ID: 956549376

View in Genome Browser
Species Human (GRCh38)
Location 3:70441314-70441336
Sequence CCATATCATGTGGCTGCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956549376_956549380 0 Left 956549376 3:70441314-70441336 CCAGCAGCAGCCACATGATATGG No data
Right 956549380 3:70441337-70441359 AGAGAGAATCTGTACATGTAGGG No data
956549376_956549381 1 Left 956549376 3:70441314-70441336 CCAGCAGCAGCCACATGATATGG No data
Right 956549381 3:70441338-70441360 GAGAGAATCTGTACATGTAGGGG No data
956549376_956549382 24 Left 956549376 3:70441314-70441336 CCAGCAGCAGCCACATGATATGG No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data
956549376_956549379 -1 Left 956549376 3:70441314-70441336 CCAGCAGCAGCCACATGATATGG No data
Right 956549379 3:70441336-70441358 GAGAGAGAATCTGTACATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956549376 Original CRISPR CCATATCATGTGGCTGCTGC TGG (reversed) Intergenic