ID: 956572516

View in Genome Browser
Species Human (GRCh38)
Location 3:70712546-70712568
Sequence ACTAGTCAGTGCTCCAGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956572509_956572516 21 Left 956572509 3:70712502-70712524 CCATTCTGGGGTCTGGAGGATGG 0: 723
1: 1254
2: 1570
3: 1362
4: 1119
Right 956572516 3:70712546-70712568 ACTAGTCAGTGCTCCAGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956572516 Original CRISPR ACTAGTCAGTGCTCCAGTGG GGG Intergenic
No off target data available for this crispr