ID: 956529704

View in Genome Browser
Species Human (GRCh38)
Location 3:70204305-70204327
Sequence GGATGCAGAAATTGAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956529704_956529707 18 Left 956529704 3:70204305-70204327 CCCAGCTCTCAATTTCTGCATCC No data
Right 956529707 3:70204346-70204368 CTATCGAAAATTCTCTAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956529704 Original CRISPR GGATGCAGAAATTGAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr