ID: 956541223

View in Genome Browser
Species Human (GRCh38)
Location 3:70341710-70341732
Sequence CCACGAGGACATAAGCCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956541220_956541223 4 Left 956541220 3:70341683-70341705 CCTGGAGGTGCAGTGGTCATTTT No data
Right 956541223 3:70341710-70341732 CCACGAGGACATAAGCCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956541223 Original CRISPR CCACGAGGACATAAGCCAAC AGG Intergenic
No off target data available for this crispr