ID: 956571115

View in Genome Browser
Species Human (GRCh38)
Location 3:70696345-70696367
Sequence GTGGAGTTGCAAGAAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956571115_956571117 -6 Left 956571115 3:70696345-70696367 CCTGTTTTTTCTTGCAACTCCAC No data
Right 956571117 3:70696362-70696384 CTCCACAAACATCTCAACAAGGG No data
956571115_956571116 -7 Left 956571115 3:70696345-70696367 CCTGTTTTTTCTTGCAACTCCAC No data
Right 956571116 3:70696361-70696383 ACTCCACAAACATCTCAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956571115 Original CRISPR GTGGAGTTGCAAGAAAAAAC AGG (reversed) Intergenic
No off target data available for this crispr