ID: 956549378

View in Genome Browser
Species Human (GRCh38)
Location 3:70441324-70441346
Sequence GATTCTCTCTCCATATCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956549378_956549382 14 Left 956549378 3:70441324-70441346 CCACATGATATGGAGAGAGAATC No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data
956549378_956549380 -10 Left 956549378 3:70441324-70441346 CCACATGATATGGAGAGAGAATC No data
Right 956549380 3:70441337-70441359 AGAGAGAATCTGTACATGTAGGG No data
956549378_956549381 -9 Left 956549378 3:70441324-70441346 CCACATGATATGGAGAGAGAATC No data
Right 956549381 3:70441338-70441360 GAGAGAATCTGTACATGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956549378 Original CRISPR GATTCTCTCTCCATATCATG TGG (reversed) Intergenic