ID: 956529676

View in Genome Browser
Species Human (GRCh38)
Location 3:70203884-70203906
Sequence CAGAAACAGAAGTGGGGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956529672_956529676 8 Left 956529672 3:70203853-70203875 CCACAGAGAAGCTTTCACAATCA No data
Right 956529676 3:70203884-70203906 CAGAAACAGAAGTGGGGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956529676 Original CRISPR CAGAAACAGAAGTGGGGACA TGG Intergenic
No off target data available for this crispr