ID: 956517076

View in Genome Browser
Species Human (GRCh38)
Location 3:70061331-70061353
Sequence CTAAGCCAGAGGTCCTAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956517074_956517076 -4 Left 956517074 3:70061312-70061334 CCATGCTAACATCTTTGTTCTAA No data
Right 956517076 3:70061331-70061353 CTAAGCCAGAGGTCCTAAATTGG No data
956517072_956517076 15 Left 956517072 3:70061293-70061315 CCATGACCAAGTCTAGGGACCAT No data
Right 956517076 3:70061331-70061353 CTAAGCCAGAGGTCCTAAATTGG No data
956517073_956517076 9 Left 956517073 3:70061299-70061321 CCAAGTCTAGGGACCATGCTAAC No data
Right 956517076 3:70061331-70061353 CTAAGCCAGAGGTCCTAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956517076 Original CRISPR CTAAGCCAGAGGTCCTAAAT TGG Intergenic
No off target data available for this crispr