ID: 956549373

View in Genome Browser
Species Human (GRCh38)
Location 3:70441308-70441330
Sequence CATGTGGCTGCTGCTGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956549373_956549382 30 Left 956549373 3:70441308-70441330 CCAACCCCAGCAGCAGCCACATG No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data
956549373_956549379 5 Left 956549373 3:70441308-70441330 CCAACCCCAGCAGCAGCCACATG No data
Right 956549379 3:70441336-70441358 GAGAGAGAATCTGTACATGTAGG No data
956549373_956549380 6 Left 956549373 3:70441308-70441330 CCAACCCCAGCAGCAGCCACATG No data
Right 956549380 3:70441337-70441359 AGAGAGAATCTGTACATGTAGGG No data
956549373_956549381 7 Left 956549373 3:70441308-70441330 CCAACCCCAGCAGCAGCCACATG No data
Right 956549381 3:70441338-70441360 GAGAGAATCTGTACATGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956549373 Original CRISPR CATGTGGCTGCTGCTGGGGT TGG (reversed) Intergenic