ID: 956549374

View in Genome Browser
Species Human (GRCh38)
Location 3:70441312-70441334
Sequence ATATCATGTGGCTGCTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956549374_956549379 1 Left 956549374 3:70441312-70441334 CCCCAGCAGCAGCCACATGATAT No data
Right 956549379 3:70441336-70441358 GAGAGAGAATCTGTACATGTAGG No data
956549374_956549381 3 Left 956549374 3:70441312-70441334 CCCCAGCAGCAGCCACATGATAT No data
Right 956549381 3:70441338-70441360 GAGAGAATCTGTACATGTAGGGG No data
956549374_956549380 2 Left 956549374 3:70441312-70441334 CCCCAGCAGCAGCCACATGATAT No data
Right 956549380 3:70441337-70441359 AGAGAGAATCTGTACATGTAGGG No data
956549374_956549382 26 Left 956549374 3:70441312-70441334 CCCCAGCAGCAGCCACATGATAT No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956549374 Original CRISPR ATATCATGTGGCTGCTGCTG GGG (reversed) Intergenic