ID: 956530817

View in Genome Browser
Species Human (GRCh38)
Location 3:70216664-70216686
Sequence TTCAATAAGCTTTAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956530817_956530819 -10 Left 956530817 3:70216664-70216686 CCTTCATCCTAAAGCTTATTGAA No data
Right 956530819 3:70216677-70216699 GCTTATTGAAAAACATACTCAGG No data
956530817_956530820 15 Left 956530817 3:70216664-70216686 CCTTCATCCTAAAGCTTATTGAA No data
Right 956530820 3:70216702-70216724 TCTGCTCAAATGTCACCTCCTGG 0: 3
1: 6
2: 19
3: 69
4: 294
956530817_956530823 25 Left 956530817 3:70216664-70216686 CCTTCATCCTAAAGCTTATTGAA No data
Right 956530823 3:70216712-70216734 TGTCACCTCCTGGGTGAGGCAGG No data
956530817_956530822 21 Left 956530817 3:70216664-70216686 CCTTCATCCTAAAGCTTATTGAA No data
Right 956530822 3:70216708-70216730 CAAATGTCACCTCCTGGGTGAGG No data
956530817_956530821 16 Left 956530817 3:70216664-70216686 CCTTCATCCTAAAGCTTATTGAA No data
Right 956530821 3:70216703-70216725 CTGCTCAAATGTCACCTCCTGGG 0: 4
1: 8
2: 52
3: 175
4: 472

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956530817 Original CRISPR TTCAATAAGCTTTAGGATGA AGG (reversed) Intergenic
No off target data available for this crispr