ID: 956554620

View in Genome Browser
Species Human (GRCh38)
Location 3:70505006-70505028
Sequence ACCAGTAGGCCCCACCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956554615_956554620 8 Left 956554615 3:70504975-70504997 CCTGAAAAAGTTATAGGTGAACC No data
Right 956554620 3:70505006-70505028 ACCAGTAGGCCCCACCTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956554620 Original CRISPR ACCAGTAGGCCCCACCTCAT GGG Intergenic
No off target data available for this crispr