810473 1:158903975-158903997 TTGCCTAGGCTGGAGTGTAATGG - Intergenic
915970145 1:160349205-160349227 TTCCCTTGGCTGCCCTGGTCTGG + Intronic
916501976 1:165395073-165395095 TTCAGTGGGCTGCCGTGTACTGG + Intergenic
917039616 1:170789777-170789799 TTACCTAGGCTGCAGTGCAGTGG - Intergenic
917343367 1:174003698-174003720 TCCCCTAGGCTGGAGTGTAGTGG + Intronic
917347850 1:174047154-174047176 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
917820768 1:178761598-178761620 TTGCCTGGGCTGGAGTGTAATGG + Intronic
917957877 1:180118802-180118824 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
918205670 1:182307016-182307038 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
918670029 1:187203355-187203377 TTGCCTGGGCTGGAGTGCACTGG + Intergenic
919080650 1:192861422-192861444 TTCCCCAGGCTGGAGTGTAATGG - Intergenic
919857662 1:201716836-201716858 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
919902041 1:202051059-202051081 TTCCCTGGGCTGGAGTGCAATGG + Intergenic
919906569 1:202082552-202082574 TTCCCCAGGCTGCAGTGCAGTGG + Intergenic
919911977 1:202117034-202117056 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
920025314 1:202989805-202989827 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
920027408 1:203009519-203009541 TTGCCTGGGCTGGAGTGTAGTGG + Intronic
920095324 1:203483003-203483025 TTCCCTTACCTGCTGGGTACAGG + Intronic
921086086 1:211794336-211794358 TTACCTTGGCTGGAGTGCAATGG + Intronic
921667867 1:217894542-217894564 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
921736969 1:218639964-218639986 TTCTCTGGGCTGCAGTGTTCTGG + Intergenic
921781412 1:219169791-219169813 CTCCCTTGGGTGCAGGCTACAGG - Intergenic
921868995 1:220117229-220117251 TTTCCTAGGCTGGAGTGTAGTGG + Intronic
922294954 1:224241814-224241836 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
922538019 1:226397279-226397301 TTGCCTAGGCTGGAATGTACCGG - Intronic
923309449 1:232721655-232721677 TTGCCCTGGCTGCAGTGCAGTGG - Intergenic
923373246 1:233333822-233333844 TTCCCTTAGCTGCACTATTCTGG - Intronic
923486431 1:234435942-234435964 TTCCCCTGTCAGCAGTGTGCTGG - Intronic
923596502 1:235364423-235364445 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
923724261 1:236492869-236492891 TTCCCTAGGCTGGAGTGCAATGG - Intergenic
923964797 1:239125429-239125451 TTGCCTGGGCTGGAGTGTAGTGG - Intergenic
924191130 1:241553647-241553669 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
1062805235 10:414547-414569 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
1063611643 10:7567832-7567854 TTGCCTAGGCTGCAGTGAAGTGG - Intronic
1063657466 10:8006334-8006356 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1063688065 10:8257474-8257496 TCCCCTAGGCTGCAGTGCAGTGG + Intergenic
1064072927 10:12246028-12246050 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1064218282 10:13418460-13418482 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1064549785 10:16487938-16487960 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1064631871 10:17323434-17323456 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1064906911 10:20356926-20356948 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1064910742 10:20399103-20399125 TCCCCCAGGCTGCAGTGTAGTGG - Intergenic
1065032811 10:21605042-21605064 TTGCCTAGGCTGCAGTGAAGTGG - Intronic
1065468662 10:26053783-26053805 TTGCCTTGGCTGGAGTGCAATGG - Intronic
1065584168 10:27201121-27201143 TTGCCTGGGCTGCAGTGTAGTGG - Intronic
1065845677 10:29740901-29740923 TCCCCTTGGCTGGAGTCTATTGG + Intergenic
1065893647 10:30142236-30142258 TTGCCTAGGCTGGAGTGTAGCGG + Intergenic
1066105925 10:32156906-32156928 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1066216009 10:33288324-33288346 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
1066382489 10:34913293-34913315 TCACCCTGGCTGGAGTGTACTGG - Intergenic
1066465728 10:35648382-35648404 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1066573467 10:36799449-36799471 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1068557879 10:58479276-58479298 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1068977401 10:63024743-63024765 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1068983950 10:63089887-63089909 TTGCCTAGGCTGGAGTGTAATGG - Intergenic
1069008529 10:63345446-63345468 TTCCCCAGGCTGCAGTGCAATGG - Intronic
1069219422 10:65864915-65864937 CCCCCTAGGCTGGAGTGTACTGG + Intergenic
1069508855 10:69025358-69025380 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1069536307 10:69255875-69255897 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1069677392 10:70258262-70258284 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1069730620 10:70609575-70609597 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
1069934182 10:71903979-71904001 TTCCCCAGGCTGCAGTGCAATGG + Intergenic
1070155486 10:73831818-73831840 TCCCCCTGGCTGGAGTGTAGTGG - Intronic
1070285047 10:75076767-75076789 TCTCCTAGGCTGCAGTGTAGTGG - Intergenic
1070438930 10:76423352-76423374 TTGCCTAGGCTGGAGTGTAGAGG - Intronic
1070944524 10:80378134-80378156 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1071770736 10:88726652-88726674 TTCCCTGGGCTGGAGTGCAGTGG - Intronic
1072214857 10:93279471-93279493 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1072387597 10:94947072-94947094 TTGCCTGGGCTGGAGTGTAATGG - Intronic
1072928210 10:99635636-99635658 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1072975374 10:100052838-100052860 TTGCCTGGGCTGCAGTGCAGTGG - Intronic
1073030511 10:100521754-100521776 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1073182363 10:101592349-101592371 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1073373455 10:103011726-103011748 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1073528934 10:104213573-104213595 GTCCCTAGGCTGGAGTGTAGTGG + Intronic
1073769987 10:106725509-106725531 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1073777281 10:106800559-106800581 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1074648636 10:115492681-115492703 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1074816556 10:117145895-117145917 TTCCCCAGGCTGGAGTGTAATGG - Intergenic
1075109296 10:119564963-119564985 TTGCCTAGGCTGCAGTGAAGTGG + Intergenic
1075321798 10:121497089-121497111 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1075368805 10:121917121-121917143 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1075531085 10:123230376-123230398 TTGCCTTGGCAGCTGTGTGCAGG + Intergenic
1075770571 10:124931113-124931135 TTCTCTTGGCTGTAGTGCAGTGG + Intergenic
1075772603 10:124952648-124952670 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1075868987 10:125754174-125754196 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1077512220 11:2973806-2973828 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1077978411 11:7274355-7274377 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1078132987 11:8628571-8628593 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1078152975 11:8774918-8774940 TTGCCTAGGCTGCAGTGCAATGG + Intronic
1081579461 11:44342268-44342290 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
1081849281 11:46263822-46263844 TCTCCTAGGCTGCAGTGTAGTGG - Intergenic
1081854011 11:46292664-46292686 TTGCCCTGGCTGGAGTGTAGTGG + Intronic
1081887069 11:46507135-46507157 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1081902262 11:46639025-46639047 TTGCCCTGGCTGGAGTGTAGTGG + Intronic
1081966100 11:47170904-47170926 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1082073633 11:47959742-47959764 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1082073802 11:47961083-47961105 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1082263684 11:50097255-50097277 TTCCTCTGGCTTCAGTGAACAGG + Intergenic
1083288390 11:61675743-61675765 TTAGCTTGGCTGCAGGGTATAGG - Intergenic
1083984610 11:66205022-66205044 TTGCCTAGGCTGCAGTGCAATGG + Intronic
1084515258 11:69634516-69634538 TTCCCTTAGCTGCCTTGTCCTGG - Intergenic
1084730979 11:71073504-71073526 TTACCTAGGCTGCAGTGCAGTGG + Intronic
1084989789 11:72911754-72911776 TTGCCTAGGCTGGAGTGCACTGG + Intronic
1085153991 11:74276510-74276532 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1085621685 11:78042466-78042488 TTGCCTAGGCTGCAGTGTAGCGG - Intronic
1085893747 11:80611938-80611960 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1087251589 11:95906183-95906205 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1087485532 11:98755876-98755898 TTGCCTGGGCTGGAGTGCACTGG + Intergenic
1087493498 11:98859316-98859338 TTACCTAGGCTGCAGTGCAGTGG + Intergenic
1087788626 11:102383992-102384014 TACCCTTGGGTGCAGAGAACTGG + Intergenic
1087972945 11:104508040-104508062 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1088276802 11:108096054-108096076 TTGCCTGGGCTGGAGTGTAGTGG - Intronic
1088346880 11:108836524-108836546 TTGCCTAGGCTGGAGTGCACTGG + Intronic
1088481857 11:110302006-110302028 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
1088614507 11:111611207-111611229 TTGCCTGGGCTGGAGTGCACTGG - Intronic
1088866569 11:113853253-113853275 TTGCCTTGCCTGCAGTGCAGTGG - Intronic
1089469143 11:118706877-118706899 TCCCCTAGGCTGGAGTGCACTGG + Intergenic
1089996370 11:122911863-122911885 TTGCCCTGGCTGGAGTGTAATGG - Intronic
1090058774 11:123445777-123445799 TTCCCCAGGCTGAAGTGCACTGG - Intergenic
1090067190 11:123513185-123513207 TTCCCCTAGCCGCAATGTACTGG + Intergenic
1090340947 11:126019682-126019704 TTTCATTGGCTGCAGGGTACCGG - Exonic
1090806352 11:130204772-130204794 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1090872547 11:130761107-130761129 TTCCCTTGGCTGGTGTGTCTGGG + Intergenic
1091235434 11:134019253-134019275 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1091473120 12:747711-747733 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
1092051068 12:5470584-5470606 TTCCCATGGCTGCAGGGCAGGGG + Intronic
1092119037 12:6030989-6031011 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1092324707 12:7517636-7517658 TTGCCTTGGCTGGAGTGCAATGG - Intergenic
1092343570 12:7696953-7696975 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
1092673202 12:10886360-10886382 TCTCCTTGGCAGCAGAGTACAGG + Intronic
1092676528 12:10927171-10927193 TCTCCTTGGCAGCAGAGTACAGG - Intronic
1092713016 12:11357625-11357647 TCCCCTTGGCAGGAGAGTACAGG + Intronic
1092716808 12:11397595-11397617 TCCCCTTGGCAGGAGAGTACAGG + Intronic
1092882364 12:12897646-12897668 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1093111765 12:15161093-15161115 TTGCCTAGGCTGCAGTGCAATGG - Intronic
1093591168 12:20904198-20904220 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1093814971 12:23534747-23534769 TTGCCTAGGCTGCAGTGCAATGG + Intronic
1094022095 12:25925544-25925566 TTACCTAGGCTGTAGTGCACTGG - Intergenic
1094244094 12:28268101-28268123 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1094599272 12:31894262-31894284 TTACCTAGGCTGGAGTGTAGTGG + Intergenic
1094652172 12:32389241-32389263 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
1095240316 12:39850937-39850959 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1095428614 12:42107649-42107671 TTGCCTAGTCTGGAGTGTACTGG - Intronic
1095467809 12:42506294-42506316 TTGCCTAGGCTGCAGTGCAATGG + Intronic
1095544601 12:43350641-43350663 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
1095619833 12:44238603-44238625 TTCCCTAGGCTGGAGTGTAGTGG - Intronic
1095970283 12:47897014-47897036 TTGCCTTTCCTGCAGTGTCCTGG - Intronic
1096225898 12:49866868-49866890 TTCCCTCGTCTGCCGTGTGCTGG - Intergenic
1096247012 12:49996599-49996621 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1096299922 12:50417898-50417920 TTACCCAGGCTGCAGTGTAATGG + Intronic
1096310276 12:50514702-50514724 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1096402575 12:51319348-51319370 TTACTTTGGCTCCAGAGTACTGG - Intronic
1096711300 12:53458343-53458365 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1097098914 12:56572247-56572269 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1097205122 12:57314437-57314459 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1097293198 12:57937290-57937312 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1097975887 12:65685349-65685371 TCCCCTAGGCTGGAGTGTAGTGG - Intergenic
1098086455 12:66849574-66849596 TCACCTAGGCTGCAGTGTAGTGG - Intergenic
1098192755 12:67967642-67967664 GTCCCTTGGCTGGAGTGCAGTGG - Intergenic
1098229413 12:68357838-68357860 TTGCCTAGGCTGCAGTGCAATGG + Intergenic
1098297323 12:69017218-69017240 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1098318629 12:69217683-69217705 TTGCCTAAGCTGCAGTGTAGTGG - Intergenic
1098350201 12:69551311-69551333 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1098356749 12:69619547-69619569 ATCCCTAGGCTGGAGTGTAATGG + Intergenic
1098685018 12:73409078-73409100 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
1099064553 12:77957702-77957724 TCCCCCTGGCTGGAGTGTAGTGG + Intronic
1099468839 12:83021553-83021575 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1099626463 12:85081761-85081783 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
1099940783 12:89185478-89185500 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1100134092 12:91533931-91533953 TTCCCTAGGCTGGAGTGCAATGG + Intergenic
1100322195 12:93506303-93506325 TTGCCTTGGCTGGAGTGTAGTGG + Exonic
1100355325 12:93823250-93823272 TTTCCTAGGCTGCAATGCACTGG - Intronic
1100436313 12:94574346-94574368 TTGCCTGGGCTGGAGTGTAGTGG - Intronic
1100700207 12:97139307-97139329 TTCTTTTGGATGTAGTGTACAGG - Intergenic
1100852503 12:98727899-98727921 TTGCCTAGGCTGCAGTGCAATGG - Intronic
1100984460 12:100190902-100190924 CTCCCTTGGGTGGAGTGGACAGG - Intergenic
1101923484 12:108952272-108952294 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
1102139366 12:110601910-110601932 TTGCCCTGGCTGCAGTGCAGTGG - Intergenic
1102454352 12:113062729-113062751 TTCCGCTGGCTGCACTGCACGGG - Intronic
1102510642 12:113413079-113413101 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1102993082 12:117328602-117328624 TTGCCTAGGCTGAAGTGTAGTGG + Intronic
1103237305 12:119384154-119384176 TCCCCTAGGCTGGAGTGTAGTGG - Intronic
1103356980 12:120328902-120328924 TTCCCTAGGCTGGAGTGCAATGG - Intergenic
1103519504 12:121528518-121528540 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1103534116 12:121623030-121623052 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1103856721 12:123975462-123975484 TTGCCGTGGCTGGAGTGTAGTGG + Intronic
1104469749 12:129020040-129020062 TTCCCCAGGCTGGAGTGCACTGG + Intergenic
1105071853 12:133238988-133239010 TTGCCTTGGCTGGAGTGCAGTGG + Intergenic
1105269257 13:18855503-18855525 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1105360548 13:19710875-19710897 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
1105381142 13:19888637-19888659 TTCCCCAGGCTGCAGTGTAATGG + Intergenic
1106172631 13:27301297-27301319 TCACCTAGGCTGGAGTGTACTGG + Intergenic
1106400212 13:29422701-29422723 TTGCCTGGGCTGAAGTGTAGTGG + Intronic
1106497308 13:30291993-30292015 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1106659032 13:31779163-31779185 TTACCTTGGCTGGAGTGCAGTGG + Intronic
1106669515 13:31889648-31889670 TTCCCCAGGCTGGAGTGTAGTGG + Intergenic
1107198363 13:37682788-37682810 TTTCCCAGGCTGCAGTGTAGTGG + Intronic
1107364894 13:39660222-39660244 TTGCCTGGGCTGGAGTGTAGTGG + Intronic
1107527931 13:41251917-41251939 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1107980495 13:45730101-45730123 TTACCCAGGCTGGAGTGTACTGG + Intergenic
1108232623 13:48364701-48364723 TTGCCTAGGCTGAAGTGTAGTGG - Intronic
1108482149 13:50884321-50884343 TCACCTAGGCTGGAGTGTACTGG - Intergenic
1109021769 13:57105121-57105143 TTCCCCAGGCTGGAGTGTAATGG + Intergenic
1109198014 13:59400432-59400454 TTACCTGGGCTGGAGTGTAGTGG - Intergenic
1110309944 13:74037161-74037183 TTGCCTTGGCTGGAGTGCAATGG - Intronic
1110565443 13:76953099-76953121 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1110871903 13:80462281-80462303 TTCCGTTGGCTACTGTGTTCTGG + Intergenic
1110924601 13:81135101-81135123 TTTCCCAGGCTGCAGTGTAGTGG - Intergenic
1111252432 13:85620462-85620484 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1111262140 13:85754611-85754633 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1111658995 13:91186103-91186125 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1111731851 13:92086696-92086718 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1111848925 13:93547304-93547326 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1112128818 13:96499063-96499085 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1112652224 13:101412390-101412412 TTCTCTTGGCTTCAGTGTTCTGG + Intronic
1112849088 13:103681789-103681811 TTGCCTAGGCTGCAGTGCAATGG - Intergenic
1113075193 13:106461138-106461160 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1113102026 13:106731485-106731507 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1113251691 13:108460311-108460333 TGCCTTTGGCTGCAATGTACTGG - Intergenic
1113815644 13:113168766-113168788 TTGCCTGGGCTGGAGTGTAGTGG + Intronic
1114264417 14:21064339-21064361 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1114341800 14:21753478-21753500 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
1114514291 14:23287467-23287489 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1114838920 14:26239059-26239081 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1115023849 14:28716201-28716223 TCCCCCAGGCTGCAGTGTAGTGG - Intergenic
1115701088 14:35953709-35953731 ATCCCTTGGTTGCAGTTTCCTGG + Intergenic
1115778249 14:36740053-36740075 CTCACTTGGCTGCAGTCCACAGG - Intronic
1116195010 14:41714487-41714509 TTCCCTTTGCTGTAGTGAACTGG + Intronic
1116413590 14:44653694-44653716 TTCCCTTGGCTTCATTGCTCAGG - Intergenic
1116580019 14:46628486-46628508 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1116827903 14:49689663-49689685 TTGCCTAGGCTGGAGTGTAATGG - Intergenic
1117225505 14:53654145-53654167 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1117401817 14:55365169-55365191 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1117553662 14:56862287-56862309 TTGCCTAGGCTGAAGTGCACTGG - Intergenic
1117721040 14:58629209-58629231 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1117736976 14:58777551-58777573 TTCCCATGGCTGCCGTGAACTGG + Intergenic
1117926491 14:60784890-60784912 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1118144994 14:63125314-63125336 TTACCTTGGCTGGAGTGCAGTGG - Intergenic
1118162005 14:63299901-63299923 TTGCCTTGTCTGCAGCGTAGAGG + Intergenic
1118181366 14:63496402-63496424 TTGCCTGGGCTGGAGTGTAGTGG - Intronic
1118469928 14:66066399-66066421 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
1118530596 14:66701574-66701596 TTCCCTTGGCTGCGGGGTAGGGG - Intronic
1118591087 14:67401470-67401492 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1118659162 14:67988417-67988439 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1118800199 14:69182721-69182743 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
1119112440 14:71987563-71987585 TTCCCCAGGCTGGAGTGTAATGG + Intronic
1119275391 14:73350585-73350607 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1119293356 14:73513685-73513707 TTGCCTTGGCTGGAGTGCAACGG - Intronic
1119315474 14:73690610-73690632 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1119322369 14:73739567-73739589 TCCCCTTGGTTGCACTGTAGAGG + Exonic
1119451935 14:74719253-74719275 TTGCCTGGGCTGGAGTGTAGTGG - Intronic
1119553309 14:75533386-75533408 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1119575449 14:75717152-75717174 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1119994191 14:79234421-79234443 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1120146686 14:80986524-80986546 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1120184893 14:81384285-81384307 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1120748861 14:88178869-88178891 TTGCCTAGGCTGCAGTGCAATGG - Intergenic
1121547258 14:94771276-94771298 TTCCCTGGGCCGCAGTGGCCTGG + Intergenic
1122583932 14:102791057-102791079 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
1122726838 14:103761232-103761254 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1122996354 14:105267341-105267363 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1202871988 14_GL000225v1_random:173258-173280 TTACCCAGGCTGCAGTGTAGTGG - Intergenic
1202873569 14_GL000225v1_random:188092-188114 TTCCCTGGGCTGGAGTGCAGTGG + Intergenic
1123553616 15:21404974-21404996 TTGCCTGGGCTGCAGTGCAGTGG + Intergenic
1123670345 15:22650463-22650485 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1123755251 15:23392911-23392933 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1123895126 15:24820977-24820999 TTACCTTGGCTGGAATGTAGTGG - Intergenic
1123992329 15:25693059-25693081 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1124152626 15:27195672-27195694 TTCTCTAGGCTGGAGTGTAGTGG + Intronic
1124359261 15:29023493-29023515 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1124446936 15:29743685-29743707 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1124928300 15:34093988-34094010 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1125558853 15:40610791-40610813 TTCCCCAGGCTGCAGTGCAATGG + Exonic
1125618894 15:41041478-41041500 TTCCCCAGGCTGGAGTGTAATGG + Intronic
1125634320 15:41174413-41174435 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1125635532 15:41185383-41185405 TTGCCTTGGCTGGAGTGCAATGG + Intronic
1125748844 15:42015094-42015116 CTCCCTGGGCTGCAGTGTCTGGG + Intronic
1126044375 15:44625092-44625114 TTGCCTAGGCTGCAGTGCAATGG - Intronic
1127252149 15:57250687-57250709 TTACCTGGGCTGGAGTGCACTGG - Intronic
1127431204 15:58910782-58910804 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1127438372 15:58981016-58981038 TTGCCCTGGCTGGAGTGTAGTGG + Intronic
1127804318 15:62504994-62505016 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
1128154956 15:65386248-65386270 TTCCCTTGGCTGCAGGCATCTGG + Intronic
1128165630 15:65462006-65462028 TTGCCTGGGCTGCAGTGTAGTGG + Intronic
1128169130 15:65495198-65495220 TCCCCTTGTCAGGAGTGTACTGG + Intronic
1129083184 15:73060301-73060323 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1129156283 15:73720269-73720291 TCCTCCTGGCTGCAGTGGACGGG - Intergenic
1129282404 15:74496026-74496048 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1129347264 15:74930545-74930567 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1129448179 15:75633496-75633518 TTCCCCAGGCTGGAGTGTAGTGG + Intergenic
1129565540 15:76618882-76618904 TTGCCTGGGCTGCAGTATAGTGG + Intronic
1129593499 15:76939189-76939211 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1129713640 15:77834333-77834355 TTGCCTCGGCTGGAGTGTAGTGG - Intergenic
1130024217 15:80257337-80257359 TCCCCTTGGCCACAGTTTACTGG - Intergenic
1130321116 15:82842933-82842955 TTCCCCAGGCTGGAGTGCACCGG + Intronic
1130345236 15:83038042-83038064 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1130386484 15:83416667-83416689 TTCCCCAGGCTGGAGTGTAGTGG + Intergenic
1130698541 15:86155959-86155981 TTGCCTAGGCTGGAGTGCACTGG + Intronic
1131009710 15:89006928-89006950 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1131036466 15:89225711-89225733 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1131084301 15:89563119-89563141 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1131107213 15:89743449-89743471 TTCTCTTGGCCTCAGTGTCCTGG - Exonic
1131254071 15:90850177-90850199 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
1131552231 15:93366924-93366946 TGCCCTTGGCTGCAGAGTTAGGG + Intergenic
1131745795 15:95445926-95445948 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
1131846371 15:96493896-96493918 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1131949767 15:97669372-97669394 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1132047538 15:98577395-98577417 TTACCTAGGCTGGAGTGTAATGG + Intergenic
1132736028 16:1386512-1386534 TTGCCTGGGCTGCAGTGCATTGG - Intronic
1132911255 16:2313511-2313533 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1132928809 16:2447966-2447988 GTCCCTTGGCTGCTCTGTCCTGG - Intronic
1132993021 16:2807095-2807117 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
1133244551 16:4439391-4439413 TTACCTAGGCTGGAGTGTAGTGG + Intronic
1133307260 16:4818332-4818354 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1133320271 16:4909254-4909276 GTCTCTTGGCTGCTGTGGACAGG + Intronic
1133662110 16:7928406-7928428 TTTCCTAGGCTGCAGTGCAATGG + Intergenic
1133887898 16:9848253-9848275 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1133950953 16:10392091-10392113 TTCCCCAGGCTGGAGTGAACGGG + Intronic
1134077453 16:11301868-11301890 TTCCCTGGGCTTCTGTCTACTGG - Intronic
1134180587 16:12044616-12044638 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1134204729 16:12227858-12227880 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1134225576 16:12387334-12387356 TTCCCAGGGCTGCAGTCTACTGG + Intronic
1134389442 16:13805634-13805656 TTCCCCACGCTGCAGTGCACTGG - Intergenic
1134454842 16:14387422-14387444 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1134470230 16:14518250-14518272 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1134474637 16:14562094-14562116 TTCCCCAGGCTGGAGTGTAATGG - Intronic
1134622807 16:15702428-15702450 TTACCTAGGCTGCAGTGCAGTGG + Intronic
1134667669 16:16030888-16030910 GTCCCTAGGCTGGAGTGTAGTGG + Intronic
1135317881 16:21466161-21466183 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1135370775 16:21897956-21897978 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1135419159 16:22293164-22293186 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1135441010 16:22472757-22472779 TTCCCCTGGCTGGAGTGCAGCGG + Intergenic
1135526773 16:23219194-23219216 TTCCCCGGGCTGCAGTGCAGTGG - Intergenic
1135572401 16:23558818-23558840 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1135706340 16:24678269-24678291 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1135908551 16:26538267-26538289 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
1135958501 16:26976508-26976530 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1136086133 16:27886398-27886420 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1136247331 16:28983539-28983561 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1136291992 16:29279620-29279642 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
1136314650 16:29445842-29445864 TTCCCCTGGCTGGAGTGCAGCGG - Intronic
1136328093 16:29547606-29547628 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1136414849 16:30096596-30096618 TCCCGTTGGCTCCACTGTACCGG + Intronic
1136442777 16:30287611-30287633 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1136493961 16:30630180-30630202 ATCGCTAGGCTGCAGTGTAGTGG + Intergenic
1136621903 16:31435073-31435095 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1137308793 16:47232679-47232701 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1138382673 16:56614298-56614320 TTCCCTAGGCTGGAGTGCAATGG + Intergenic
1138527445 16:57617264-57617286 TTGCCTAGGCTGCAGTGCAATGG + Intronic
1138644089 16:58410507-58410529 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1138788313 16:59872051-59872073 TTGCCCTGGCTGGAGTGTAGTGG - Intergenic
1138991787 16:62398946-62398968 TTACCTAGGCTGCAGTGCAGTGG + Intergenic
1139606217 16:68020587-68020609 TCCCCTAGGCTGGAGTGTAGTGG + Intronic
1139613865 16:68077425-68077447 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1139644514 16:68318571-68318593 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
1139889521 16:70240095-70240117 TTCCCCTGGCTGGAGTGCAGCGG - Intergenic
1139893060 16:70266559-70266581 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1140583641 16:76261071-76261093 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
1141102763 16:81210067-81210089 TTGCCTTGGCTGGAGTGCAGTGG - Intergenic
1141121812 16:81364647-81364669 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1141499456 16:84433610-84433632 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1141707131 16:85672484-85672506 TTGCCTTGCCTGCAATGCACTGG + Exonic
1141713464 16:85713758-85713780 GCCCCTTGGCTTCAGTGTCCAGG - Intronic
1142025954 16:87813739-87813761 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1142097882 16:88253575-88253597 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
1142544395 17:689335-689357 GTCCCCAGGCTGCAGTGTAGAGG + Intronic
1142628459 17:1207607-1207629 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1142784136 17:2206846-2206868 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1143229831 17:5343713-5343735 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1143232598 17:5369738-5369760 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1143600825 17:7944715-7944737 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1143909106 17:10233180-10233202 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1143985976 17:10914512-10914534 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1144147555 17:12413186-12413208 TTGCCTGGGCTGGAGTGTAATGG + Intergenic
1144266528 17:13574676-13574698 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1144855715 17:18266472-18266494 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1145001043 17:19304820-19304842 TTCCCTTGGCTGACATGCACAGG + Intronic
1145124686 17:20290552-20290574 TTGCCCTGGCTGGAGTGTAGTGG + Intronic
1145319592 17:21756689-21756711 TCCCCTAGGCTGCAGTGCAATGG - Intergenic
1145919062 17:28596626-28596648 TTCCCTAGGCTGGAGTGCAATGG - Intronic
1145932100 17:28693128-28693150 TTGCCTAGGCTGAAGTGTAGTGG - Intronic
1146046248 17:29510335-29510357 TTACCCTGGCTGCAGTGCAGTGG - Intronic
1146066140 17:29637147-29637169 TTGCCTAGGCTGCAGTGCAGCGG + Intronic
1146068084 17:29653624-29653646 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1146201926 17:30866235-30866257 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1146254774 17:31385353-31385375 TTGCCTAGGCTGCAGTGCAATGG - Intergenic
1146454168 17:32996447-32996469 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1146768107 17:35542473-35542495 TTCCCCAAGCTGCAGTGTAGTGG + Intergenic
1146772664 17:35583176-35583198 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1146816603 17:35947545-35947567 TTCCCTAGGCTGGAGTGCATTGG + Intergenic
1147059053 17:37859445-37859467 TTGCCTAGGCTGCAGTGAAGTGG + Intergenic
1147282591 17:39374499-39374521 TTGCCTTGGCTGGAGTGCACTGG - Intronic
1147687894 17:42298201-42298223 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
1147780150 17:42935135-42935157 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
1147787447 17:42989672-42989694 TTCCCCTGGCTGGAGTGCAGTGG + Intronic
1147940969 17:44047600-44047622 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1148036367 17:44664320-44664342 TTCCCCAGGCTGCAGTGCAATGG - Intronic
1148066054 17:44870976-44870998 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1148247973 17:46047945-46047967 TTCCCCAGGCTGCAGTGCATTGG + Intronic
1148272272 17:46271203-46271225 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1148835495 17:50463727-50463749 TTCCCTTTGCTGCAGTTTCATGG + Intronic
1149491925 17:57091336-57091358 TGCATGTGGCTGCAGTGTACGGG + Intronic
1149700883 17:58654544-58654566 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1149837675 17:59928116-59928138 TTGCCCAGGTTGCAGTGTACTGG - Intronic
1149904479 17:60512792-60512814 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1150051596 17:61969639-61969661 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1150072950 17:62168108-62168130 TTTCCTTTGCAGCAGTGTACTGG + Intergenic
1150095872 17:62374419-62374441 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1150144517 17:62756404-62756426 TTGCCCAGGCTGAAGTGTACTGG - Intronic
1150408499 17:64922630-64922652 TTTCCTAGGCTGCAGTGCAGTGG + Intergenic
1150424016 17:65062799-65062821 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
1150606851 17:66699169-66699191 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1150734521 17:67725016-67725038 TCCCCCAGGCTGCAGTGTACTGG - Intronic
1150813232 17:68373267-68373289 TTCCCTGGGCTGGAGTGCAATGG + Intronic
1150814157 17:68379278-68379300 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
1150911890 17:69396670-69396692 TTCCCTGGGCTGGAGTGCAGTGG + Intergenic
1150990877 17:70257695-70257717 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1151220781 17:72611344-72611366 TCCCCTTGGCTACAGTTGACGGG + Intergenic
1151290897 17:73149041-73149063 TTCCCCAGGCTGGAGTGTAGTGG - Intergenic
1151560137 17:74865640-74865662 TGCCCTTGTCTGCAGGGTTCAGG - Intronic
1151626883 17:75282211-75282233 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1151672941 17:75582250-75582272 TCGCCCAGGCTGCAGTGTACTGG + Intergenic
1151708967 17:75789374-75789396 TGCCCTTGGCTGGAGTGCAGTGG + Intronic
1151827972 17:76534214-76534236 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1151845038 17:76647765-76647787 TTCACCAGGCTGCAGTGCACTGG + Intergenic
1152135585 17:78501427-78501449 TTCCCTGGGCAGCAGGGGACCGG - Intronic
1152385230 17:79969900-79969922 TTGCCTAGGCTGCAGTGCAATGG - Intronic
1152440321 17:80304598-80304620 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1152651478 17:81495748-81495770 TTCCCCAGGCTGCAGTGCAATGG - Intergenic
1152770973 17:82169164-82169186 TTACCTAGGCTGGAGTGTAGTGG + Intronic
1152836000 17:82532182-82532204 TTGCCTAGGCTGCAGTGCAATGG + Intronic
1152836223 17:82533957-82533979 TTGCCTGGGCTGGAGTGCACCGG - Intronic
1153018721 18:607471-607493 TTGCCTGGGCTGGAGTGTAGTGG + Intronic
1153036825 18:771325-771347 TTCCCCAGGCTGTAGTGTAGTGG - Intronic
1153108176 18:1551845-1551867 TCCCCTAGGCTGCAGTGCAGTGG + Intergenic
1153194729 18:2581617-2581639 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1153480976 18:5545466-5545488 TTTCCTTGGCTGGAGTGGAAGGG + Intronic
1153796784 18:8630926-8630948 TCCCCTAGGCTGCAGTGCAGTGG + Intronic
1154235686 18:12603612-12603634 TTCCCCAGGCTGCAGTGCAGTGG + Intronic
1154418777 18:14204482-14204504 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1155145845 18:23082732-23082754 TTCCCCTGGCTGGGGTGCACTGG - Intergenic
1155240569 18:23860296-23860318 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1155618160 18:27745399-27745421 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1155632815 18:27914185-27914207 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1155663048 18:28274971-28274993 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1155968370 18:32057372-32057394 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1155969566 18:32069159-32069181 TTACCCAGGCTGGAGTGTACTGG - Exonic
1156131594 18:33982788-33982810 TTCCCCAGGCTGGAGTGTAATGG + Intronic
1156371601 18:36476369-36476391 ATCCCTTGGCTACAGGGTTCAGG + Intronic
1156427657 18:37032138-37032160 TTGCCCTGGCTGGAGTGTAGTGG - Intronic
1156957468 18:42986077-42986099 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1157127460 18:44970589-44970611 TTCCCCAGGCTGCAGTGAAATGG + Intronic
1157467971 18:47964697-47964719 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1157512587 18:48288614-48288636 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1157656559 18:49395587-49395609 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1157669511 18:49516595-49516617 TTACCCAGGCTGCAGTGTAGTGG + Intergenic
1157671048 18:49529043-49529065 TTACCCAGGCTGCAGTGCACTGG + Intergenic
1157935436 18:51866909-51866931 TTCCCTTGCCTGAAATGTAAAGG - Intergenic
1158460173 18:57639620-57639642 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
1158710834 18:59836516-59836538 TTGCCTGGGCTGGAGTGTAGTGG - Intergenic
1158770513 18:60511190-60511212 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1158935702 18:62362881-62362903 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1159171072 18:64767643-64767665 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1159200869 18:65182772-65182794 TCCCCTTGGCTGGAGTGCAGTGG + Intergenic
1159333917 18:67038800-67038822 TTGCCTAGGCTGCAGTGCAATGG + Intergenic
1159712743 18:71783444-71783466 TTCCCGAGGCTGCAGTGCATTGG + Intronic
1160707819 19:537693-537715 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1160993366 19:1870633-1870655 TTACCTGGGCTGGAGTGTAGTGG - Intergenic
1161254778 19:3301829-3301851 TTCTCTTAGCTGCTGTGTAGTGG + Intergenic
1161488527 19:4548873-4548895 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1161593336 19:5138614-5138636 TTGTCTAGGCTGCAGTGTAATGG - Intronic
1161763074 19:6188586-6188608 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1161799650 19:6410033-6410055 TTGCCTGGGCTGGAGTGTAGTGG - Intergenic
1161871815 19:6876244-6876266 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
1162018049 19:7856294-7856316 TTCCCGTGGCTGCAGGCCACTGG - Intronic
1162399610 19:10437161-10437183 TCCCCTAGGCTGCAGTGCAGTGG + Intronic
1162647927 19:12063747-12063769 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
1162689991 19:12421553-12421575 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1162692367 19:12444265-12444287 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1162766147 19:12920880-12920902 TTCCCTGGGCTGGAGTGTAGGGG - Intergenic
1162898058 19:13777283-13777305 TCCCCCAGGCTGCAGTGTAGTGG + Intronic
1162973296 19:14194170-14194192 TTGCCCAGGCTGAAGTGTACTGG - Intronic
1163163808 19:15481558-15481580 TTGCCTAGGCTGCAGTGTAGTGG + Intronic
1163242512 19:16072865-16072887 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1163275728 19:16283005-16283027 TTGCCTAGGCTGCAGTGCAATGG - Intergenic
1163280169 19:16311356-16311378 TTGCCCTGGCTGGAGTGTAGTGG - Intergenic
1163284861 19:16340064-16340086 TTGCCTAGGCTGAAGTGTAGTGG - Intergenic
1163409480 19:17144928-17144950 TTGCCTTGGCTGGAGTGCAGGGG - Intronic
1163569723 19:18073862-18073884 TTACCTAGGCTGGAGTGCACTGG + Intronic
1163902481 19:20117080-20117102 TTCCCTATGCTGAAGTGCACTGG + Intronic
1164045309 19:21533693-21533715 TTGCCCAGGCTGGAGTGTACCGG + Intronic
1164065168 19:21708796-21708818 TTGCCTTGGCTGGAGTGCAATGG + Intergenic
1164070182 19:21760453-21760475 TCCCCTAGGCTGGAGTGTAGTGG - Intronic
1164757408 19:30700425-30700447 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1164791823 19:30992662-30992684 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1164837932 19:31370034-31370056 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1164993653 19:32703386-32703408 TTCCCCAGGCTGCAGTGCAATGG + Intronic
1165202394 19:34155621-34155643 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1165207837 19:34206329-34206351 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1165222667 19:34329794-34329816 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1165248055 19:34509157-34509179 TTACCCTGGCTGGAGTGCACTGG - Exonic
1165470718 19:36002953-36002975 TTCCCTAGGCTGGAGTGCAATGG - Intergenic
1165536546 19:36451965-36451987 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1165548456 19:36562196-36562218 TCCCCTGGGCTGCAGTGCAATGG - Intronic
1165663389 19:37603045-37603067 TTGCCTAGGCTGCAGTGCAATGG + Intronic
1165734651 19:38168345-38168367 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
1166006667 19:39912852-39912874 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1166067554 19:40368883-40368905 TTGCCTGGGCTGGAGTGTAGTGG - Intronic
1167044342 19:47041010-47041032 TACCGTTGGCTGCAGCGTGCCGG + Exonic
1167069719 19:47213879-47213901 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1167474006 19:49689894-49689916 CTCACCTGGCTGCAGTGTCCAGG - Exonic
1167584603 19:50366871-50366893 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1167612722 19:50515095-50515117 TGCCCATAGCTGCCGTGTACGGG + Intergenic
925090997 2:1155997-1156019 TTCCTTTGTCTGCGGTGTCCTGG - Intronic
925646743 2:6044209-6044231 TTCCTCGGGCTGCAGTGTGCTGG - Intergenic
925968595 2:9089962-9089984 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
926242403 2:11098702-11098724 TTCCCTGGGCTGGAGTGCAGTGG + Intergenic
926625030 2:15084089-15084111 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
927024862 2:19056711-19056733 TTCCCTTGTCTGCATTATAGTGG + Intergenic
927179726 2:20436255-20436277 TTCCCTAGGCTGAAGTGCAATGG - Intergenic
927303348 2:21541333-21541355 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
927662795 2:25007050-25007072 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
927966415 2:27272531-27272553 TTGCCTAGGCTGGAGTGTAATGG + Intronic
928025124 2:27733185-27733207 TTCCCCAGGCTGGAGTGTAATGG - Intergenic
928977170 2:37100298-37100320 TTCACTGGGCTGCAGTTCACTGG - Exonic
929126870 2:38530153-38530175 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
929147150 2:38716813-38716835 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
929147491 2:38719427-38719449 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
929479497 2:42290690-42290712 TTCCCCTGGCTGCAGTGCAGTGG - Intronic
929767029 2:44853354-44853376 GTCCCTTGTCTTCAGGGTACAGG - Intergenic
930047338 2:47184384-47184406 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
930259453 2:49127930-49127952 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
930787672 2:55286417-55286439 TCACCCTGGCTGGAGTGTACTGG - Intergenic
930793843 2:55366485-55366507 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
930922539 2:56775176-56775198 GTCCCCTGGCTGGAGTGTAGTGG + Intergenic
931276944 2:60752556-60752578 TTACCCAGGCTGGAGTGTACTGG + Intergenic
931317282 2:61144602-61144624 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
931345978 2:61446754-61446776 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
931375251 2:61701407-61701429 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
931596645 2:63953169-63953191 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
931626418 2:64260244-64260266 TTGCCCCGGCTGGAGTGTACTGG + Intergenic
931662159 2:64575575-64575597 TTGCCTAGGCTGGAGTGCACTGG - Intronic
931739499 2:65228720-65228742 TTCCCTTCGTTTCAGTATACAGG + Intronic
931781368 2:65581697-65581719 TCACCTTGGCTGGAATGTACTGG - Intergenic
931844765 2:66192056-66192078 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
931994900 2:67830516-67830538 TTGCCTTGGCTGGAGTGCAATGG + Intergenic
932235998 2:70121580-70121602 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
932262764 2:70341201-70341223 TTCCCTTCGCTGCATTGGAGTGG - Intergenic
932271589 2:70414767-70414789 TTGCCTGGGCTGGAGTGTAATGG - Intergenic
932472064 2:71966102-71966124 TTCCCTGGGCTGGAGTGCTCAGG - Intergenic
932550544 2:72765245-72765267 TTGCCCTGGCTGGAGTGTACTGG - Intronic
933592491 2:84248325-84248347 TTGCCTTGGCTGGAGTGCAGTGG + Intergenic
933890738 2:86767101-86767123 GTCCCCTGGCTGGAGTGTAGTGG + Intronic
934314063 2:91899943-91899965 TTGCCTAGGCTGTAGTGTAATGG - Intergenic
935176547 2:100654161-100654183 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
935207230 2:100906628-100906650 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
935374025 2:102377350-102377372 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
935835718 2:107050965-107050987 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
936129497 2:109822617-109822639 TCACCTGGGCTGCAGTGTAGTGG + Intronic
936215200 2:110548868-110548890 TCACCTGGGCTGCAGTGTAGTGG - Intronic
936424337 2:112403441-112403463 TCACCTGGGCTGCAGTGTAGTGG - Intronic
936489114 2:112955421-112955443 TCTCCTTGGCTGCAGGGAACAGG - Intergenic
936657187 2:114501973-114501995 TCCCCTAGGCTGGAGTGTAGTGG + Intronic
936814035 2:116437123-116437145 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
936825776 2:116579358-116579380 TTGCCTAGGCTGCAGTGCAACGG + Intergenic
937110317 2:119361931-119361953 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
937372845 2:121314057-121314079 TTGCCCTGGCTGGAGTGTAATGG - Intergenic
937909143 2:127067029-127067051 TTCCCCTGGCTGGAGTGCAGTGG - Intronic
938007858 2:127802939-127802961 TTACCTAGGCTGGAGTGTAGTGG - Intronic
938008193 2:127806245-127806267 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
938174449 2:129111824-129111846 TTGCCCTGGCTGCAGTGCAGTGG - Intergenic
938410242 2:131057868-131057890 TTCCCTAGGCTGGAGTGTAGTGG + Intronic
938627312 2:133125004-133125026 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
938811080 2:134853121-134853143 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
939097703 2:137853615-137853637 CTCCCTTGGCTGCAGCATGCTGG - Intergenic
939404749 2:141742289-141742311 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
939615463 2:144357336-144357358 TTACCTAGGCTGCAGTGCAACGG + Intergenic
939694550 2:145308544-145308566 TTCCCCAGGCTGCAGTGGAGTGG + Intergenic
940198456 2:151123043-151123065 TTTCCTAGGCTGGAGTGTAGTGG - Intergenic
940224671 2:151389188-151389210 TTCCCCAGGCTGGAGTGTAGTGG + Intergenic
940328826 2:152453160-152453182 TCACCCTGGCTGGAGTGTACTGG - Intronic
940523017 2:154776039-154776061 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
940647281 2:156404812-156404834 TTCCCTAGGCTGGAGTGCAATGG - Intergenic
940790031 2:158022417-158022439 TTCCCTGGGCTGGAGTGCAGTGG - Intronic
940861588 2:158775507-158775529 TTGCCTAGGCTACAGTGTAGTGG - Intergenic
941336075 2:164245221-164245243 TCCCCTAGGCTGGAGTGCACTGG + Intergenic
941466788 2:165837686-165837708 TTTCCTAAGCTGCAGTGTTCAGG + Intergenic
941950510 2:171151059-171151081 TTGCCCTGGCTGGAGTGTAGTGG + Intronic
942033452 2:171987359-171987381 TTCCCTGGGCTGGAGTGCACTGG - Intronic
942081783 2:172406707-172406729 TTGTCTTGGCTGCAGTGCAGTGG - Intergenic
942614900 2:177781540-177781562 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
943746686 2:191469538-191469560 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
944035070 2:195284831-195284853 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
944058250 2:195545750-195545772 TTGCCTAGGCTGGAGTGTAATGG - Intergenic
944805659 2:203278232-203278254 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
944899817 2:204202875-204202897 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
945093357 2:206196946-206196968 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
945285249 2:208075580-208075602 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
945785226 2:214226170-214226192 TTCCCTTGTCTGAAGTTTGCTGG + Intronic
945955952 2:216085829-216085851 TTGCCTTGGCTGGAGTGCAATGG - Intronic
945962723 2:216152399-216152421 TTGCCTAGGCTGGAGTGTAATGG - Intronic
945972578 2:216245067-216245089 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
945997595 2:216451022-216451044 TTTCCTTGGCTGCAGCATCCAGG - Exonic
946652250 2:221906042-221906064 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
946663754 2:222028353-222028375 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
946669818 2:222090656-222090678 TTTCATTAGCTGCAGTGTAATGG + Intergenic
947105843 2:226667202-226667224 TTACCTTGGCTGAAGTGCAGTGG - Intergenic
947578868 2:231298892-231298914 TTGCCTAGGCTGGAGTGCACTGG - Intronic
947763262 2:232619348-232619370 TTCCCTAGGCTGGAGTGTGATGG + Intronic
947775082 2:232702105-232702127 TTCCCTCAGCTGGAGTGTAGTGG - Intronic
947878516 2:233484514-233484536 TTGCCTGGGCTGCAGTGCAGTGG + Intronic
948131733 2:235605876-235605898 CTCCCTTGGCTGCAGTGTGGTGG + Intronic
948230992 2:236349199-236349221 ATCCCTTGGCAGCAGTGCCCAGG - Intronic
948464736 2:238146964-238146986 TCACCTAGGCTGCAGTGTAATGG - Intronic
948643620 2:239390512-239390534 TTGCCCAGGCTGGAGTGTACTGG - Intronic
948781044 2:240322029-240322051 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1168777141 20:457282-457304 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
1168782690 20:507220-507242 TTGCCCTGGCTGCAGTGCAGTGG - Intronic
1169153402 20:3308380-3308402 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
1169420680 20:5456751-5456773 TTGCCCTGGCTGCAGTGCAGTGG + Intergenic
1169425645 20:5495276-5495298 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
1169843566 20:9965687-9965709 TTCCCCAGGCTGCAGTGAAGTGG - Intergenic
1170161849 20:13321160-13321182 TCACCTAGGCTGCAGTGTAGTGG - Intergenic
1170235058 20:14094064-14094086 TCCCTTTGGCTGCAGTGTGAAGG + Intronic
1170674258 20:18464713-18464735 TTGCCTAGGCTGGAGTGCACTGG + Intronic
1170929951 20:20760295-20760317 TTGCCAAGGCTGGAGTGTACTGG - Intergenic
1171044267 20:21795804-21795826 TCCTTTTGGCTGAAGTGTACTGG + Intergenic
1171114458 20:22512655-22512677 TTCCATTGGCTGCAGAGGCCCGG - Intergenic
1171134737 20:22686203-22686225 TTCCCTTCGCTGCAGCGCATGGG - Intergenic
1171183776 20:23110479-23110501 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1172069473 20:32245931-32245953 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1172256478 20:33522701-33522723 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1172416240 20:34770668-34770690 TTGCCTGGGCTGCAGTGCAATGG + Intronic
1172457463 20:35089264-35089286 TTGCCCAGGCTGCAGTGTAATGG + Intronic
1172548174 20:35778121-35778143 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1172565670 20:35928397-35928419 TTGCCCTGGCTGGAGTGCACTGG - Intronic
1172668706 20:36618865-36618887 TTCCCTAGGCTGTAGTGAAATGG - Intronic
1172717095 20:36972668-36972690 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
1172912369 20:38419444-38419466 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1172987071 20:39000169-39000191 ATCCCTTGCCTGCACTGTAAAGG - Intronic
1173435347 20:43027434-43027456 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1173639361 20:44589295-44589317 GTCCCCAGGCTGGAGTGTACTGG - Intronic
1173790625 20:45825652-45825674 TTGCCTAGGCTGCAGTGTAATGG + Intronic
1173800048 20:45889651-45889673 TTGCCTAGGCTGGAGTGCACTGG + Intronic
1174095581 20:48086912-48086934 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1176311229 21:5151179-5151201 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1177629761 21:23711341-23711363 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1177689084 21:24480399-24480421 TTGCCTAGGCTGGAGTATACTGG + Intergenic
1177752354 21:25300590-25300612 TTCCCTAGGCTGGAGTGCAATGG + Intergenic
1178320589 21:31602182-31602204 TCCCCTAGGCTGGAGTGTAGTGG - Intergenic
1178399625 21:32274244-32274266 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1178533403 21:33393399-33393421 TTCTCCTGGCTGCAGTGCAATGG - Intergenic
1178841896 21:36144416-36144438 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1178841916 21:36144585-36144607 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1178841935 21:36144756-36144778 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1178854350 21:36238328-36238350 TTCCTTTGGCTGCAGACCACAGG + Intronic
1179007345 21:37527491-37527513 ATCCATTGGCTGCAGTGTTGAGG + Intergenic
1179441727 21:41399603-41399625 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1179519741 21:41934387-41934409 TCGCCTAGGCTGGAGTGTACTGG - Intronic
1179845821 21:44110856-44110878 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1180154255 21:45970569-45970591 TTCCCTTGGCTGCAGGGACTGGG - Intergenic
1180628451 22:17210228-17210250 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1180872714 22:19155890-19155912 TTACCTAGGCTGGAGTGCACTGG - Intergenic
1181288328 22:21771130-21771152 TTGCCTAGGCTGGTGTGTACTGG + Intronic
1181723574 22:24795097-24795119 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1181790521 22:25262142-25262164 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1181826328 22:25519183-25519205 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1182164684 22:28161612-28161634 TTACCTTGGCTGGAGTATAGTGG - Intronic
1182581543 22:31315430-31315452 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1182589395 22:31367181-31367203 TTGCCTAGGCTGAAGTGTAGTGG + Intergenic
1182705970 22:32280576-32280598 TTCCCTATGCTGCTGTGTATAGG + Intergenic
1182880114 22:33725860-33725882 TGCCCTTGGCTGAAAAGTACTGG - Intronic
1182901609 22:33903090-33903112 TTGCCTGGGCTGCAGTGCAATGG - Intronic
1182994896 22:34802918-34802940 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1183146426 22:35996563-35996585 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1183433220 22:37778466-37778488 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1183443111 22:37834656-37834678 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1183454579 22:37915210-37915232 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1183940499 22:41292185-41292207 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1183967967 22:41454641-41454663 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1184054836 22:42038943-42038965 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1184099125 22:42332541-42332563 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1184161852 22:42701714-42701736 TTCCCCTGGCCGCAGTGGTCCGG + Intronic
1184488883 22:44797845-44797867 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1185221786 22:49632709-49632731 CTCCCTTGGCTGCCGCGTCCCGG - Intronic
949544472 3:5060805-5060827 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
950016106 3:9756260-9756282 TTGCCTAGGCTGGAGTGCACTGG - Intronic
950037271 3:9895738-9895760 TTCCCTAGGCTGAAGTGCAGTGG + Intergenic
950202815 3:11056908-11056930 ATCCCTCTGCTGCAGTGTAGAGG - Intergenic
950251537 3:11469649-11469671 TTAGCTGGGCTGCAGTGGACAGG - Intronic
950281207 3:11709395-11709417 TTCCCTGGGCTGGAGTGCAATGG - Intronic
950370271 3:12523571-12523593 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
950512121 3:13436549-13436571 TCCCCTTGGCTGGAGTGCAGTGG - Intergenic
950804969 3:15593835-15593857 TTCCCCAGGCTGCAGTGCAATGG + Intronic
951272078 3:20638454-20638476 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
951872650 3:27382157-27382179 TTGCCTAGGCTGGAGTGCACTGG + Intronic
952384166 3:32827301-32827323 TTGCCTAGGCTGGAGTGTAATGG + Intronic
952398456 3:32941405-32941427 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
953064715 3:39458280-39458302 TTCCCTAGGCTGGAGGGTAGTGG - Intergenic
953291377 3:41667112-41667134 TCACCTAGGCTGAAGTGTACTGG - Intronic
953527686 3:43707666-43707688 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
953763301 3:45711578-45711600 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
953950236 3:47183973-47183995 TTTCCTGGGCTGCAGTGCAGTGG + Intergenic
954736049 3:52707207-52707229 TTGCCCAGGCTGCAGTGCACTGG + Intronic
954885549 3:53870268-53870290 TTCCCCTGGCTGCAGTGTGGAGG - Intronic
955196429 3:56808548-56808570 TTGCCTAGGCTGGAGTGCACTGG - Intronic
955324857 3:58002085-58002107 TCCCCTAGGCTGCAGTGCAGTGG - Intergenic
955376990 3:58405736-58405758 TTCCCCAGGCTGGAGTGTACCGG - Intronic
955388464 3:58499585-58499607 TTCCCTAGGCTGGAGTGCAATGG + Intronic
955833043 3:63025286-63025308 TTCCCCAGGCTGGAGTGTAGTGG + Intergenic
956288087 3:67631585-67631607 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
956433923 3:69214820-69214842 TTCCCTTGGCTGGAGTGCAGTGG - Intronic
956506074 3:69941620-69941642 TTCCCTTGGCTGCAGTGTACTGG - Intronic
956522885 3:70124773-70124795 TTGCCTGGGCTGGAGTGCACTGG - Intergenic
957449667 3:80362835-80362857 TTTCCTAGGCTGGAGTGTAATGG + Intergenic
958646646 3:96883061-96883083 TTGCCATGGATGCAGTGAACAGG - Intronic
958869629 3:99542653-99542675 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
959928845 3:111956152-111956174 TTGCCTAGGCTGTAGTGTAGTGG - Intronic
960082817 3:113559479-113559501 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
960659029 3:120038486-120038508 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
960664713 3:120097282-120097304 TTGCCTTGGCTGGAGTGCAATGG - Intergenic
960671965 3:120162991-120163013 TTGCCTTGGCTGGAGTGCAGTGG - Intergenic
960803066 3:121558201-121558223 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
960829580 3:121832365-121832387 TTACCCTGGCTGCAGTGCAGTGG + Intronic
960893196 3:122473039-122473061 TTACCTAGGCTGAAGTGTAGTGG - Intronic
960959046 3:123056218-123056240 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
961032027 3:123614666-123614688 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
961128289 3:124441784-124441806 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
961253088 3:125522920-125522942 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
961258701 3:125581654-125581676 TCACCTAGGCTGCAGTGTAGTGG - Intronic
961351709 3:126308388-126308410 TTTCCTTGGCTGAAGAGAACTGG - Intergenic
962504389 3:136031103-136031125 TTGGCATGGCTGCAGTGAACAGG - Intronic
962542146 3:136393631-136393653 TTGCCTAGGCTGGAGTGCACTGG + Intronic
962582751 3:136812963-136812985 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
962732181 3:138293497-138293519 TTGCCTAGGCTGGAGTGCACTGG - Intronic
962961737 3:140317445-140317467 CTCCCTTAGCTGCAGTCCACTGG + Intronic
963439819 3:145324349-145324371 TTGCCTTGGCTGGAGTGTAGTGG - Intergenic
963565075 3:146919151-146919173 TTCCCCAGGCTGGAGTGTAGTGG - Intergenic
963981790 3:151546385-151546407 TTGCCTTGGCTTCAGTGCAGTGG + Intergenic
964295962 3:155233384-155233406 CTCCCTTGGCTGCAGTCCAAAGG - Intergenic
964616742 3:158674118-158674140 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
965466410 3:169035751-169035773 TTGCCTAGGCTGGAGTGTAATGG - Intergenic
965592482 3:170375611-170375633 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
965704048 3:171488127-171488149 TTCCCTCAGCTTCAGTGTTCTGG - Intergenic
966158999 3:176948566-176948588 TTCCCTAGGCTGGAGTGCAATGG + Intergenic
966415004 3:179680131-179680153 TTCCCCAGGCTGGAGTGTAATGG - Intronic
966597607 3:181738472-181738494 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
967172878 3:186837274-186837296 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
967211520 3:187174472-187174494 TTGCCTTGGCTGGAGTGCAGTGG + Intronic
967218533 3:187229890-187229912 CTCCCTTGGATGCAGTGTGTGGG - Intronic
967469777 3:189848272-189848294 TTGCCTAGGCTGGAGTGCACTGG + Intronic
967576688 3:191103001-191103023 TTCCCCAGGCTGCAGTGCAGGGG - Intergenic
967729465 3:192893993-192894015 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
967800904 3:193658203-193658225 TTGCCTTGGCTGGAGTGCAATGG - Intronic
968630443 4:1648167-1648189 TTGCCCTGGCTGGAGTGTAGTGG - Intronic
969384208 4:6832386-6832408 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
969748505 4:9092773-9092795 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
970025446 4:11619103-11619125 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
970538015 4:17049643-17049665 TTCCCCAGGCTGGAGTGTAATGG + Intergenic
970569290 4:17363909-17363931 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
970662376 4:18300207-18300229 TCACCTTGGCTGAAGTGTAGTGG - Intergenic
970848660 4:20574745-20574767 TTGCCCAGGCTGCAGTGCACTGG - Intronic
971016658 4:22495867-22495889 TCCCCCAGGCTGCAGTGTAGTGG - Intronic
971023726 4:22566689-22566711 TTGCCTAGGCTGGAGTGTATTGG - Intergenic
971205521 4:24564025-24564047 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
971216873 4:24670299-24670321 TTCCCTAGGCTGGAGTGCAGAGG - Intergenic
971361851 4:25945538-25945560 TTGCCTAGGCTGGAGTATACTGG + Intergenic
971423029 4:26491225-26491247 TTCCCCAGGCTGCAGTGGAGTGG + Intergenic
971441621 4:26693653-26693675 TTGCCTAGGCTGGAGTGTAATGG - Intronic
971795095 4:31216984-31217006 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
971957368 4:33439384-33439406 TTCCCTAGGCTGGAGTGTAGTGG + Intergenic
972056041 4:34804920-34804942 TTGCCTGGGCTGGAGTGTAGTGG - Intergenic
972481461 4:39501002-39501024 TTGCCTGGGCTGCAGTGCAGTGG + Intronic
972548753 4:40107961-40107983 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
972603535 4:40593448-40593470 TTCCCTTGGCAGGGATGTACAGG - Intronic
972716445 4:41651044-41651066 TTGCCTAGGCTGGAGTGTAATGG + Intronic
973626399 4:52776980-52777002 TTCCCTAGGCTGGAGTGCAATGG + Intergenic
973777536 4:54256987-54257009 TTGCCCAGGCTGGAGTGTACTGG - Intronic
975393426 4:73847439-73847461 TTTCCTAGAATGCAGTGTACAGG - Intronic
975588835 4:75979868-75979890 TTGCCTAGGCTGCAGTGTAGTGG + Intronic
975681543 4:76881824-76881846 TTCCCTTCTCTGCAGTCTATGGG - Intergenic
975773516 4:77757737-77757759 TTGCCTGGGCTGGAGTGCACTGG + Intronic
975990718 4:80257359-80257381 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
976016652 4:80562616-80562638 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
976473963 4:85461521-85461543 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
976645187 4:87380431-87380453 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
976689667 4:87855605-87855627 TTCCTTTGGCTAGAGTGTGCAGG - Intergenic
976789847 4:88866085-88866107 TCCCCCTGGCTGGAGTGTAATGG + Intronic
977602133 4:98944758-98944780 TTACCTGGGCTGGAGTGTAATGG + Intergenic
978443519 4:108759007-108759029 TTCCCCAGGCTGCAGTGTAATGG - Intronic
978689353 4:111487464-111487486 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
978784155 4:112590883-112590905 TTGCCTAGGCTGGAGTGTAATGG - Intronic
979030523 4:115638787-115638809 TTCCCCAGGCTGGAGTGTAGTGG - Intergenic
979086229 4:116412636-116412658 TCCCCTGGGCTGAAGTGTAGTGG + Intergenic
979320912 4:119324023-119324045 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
979873025 4:125850513-125850535 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
980346043 4:131621060-131621082 CTACCCTGGCTGGAGTGTACTGG - Intergenic
980381661 4:132028440-132028462 TTGCCTAGGCTGGAGTGTAATGG - Intergenic
980771926 4:137384921-137384943 TGCCCTTGGCTGGAGTGTAGTGG + Intergenic
980950372 4:139369842-139369864 TTTCCTAGGCTGGAGTGTAGTGG + Intronic
981038907 4:140202879-140202901 TTGCCTAGGCTGAAGTGTAGTGG + Intergenic
981982546 4:150811540-150811562 TTGCCCAGGCTGGAGTGTACTGG + Intronic
982054435 4:151533373-151533395 TTTCCTAGGCTGGAGTGTAGTGG - Intronic
982242870 4:153317918-153317940 TCACCTAGGCTGCAGTGCACAGG - Intronic
982425012 4:155247763-155247785 TTGCCTGGGCTGCAGTGCAGTGG - Intergenic
982459237 4:155647556-155647578 TTGCCCTGGCTGGAGTGTAATGG - Intergenic
982572633 4:157069418-157069440 TTGCCTTGGCTGGAGTGCAGTGG + Intergenic
982663260 4:158230209-158230231 TTCCCTTGGCTGGGGTGTGGGGG + Intronic
982782971 4:159510459-159510481 TTCCCCAGGCTGCAGTGCAATGG + Intergenic
982947560 4:161644484-161644506 TTGCCCTGGCTGCAGTGCAATGG - Intronic
984502761 4:180577126-180577148 TTCCCTTGGCATCACCGTACAGG - Intergenic
984882196 4:184419905-184419927 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
984897594 4:184555375-184555397 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
986688827 5:10297143-10297165 TTGCCTAGGCTGCAGTGCAATGG - Intronic
986695015 5:10343959-10343981 TTGCCTAGGCTGGAGTGCACTGG - Intergenic
986696585 5:10361801-10361823 TTGCCTAGGCTGCAGTGCAATGG + Intronic
986806889 5:11316263-11316285 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
987152105 5:15053079-15053101 TTCCCTTGTCTTCAGTTTTCTGG + Intergenic
987312282 5:16692378-16692400 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
987549004 5:19353618-19353640 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
987675451 5:21067568-21067590 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
989057336 5:37378260-37378282 TTGCCTTGGCTGGAGTGCAGTGG - Intergenic
989372586 5:40724591-40724613 TTCCCCAGGCTGGAGTGCACTGG - Intronic
989392167 5:40912416-40912438 TTGCCCTGGCTGGAGTGTAGTGG + Intronic
989471804 5:41828145-41828167 TTGCCTAGGCTGGAGTGCACTGG + Intronic
989585229 5:43069306-43069328 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
990467055 5:56080274-56080296 TTGCCTTGGCTGGAGTGCAATGG - Intergenic
990584971 5:57202031-57202053 TTGCCTAGGCTGGAGTGTAATGG + Intronic
990599378 5:57342157-57342179 TTGCCTAGGCTGCAGTGTGACGG + Intergenic
990857010 5:60279722-60279744 TCCCCTGGGCTGGAGTGTAATGG + Intronic
990857847 5:60290764-60290786 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
990906778 5:60812178-60812200 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
991692470 5:69238322-69238344 TTTCCCTGGCTGGAGTGTAGTGG + Intronic
992047206 5:72905855-72905877 TCCCCTAGGCTGGAGTGCACTGG - Intronic
992061022 5:73047874-73047896 TTGCCTAGGCTGGAGTGCACTGG + Intronic
992241704 5:74776461-74776483 TTCCCCAGGCTGCAGTGTGGTGG - Intronic
992601794 5:78408638-78408660 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
992668285 5:79033266-79033288 TTGCTTTGGCCTCAGTGTACTGG + Exonic
992781988 5:80136241-80136263 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
994357783 5:98813478-98813500 TTGCCTTGGCTGGAGTGCAGTGG - Intergenic
994376301 5:99018817-99018839 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
994912599 5:105931625-105931647 TTGCCCTGGCTGCAGTGCAGTGG - Intergenic
995210153 5:109528657-109528679 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
995218416 5:109621457-109621479 TTGCCTGGGCTGTAGTGTAATGG + Intergenic
995285278 5:110381435-110381457 TTCCCTTGGTGTCAGTGTTCTGG + Intronic
995709517 5:115020931-115020953 TTCCCCAGGCTGCAGGGTAGTGG - Intergenic
996053470 5:118958416-118958438 TTGCCCTGGCTGGAGTGTAGTGG - Intronic
996066187 5:119082149-119082171 TTTCCCAGGCTGCAGTGTAGTGG + Intronic
996714572 5:126576885-126576907 TTGCCCTGGCTGGAGTGTAATGG - Intronic
996715980 5:126588437-126588459 TTGCCTAGGCTGGAGTGCACTGG - Intronic
996964738 5:129294494-129294516 TTGCCTGGGCTGCAGTGCAGTGG - Intergenic
997316615 5:132941965-132941987 TTCCCCGGGCTGGAGTGCACTGG - Intronic
997499606 5:134362477-134362499 TTGCCCAGGCTGCAGTGTAATGG - Intronic
997802026 5:136873272-136873294 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
997813527 5:136994963-136994985 TTGCCCAGGCTGGAGTGTACTGG - Intronic
997946647 5:138208826-138208848 TCTCCTGGGCTGCAGTGTAGTGG + Intronic
998029797 5:138856380-138856402 TTACCTAGGCTGGAGTGTAGTGG + Intronic
998118839 5:139560235-139560257 TTGCCTAGGCTGGAGTGAACTGG + Intronic
998221273 5:140282776-140282798 TTCCCTTGGTTCCAGTGGAGGGG - Intronic
998708532 5:144793740-144793762 TTGCCTGGGCTGCAGTGCAGTGG + Intergenic
999387248 5:151162985-151163007 TTCCCTTGACTGCAGAGCCCAGG + Intergenic
999415038 5:151387639-151387661 TTCCCAGGGCTGGAGTGTAGTGG + Intergenic
999524676 5:152391732-152391754 GTCCCTTGGCAGCAGTCTACAGG - Exonic
999564824 5:152847199-152847221 TTACCCTGGCTGCAGTGCAGTGG + Intergenic
999603188 5:153289645-153289667 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
1000002644 5:157153464-157153486 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
1000083932 5:157872628-157872650 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1000311561 5:160050031-160050053 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1000578551 5:163007482-163007504 TTCCCTTGGCTTCATTGTGAGGG - Intergenic
1000594333 5:163196407-163196429 TTCCCTAGGCTGCAGCGCAGCGG - Intergenic
1000778830 5:165453896-165453918 TTCCCCAGGCTGGAGTGTAGTGG - Intergenic
1000822519 5:166001885-166001907 TTGCCCAGGCTGCAGTGTAATGG - Intergenic
1000839543 5:166200135-166200157 TTGCCCTGGCTGAAGTGTAGTGG - Intergenic
1001467704 5:171983146-171983168 TTGCCTAGGCTGGAGTGTAGCGG - Intronic
1001583317 5:172815265-172815287 TTGCCTTGGCTGGAGTGCAGTGG - Intergenic
1001605648 5:172958222-172958244 TTCCCTGGGCTGCAGTGCAGTGG - Intergenic
1001634538 5:173200225-173200247 TTGCCTAGGCTGGAGTGTAATGG - Intergenic
1002117976 5:176979561-176979583 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1002147238 5:177194297-177194319 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1002216050 5:177634032-177634054 TAGCCTTGGCTGGAGTGTAGTGG + Intergenic
1002530103 5:179839209-179839231 TTCCCCTGGCTGGAGTGTAATGG - Intronic
1002631233 5:180580387-180580409 TTGCCTGGGCTGGAGTGCACTGG - Intergenic
1002775730 6:326137-326159 TTCCCTCGGCTTCTGTGTCCTGG + Intronic
1002824538 6:761146-761168 TTCCCTAGGCTGCAGGGGGCAGG + Intergenic
1002982977 6:2160579-2160601 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1003123457 6:3336834-3336856 TTACCTAGGCTGGAGTGCACTGG + Intronic
1003503091 6:6718508-6718530 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
1003520406 6:6853781-6853803 TTGCCTTGGCTGGAGTGCAATGG - Intergenic
1003598995 6:7500886-7500908 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1003715896 6:8645838-8645860 TTACCTAGGCTGGAGTGTAGTGG + Intergenic
1004090130 6:12492987-12493009 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1004148240 6:13090092-13090114 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1004222430 6:13758378-13758400 TTGCCCAGGCTGCAGTGTACTGG + Intergenic
1004261573 6:14112274-14112296 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1004287071 6:14330847-14330869 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1004933997 6:20489928-20489950 TTCTCTTGGCTGGAGTGCAGTGG - Intronic
1005164365 6:22902732-22902754 TTCCCTGGGCTGGAGTGTGATGG + Intergenic
1005289332 6:24363459-24363481 TTACCCAGGCTGCAGTGTAACGG - Intergenic
1005300098 6:24462170-24462192 TTGCCTAGACTGGAGTGTACTGG + Intronic
1005507549 6:26482829-26482851 TTGCCCTGGCTGGAGTGTAGTGG - Intergenic
1005531283 6:26709105-26709127 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1005539513 6:26792531-26792553 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1005719127 6:28583340-28583362 TCCCCTGGGCTGCAGTGTAGTGG - Intronic
1005751964 6:28891874-28891896 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
1005814941 6:29542949-29542971 TTGCCTAGGCTGCAGTGCAATGG + Intergenic
1006029391 6:31168273-31168295 TTGCCTAGGCTGGAGTGCACTGG + Intronic
1006105930 6:31716571-31716593 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
1006116199 6:31777301-31777323 CTCCCTTGGCTGCAGTGCGGAGG + Intergenic
1006236581 6:32638635-32638657 TTGCCCTGGCTGGAGTGTAGTGG - Intronic
1006553795 6:34848242-34848264 TTGCCTGGGCTGGAGTGCACTGG - Intronic
1006593447 6:35175215-35175237 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1006805769 6:36788068-36788090 TTCCCCAGGCTTCAGTGCACTGG + Intronic
1006817153 6:36859383-36859405 TTGCCTGGGCTGCAGTGCAGTGG - Intronic
1007011556 6:38423223-38423245 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1007382225 6:41497939-41497961 TTCTCTGGGCTGTAGTGTGCTGG - Intergenic
1007565504 6:42847208-42847230 TTGCCCTGGCTGTAGTGTAGTGG - Intronic
1007766589 6:44164130-44164152 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1008235152 6:49037523-49037545 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
1008621906 6:53279020-53279042 TCCCCTTGGCTACTGTGTAGCGG - Intronic
1008755166 6:54786749-54786771 TTGCCTAGGCTGCAGTGCAATGG + Intergenic
1009010338 6:57834704-57834726 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1009416758 6:63423998-63424020 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1009965468 6:70573713-70573735 TTGCCCTGGCTGGAGTGTAGTGG + Intronic
1009970476 6:70620267-70620289 TTGCCTAGGCTGCAGTGCAATGG + Intergenic
1010349819 6:74860091-74860113 TTGCCCTGGCTGGAGTGCACTGG + Intergenic
1010444182 6:75932738-75932760 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1010572326 6:77492259-77492281 TTGCCTGGGCTGGAGTGTAGTGG - Intergenic
1010757502 6:79683496-79683518 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1010832188 6:80544208-80544230 TTCCACTGACTGTAGTGTACAGG - Intergenic
1010928275 6:81769942-81769964 TTGCCCAGGCAGCAGTGTACAGG - Intergenic
1011523029 6:88230787-88230809 TTACCCAGGCTGGAGTGTACTGG - Intergenic
1011586169 6:88927620-88927642 TTCCCCTGGCTGGAGTGCAATGG - Intronic
1012944973 6:105455570-105455592 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1013515767 6:110884471-110884493 TTACCCTGGCTGGAGTGTAGCGG + Intronic
1013557614 6:111272549-111272571 TTGCCCAGGCTGCAGTGTAATGG + Intergenic
1013561998 6:111314889-111314911 TTCCCCAGGCTGGAGTGCACCGG + Intronic
1013629723 6:111974907-111974929 TTGCCTAAGCTGCAGTGTAATGG + Intergenic
1013812426 6:114060051-114060073 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1014208251 6:118680251-118680273 TTCCCCAGGCTGGAGTGTAGTGG - Intronic
1014443287 6:121497785-121497807 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1014778842 6:125540504-125540526 TCACCTTGGCTGGAGTGTAGTGG + Intergenic
1014936680 6:127394030-127394052 TTGCCTAGGCTGGAGTGTAGAGG + Intergenic
1015032310 6:128609599-128609621 TTACCTGGGCTGCAGTGCAGTGG - Intergenic
1015508423 6:134012933-134012955 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1015680791 6:135806174-135806196 TCACCTAGGCTGCAGTGTAGTGG + Intergenic
1015727832 6:136317595-136317617 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1015948084 6:138523347-138523369 TCACCTAGGCTGCAGTGTAGTGG + Intronic
1016225727 6:141734076-141734098 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1016469001 6:144355245-144355267 TCACCTTGGCTGGAGTGTAGTGG + Intronic
1016851321 6:148622185-148622207 TTGCCTAGGCTGCAGTGCAATGG + Intergenic
1017026452 6:150185546-150185568 TACCCTTGGCTGCTGGGTGCAGG + Intronic
1017455964 6:154601635-154601657 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1017506344 6:155072247-155072269 TTCCCCTGGCTGCTGTGTGGAGG + Intronic
1017531417 6:155296127-155296149 TTCCCATGGCAGAAGTGTTCTGG - Intronic
1018010784 6:159667877-159667899 TTGCCTGGGCTGGAGTGTAATGG - Intergenic
1018154374 6:160972044-160972066 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1018161972 6:161053629-161053651 TTTCCTAGGCTGGAGTGTAATGG + Intronic
1018197110 6:161364889-161364911 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1019470344 7:1216679-1216701 TTGCCTCGGCTGGAGTGTAATGG + Intergenic
1019561172 7:1658526-1658548 TTCCCCTGGCTGGAGTGCAGTGG - Intergenic
1019740760 7:2671790-2671812 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1019747137 7:2707235-2707257 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1019804109 7:3110171-3110193 TCCCCTAGGCTGGAGTGTAGTGG - Intergenic
1019809703 7:3156280-3156302 TTCCCCTGGCTGGAGTGCAGTGG - Intronic
1019925540 7:4189748-4189770 TTGCCATGGCTGCAGTGCAGTGG - Intronic
1019992307 7:4700775-4700797 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1020027841 7:4911686-4911708 TGCCCCAGGCTGCAGTGTAGTGG + Intronic
1020186349 7:5962233-5962255 TTCCCCAGGCTGGAGTGTAATGG + Intronic
1020226468 7:6284172-6284194 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1020250537 7:6464773-6464795 TTCCCTAGGCTGGAGTGCAATGG + Intronic
1020296565 7:6762541-6762563 TTCCCCAGGCTGGAGTGTAATGG - Intronic
1020807377 7:12807457-12807479 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1021133206 7:16935874-16935896 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1021157977 7:17235520-17235542 TTGCCTTGGCTGGAGTGCAGTGG - Intergenic
1021527610 7:21606281-21606303 TCCCCTAGGCTGGAGTGCACTGG - Intronic
1021684512 7:23170172-23170194 TTGCCCTGGCTGCAGTGCAATGG - Intronic
1021708302 7:23389934-23389956 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1022683897 7:32576744-32576766 TTACCCAGGCTGCAGTGTAATGG - Intronic
1022718389 7:32919984-32920006 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1022742250 7:33134088-33134110 TTCCCTAGGCTGGAGTGCAATGG + Intronic
1023079978 7:36517638-36517660 TTACCTAGGCTGGAGTGTAGTGG + Intronic
1023115162 7:36855307-36855329 TTCCCATGGCTGCAGTCCACTGG - Exonic
1023484818 7:40675098-40675120 TTGCCTGGGCTGGAGTGTAGTGG + Intronic
1023907935 7:44535322-44535344 TTGCCCAGGCTGCAGTGTAACGG - Intronic
1023917652 7:44602135-44602157 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1024388898 7:48784688-48784710 TTGCCTAGGCTGGAGTGTGCTGG + Intergenic
1024572671 7:50736742-50736764 TTGCCCTGGCTGGAGTGTAGTGG - Intronic
1025068991 7:55882762-55882784 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1025112825 7:56234009-56234031 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
1025747943 7:64261896-64261918 TTGCCTAGGCTGCAGTGCAATGG + Intronic
1025777694 7:64573634-64573656 TTACCTGGGCTGGAGTGTAGTGG + Intergenic
1025793032 7:64710086-64710108 TTGCTTTGGCTGGAGTGTAGTGG - Exonic
1025862784 7:65347819-65347841 TTCCCTAGGCTGGAGTGTAATGG + Intergenic
1025980341 7:66400076-66400098 TTCCTCTGGCTTCAGTGAACAGG + Intronic
1025998098 7:66541257-66541279 TGTCCTTGGCTGCAGTGTCTAGG + Intergenic
1026012206 7:66645333-66645355 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1026014782 7:66664562-66664584 TTGCCCGGGCTGCAGTGTAGTGG - Intronic
1026252892 7:68686041-68686063 TTGCCCTGGCTGGAGTGTAATGG - Intergenic
1026482946 7:70794659-70794681 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1026495324 7:70896901-70896923 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1026576057 7:71572460-71572482 TTGCCTGGGCTGGAGTGTAATGG - Intronic
1026687421 7:72523472-72523494 TTCCCCAGGCTGGAGTGTAGTGG + Intergenic
1026810338 7:73458634-73458656 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1026852957 7:73736277-73736299 TTGCCTAGGCTGGAGTGTAGTGG + Exonic
1026965582 7:74437421-74437443 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1027134743 7:75616307-75616329 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1027205225 7:76092448-76092470 TTCCTCTGGCTTCAGTGAACAGG + Intergenic
1027216337 7:76186253-76186275 TTGCCTGGGCTGCAGTGCAGTGG + Intergenic
1027345170 7:77252107-77252129 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1027518317 7:79170186-79170208 TTCCCTAGTCTGGAGTGTAGTGG + Intronic
1028332812 7:89617204-89617226 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1028850885 7:95536127-95536149 TTGCCATGGTGGCAGTGTACTGG + Intronic
1029185713 7:98736989-98737011 TTACCTAGGCTGGAGTGTAGTGG - Intergenic
1029292872 7:99516025-99516047 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1029472077 7:100760934-100760956 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1030034857 7:105400386-105400408 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1030126929 7:106162768-106162790 TTGCCTGGGCTGGAGTGTGCTGG + Intergenic
1030409199 7:109153724-109153746 TTGCCTAGGCTGCAGTGCAATGG - Intergenic
1030729563 7:112970136-112970158 TTGCCTTGGCTGGAGTGCAGTGG + Intergenic
1030953323 7:115819938-115819960 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1032226127 7:130033070-130033092 TTTCCTTTGCTGCAGTGCAGTGG + Intronic
1032685124 7:134225010-134225032 TTGCCTTGGCTGGAGTGCAGTGG - Intronic
1032814250 7:135455232-135455254 TTCCCGAGGCTGGAGTGCACTGG - Intronic
1033132726 7:138759097-138759119 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1033208378 7:139441731-139441753 TTGCCTGGGCTGCAGTGCAATGG - Intergenic
1033263941 7:139868521-139868543 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1033368459 7:140689005-140689027 TTCCCTGGGCTGGAGTGCAGTGG + Intronic
1033633672 7:143187301-143187323 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1034153698 7:148937117-148937139 TTGCCCAGGCTGCAGTGCACTGG - Intergenic
1034389378 7:150772346-150772368 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1035032894 7:155873772-155873794 TTGCCTTGGCTGGAGTGCAGTGG + Intergenic
1035196334 7:157223878-157223900 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1035402872 7:158578800-158578822 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1035709198 8:1699572-1699594 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1036056451 8:5260117-5260139 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1036193667 8:6694871-6694893 TCACCTTGGCTGGAGTGTAGTGG - Intergenic
1036371574 8:8167067-8167089 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1036437297 8:8746264-8746286 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1036448977 8:8848440-8848462 TTCCTTTGCCTGCAGTGGAGAGG - Intronic
1036534834 8:9638006-9638028 TTGCCCAGGCTGGAGTGTACCGG + Intronic
1036627693 8:10485052-10485074 TTCCCATGGCAGCTGTGTGCAGG + Intergenic
1036758944 8:11493657-11493679 GTCCTTTGACTGCTGTGTACAGG + Intergenic
1036805051 8:11825498-11825520 TCCCCTGGGCTGGAGTGCACTGG - Intronic
1036879329 8:12498577-12498599 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1037326317 8:17694626-17694648 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1037539188 8:19855343-19855365 GTCCCTTGGCTACAGTCTAATGG - Intergenic
1037593154 8:20330386-20330408 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1037809014 8:22075145-22075167 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1037954800 8:23047315-23047337 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1038553787 8:28492247-28492269 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1038692251 8:29774087-29774109 TTCCCTTGGTCTCAGTGTTCAGG + Intergenic
1038819037 8:30935326-30935348 TCACCTAGGCTGGAGTGTACTGG - Intergenic
1038957681 8:32485152-32485174 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1039113730 8:34068925-34068947 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1039119619 8:34130991-34131013 TTGCCTGGGCTGGAGTGTAGTGG + Intergenic
1039161912 8:34631349-34631371 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
1039169208 8:34723285-34723307 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1039354687 8:36802067-36802089 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1039431954 8:37531808-37531830 TTCCCTGGGCTTCAGTTTTCCGG - Intergenic
1039439536 8:37585105-37585127 CTCCCTGGGCTGGAGTGTAGTGG - Intergenic
1039518107 8:38149797-38149819 TTGCCTAGGCTGGAGTGCACTGG - Intronic
1039892225 8:41693475-41693497 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1040006107 8:42622297-42622319 TTGCCCAGGCTGCAGTGCACTGG + Intergenic
1040371343 8:46778854-46778876 GTCCCTTGTCAGCAGTGTCCAGG - Intergenic
1040668868 8:49662608-49662630 TTGCCCTGGCTGGAGTGTACTGG + Intergenic
1040789906 8:51216204-51216226 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1040860295 8:51991711-51991733 TCCCCCAGGCTGCAGTGTAATGG - Intergenic
1040884913 8:52250985-52251007 TTTCATTGGCTGGATTGTACAGG - Intronic
1041094044 8:54331700-54331722 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1041288546 8:56285160-56285182 TTTCCTAGGCTGCAGTGCAGTGG - Intergenic
1041521124 8:58757366-58757388 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1041733731 8:61088448-61088470 TTACCTTGGCTGGAGTGCAGTGG - Intronic
1042254603 8:66790036-66790058 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1042462160 8:69082214-69082236 TTCCCCAGGCTGGAGTGCACTGG + Intergenic
1042570085 8:70154450-70154472 TTGCCTAGGCTGGAGTGCACTGG + Intronic
1043368900 8:79568081-79568103 TTCACTTGGCTGCACTCTTCTGG - Intergenic
1043402801 8:79900344-79900366 TTACCTGGGCTGCAGTGCAGTGG - Intergenic
1043454675 8:80401495-80401517 TTGCCTGGGCTGGAGTGTAATGG - Intergenic
1043468520 8:80538456-80538478 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
1043605944 8:82000140-82000162 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1043885872 8:85600141-85600163 TTGCCCTGGCTGGAGTGTAGTGG + Intergenic
1043980106 8:86628204-86628226 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1044012416 8:87010703-87010725 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1044567502 8:93680649-93680671 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1044585271 8:93863919-93863941 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
1045022579 8:98056958-98056980 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1045026769 8:98094917-98094939 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1045058140 8:98386916-98386938 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1045250009 8:100475277-100475299 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
1045555636 8:103212406-103212428 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1045775592 8:105798408-105798430 TTACCTAGGCTGCAGTGCAGTGG - Intronic
1046229244 8:111331990-111332012 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1046745559 8:117872097-117872119 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1046754856 8:117962711-117962733 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1046872887 8:119222786-119222808 TCTCCTTGGCTGGAGTGCACTGG - Intronic
1047155113 8:122308114-122308136 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1047231253 8:123000237-123000259 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1047525178 8:125626855-125626877 TTCCCTAGGCTGGAGTGCAGTGG - Intergenic
1048482581 8:134813451-134813473 TTGCCTAGGCTGCAGTGCAATGG + Intergenic
1048580682 8:135727952-135727974 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1048741512 8:137566014-137566036 TTCCCTAGGCTGGAGTGCAGTGG + Intergenic
1049175072 8:141187292-141187314 TGCCCGTGGCTGGAGTGTAGTGG + Intronic
1049824311 8:144658312-144658334 TTGCCCTGGCTGCAGTGCAATGG + Intergenic
1049973663 9:842272-842294 TTGCCCAGGCTGCAGTGTAGTGG + Intronic
1050359683 9:4817958-4817980 TTGCCTGGGCTGGAGTGTAGTGG + Intronic
1050852803 9:10309390-10309412 TTGCCTAGGCTGAAGTGTAATGG + Intronic
1050878802 9:10674520-10674542 TTCCGGTGGCTGCAGTGTGTTGG + Intergenic
1050878877 9:10674966-10674988 TTCTGGTGGCTGCAGTGTATTGG - Intergenic
1051435908 9:17031386-17031408 TTCCCTTCCCTCCACTGTACGGG - Intergenic
1051597399 9:18838834-18838856 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1051796003 9:20871162-20871184 TTGCCTGGGCTGGAGTGTAGTGG - Intronic
1051800440 9:20926741-20926763 TTGCCTAGGCTGCAGTGCAATGG - Intronic
1051814552 9:21090070-21090092 TTGCCTAGGCTGGAGTGCACTGG + Intergenic
1051858745 9:21600124-21600146 TTGCCTAGGCTGCAGTGCAATGG - Intergenic
1052826287 9:33178027-33178049 TTACCCAGGCTGGAGTGTACTGG + Intergenic
1052939234 9:34118923-34118945 TTGCCCAGGCTGCAGTGCACTGG - Intronic
1053235831 9:36453251-36453273 TTGCCCTGGCTGGAGTGCACTGG + Intronic
1053265063 9:36706479-36706501 TTCACTTGGCTGGAGTGCAATGG - Intergenic
1053337205 9:37286607-37286629 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1053406573 9:37881601-37881623 TTGCCTGGGCTGGAGTGTAGTGG - Intronic
1053488610 9:38482419-38482441 TTCCTTAGGCTGGAGTGTAGTGG + Intergenic
1053909055 9:42877067-42877089 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1054139681 9:61466255-61466277 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1054297763 9:63345924-63345946 TTGCCTGGGCTGGAGTGCACTGG + Intergenic
1054859528 9:69934454-69934476 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1055308449 9:74953396-74953418 TTGCCCAGGCTGCAGTGTAGTGG - Intergenic
1055440236 9:76329791-76329813 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1056002166 9:82228487-82228509 TTCCCTTGGCTGGGGGGTAGGGG + Intergenic
1056264263 9:84880337-84880359 TTCCCTTGGCCTCCTTGTACAGG - Intronic
1056355582 9:85798405-85798427 TTTCCTAGGCTGGAGTGTAGTGG + Intergenic
1056369314 9:85938528-85938550 TTCACTTGGCTGCCGTGTTCTGG + Intergenic
1056412586 9:86345913-86345935 TTGCCCTGGCTGGAGTGAACTGG + Intronic
1056628619 9:88274585-88274607 TTTCCTTGGCTGGAGTATAAGGG - Intergenic
1056636387 9:88334594-88334616 TTGCCTAGGCTGGAGTGTAGTGG - Intergenic
1056642982 9:88387030-88387052 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1056863638 9:90210431-90210453 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1057132555 9:92664357-92664379 TGCTCTTGCCTGCAGAGTACTGG - Intronic
1057373891 9:94500692-94500714 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1057668966 9:97071700-97071722 TTCCTTAGGCTGGAGTGTAGTGG + Intergenic
1058000696 9:99862052-99862074 TTGCCTGGGCTGCAGTGCAGTGG - Intronic
1058467084 9:105240030-105240052 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1058854643 9:109049251-109049273 TTGCCTAGGCTGCAGTGCAGTGG + Intronic
1058860840 9:109116569-109116591 TCACCTAGGCTGGAGTGTACTGG + Intronic
1058958512 9:109971051-109971073 TTGCCCAGGCTGCAGTGTAGTGG - Intronic
1059642777 9:116233995-116234017 TTGCCTAGGCTGCAGTGGAATGG - Intronic
1059768530 9:117406308-117406330 TTCCCTACGCTGCTCTGTACAGG - Intronic
1060357600 9:122924829-122924851 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1060403066 9:123359486-123359508 TTGCCCTGGCTGCAGTGCAGTGG + Intronic
1060440465 9:123633734-123633756 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1060842411 9:126804283-126804305 TTCCGTGGGCTGCATTGTGCTGG - Intergenic
1061233676 9:129329527-129329549 TTCCCTGGGCTGGAGTGCAGTGG - Intergenic
1061692314 9:132343277-132343299 TTGCCTAGGCTGGAGTGTAATGG - Intronic
1062004896 9:134234153-134234175 TTCCCTGGGCTGCAGCCTCCAGG + Intergenic
1203730888 Un_GL000216v2:88445-88467 TTCCCTGGGCTGGAGTGCAGTGG - Intergenic
1203732459 Un_GL000216v2:103342-103364 TTACCCAGGCTGCAGTGTAGTGG + Intergenic
1185445404 X:255275-255297 TTGCCTGGGCTGCAGTGCAGTGG + Intergenic
1185871273 X:3666866-3666888 TTGCCCAGGCTGCAGTGTACTGG - Intronic
1186208937 X:7229916-7229938 TTGCCCAGGCTGCAGTGCACTGG + Intronic
1186314459 X:8354228-8354250 TTCCCCTGGCTGGAGTTTAGTGG + Intergenic
1186452415 X:9684550-9684572 TTGCCCAGGCTGGAGTGTACTGG - Intronic
1186669111 X:11751419-11751441 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1186753429 X:12645393-12645415 TTGCCTAGGCTGGAGTGTAATGG + Intronic
1186802315 X:13105650-13105672 TTACCTAGGCTGGAGTGTAGTGG + Intergenic
1186837625 X:13453161-13453183 TTCCCCAGGCTGCAGTGCAGTGG - Intergenic
1186889083 X:13942536-13942558 TTGCCTGGGCTGGAGTGTAATGG + Intergenic
1187152644 X:16694954-16694976 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1187356423 X:18576923-18576945 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1187530862 X:20095497-20095519 TTCCCCAGGCTGAAGTGAACTGG - Intronic
1187834040 X:23412566-23412588 TTCCCGAGGCTGGAGTGTAGCGG - Intergenic
1188344242 X:29044388-29044410 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1188669208 X:32862774-32862796 TCACCTTGGCTGGAGTGTAGTGG + Intronic
1188892136 X:35624820-35624842 TTGCCTAGGCTGCAGTGCAATGG + Intergenic
1189013061 X:37065940-37065962 TTGCCTAGGCTGCAGTGCAATGG - Intergenic
1189506692 X:41618337-41618359 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1189790237 X:44597003-44597025 TTGCCCAGGCTGGAGTGTACTGG + Intergenic
1189941434 X:46126948-46126970 TTGCCTTGGCTGGAGTGCAATGG + Intergenic
1190004884 X:46726212-46726234 TTACCCAGGCTGCAGTGCACTGG - Intronic
1190067312 X:47250312-47250334 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1190256652 X:48768003-48768025 TTGCCTAGGCTGGAGTATACTGG + Intronic
1190274030 X:48888792-48888814 TTCCCTGGGCTGGAGTGCAGTGG - Intergenic
1190369722 X:49729079-49729101 TTGCCTAGGCTGCAGTGCAGTGG + Intergenic
1190700297 X:52983211-52983233 TTGCCTAGGCTGCAGTGCAGTGG - Intronic
1190765865 X:53475307-53475329 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1190841554 X:54149597-54149619 TTGCCTTGGCTGGAGTGCAATGG - Intronic
1191860921 X:65666364-65666386 TTGCCCTGGCTGGAGTGCACTGG + Intronic
1191873911 X:65774872-65774894 TTGCCTAGGCTGCAGTGCAGGGG + Intergenic
1191887779 X:65906545-65906567 TTCCCTAGGCTGGAGTGCAATGG - Intergenic
1192787736 X:74351432-74351454 TTGCCTAGGCTGCAGTGCAGTGG - Intergenic
1192892958 X:75409446-75409468 TTGCCTGGGCTGGAGTGTAGTGG - Intronic
1193377081 X:80774304-80774326 TCACCCAGGCTGCAGTGTACTGG + Intronic
1193847968 X:86497952-86497974 TTCCCTAGGCTGGAGTGCAGTGG - Intronic
1194239706 X:91429679-91429701 TTGCCTAGGCTGGAGTGTAGTGG + Intergenic
1194739183 X:97551551-97551573 TTGCCCTGGCTGGAGTGTAATGG - Intronic
1195054550 X:101131027-101131049 TTGCCCAGGCTGGAGTGTACTGG + Intronic
1195930512 X:110070274-110070296 TTCCCCAGGCTGCAGTGCAGTGG - Intronic
1196089314 X:111722992-111723014 TTGCCTAGGCTGGAGTGTAGTGG + Intronic
1196189909 X:112783253-112783275 TTGCCTAGGCTGGAGTGTAGTGG - Intronic
1196781047 X:119384567-119384589 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1196855925 X:119984144-119984166 TTGCCCAGGCTGGAGTGTACTGG - Intergenic
1196882408 X:120210324-120210346 TTGCCCTGGCTGGAGTGTAGTGG - Intergenic
1197197920 X:123721744-123721766 TCGCCTAGGCTGCAGTGTAGTGG - Intronic
1197533136 X:127655296-127655318 TTGCCTTGGCTGGAGTGCAATGG - Intergenic
1197654065 X:129097380-129097402 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1198054190 X:132977575-132977597 TTGCCCAGGCTGCAGTGTAGTGG + Intergenic
1198075274 X:133187990-133188012 TTCCCTTGGCTGCAAAGGCCTGG + Intergenic
1198380699 X:136080521-136080543 TCACCTTGGCTGCAGTGCAATGG - Intergenic
1198381169 X:136084811-136084833 TTGCCTTGGCTGGAGTGCAGTGG + Intergenic
1198757633 X:139997586-139997608 TTGCCTAGGCTGGAGTGTAATGG + Intergenic
1199981938 X:152925892-152925914 TTCCCTTAGCTACAGTGCAAAGG + Intronic
1200139164 X:153889710-153889732 TTCCCTAGGCTGGAGTGCAGTGG + Intronic
1200412073 Y:2870759-2870781 TTCCCCAGGCTGGAGTGTAGTGG + Intronic
1201281467 Y:12346432-12346454 TTCCTCAGGCTGCAGTGCACTGG + Intergenic
1201296081 Y:12464287-12464309 TTGCCTAGGCTGGAGTGTAATGG - Intergenic
1201341324 Y:12937447-12937469 TTACCCAGGCTGCAGTGCACTGG + Intergenic
1201754650 Y:17473823-17473845 TTCCCATGGCTGGAGTGCAATGG + Intergenic
1201846902 Y:18432162-18432184 TTCCCATGGCTGGAGTGCAATGG - Intergenic
1202068332 Y:20963385-20963407 TTCCCTTGACTGCAGGGCTCAGG + Intergenic
1202164470 Y:21971656-21971678 TTGCCTAGGCTGTAGTGCACTGG - Intergenic
1202226886 Y:22614716-22614738 TTGCCTAGGCTGTAGTGCACTGG + Intergenic
1202316236 Y:23580938-23580960 TTGCCTAGGCTGTAGTGCACTGG - Intergenic
1202554528 Y:26089128-26089150 TTGCCTAGGCTGTAGTGCACTGG + Intergenic