ID: 956564742

View in Genome Browser
Species Human (GRCh38)
Location 3:70623828-70623850
Sequence TAATTTCCCCAAAAGGAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956564742_956564744 7 Left 956564742 3:70623828-70623850 CCAACTTCCTTTTGGGGAAATTA No data
Right 956564744 3:70623858-70623880 TCTATTACATGCTGCCTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956564742 Original CRISPR TAATTTCCCCAAAAGGAAGT TGG (reversed) Intergenic
No off target data available for this crispr