ID: 956572686

View in Genome Browser
Species Human (GRCh38)
Location 3:70713856-70713878
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956572680_956572686 -3 Left 956572680 3:70713836-70713858 CCAAATCTCATAAGAACCCACTA No data
Right 956572686 3:70713856-70713878 CTATTATCAGAACAGCCAGGGGG No data
956572679_956572686 15 Left 956572679 3:70713818-70713840 CCACACACTTTTAAACAACCAAA 0: 44
1: 690
2: 1246
3: 2023
4: 2276
Right 956572686 3:70713856-70713878 CTATTATCAGAACAGCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr