ID: 956549382

View in Genome Browser
Species Human (GRCh38)
Location 3:70441361-70441383
Sequence AGAGAGAGCACAGTAATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956549374_956549382 26 Left 956549374 3:70441312-70441334 CCCCAGCAGCAGCCACATGATAT No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data
956549373_956549382 30 Left 956549373 3:70441308-70441330 CCAACCCCAGCAGCAGCCACATG No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data
956549375_956549382 25 Left 956549375 3:70441313-70441335 CCCAGCAGCAGCCACATGATATG No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data
956549376_956549382 24 Left 956549376 3:70441314-70441336 CCAGCAGCAGCCACATGATATGG No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data
956549378_956549382 14 Left 956549378 3:70441324-70441346 CCACATGATATGGAGAGAGAATC No data
Right 956549382 3:70441361-70441383 AGAGAGAGCACAGTAATTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956549382 Original CRISPR AGAGAGAGCACAGTAATTGT AGG Intergenic
No off target data available for this crispr