ID: 956527320

View in Genome Browser
Species Human (GRCh38)
Location 3:70179264-70179286
Sequence CTCAAAAAGAAGGGGAACCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956527320_956527324 -7 Left 956527320 3:70179264-70179286 CCTTGGTTCCCCTTCTTTTTGAG No data
Right 956527324 3:70179280-70179302 TTTTGAGAAGTGAAAGTTTTAGG No data
956527320_956527326 18 Left 956527320 3:70179264-70179286 CCTTGGTTCCCCTTCTTTTTGAG No data
Right 956527326 3:70179305-70179327 CTTCTACATTTCTTGGAGCATGG No data
956527320_956527325 11 Left 956527320 3:70179264-70179286 CCTTGGTTCCCCTTCTTTTTGAG No data
Right 956527325 3:70179298-70179320 TTAGGCACTTCTACATTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956527320 Original CRISPR CTCAAAAAGAAGGGGAACCA AGG (reversed) Intergenic
No off target data available for this crispr