ID: 956528781

View in Genome Browser
Species Human (GRCh38)
Location 3:70193524-70193546
Sequence GCCCCTATGTTGATTATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956528778_956528781 -6 Left 956528778 3:70193507-70193529 CCAGGCTACCAAGTCCAGCCCCT No data
Right 956528781 3:70193524-70193546 GCCCCTATGTTGATTATCACTGG No data
956528777_956528781 -5 Left 956528777 3:70193506-70193528 CCCAGGCTACCAAGTCCAGCCCC No data
Right 956528781 3:70193524-70193546 GCCCCTATGTTGATTATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956528781 Original CRISPR GCCCCTATGTTGATTATCAC TGG Intergenic
No off target data available for this crispr