ID: 956573515

View in Genome Browser
Species Human (GRCh38)
Location 3:70724804-70724826
Sequence ATACAGAAATCAAATCAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 28357
Summary {0: 14, 1: 406, 2: 1341, 3: 8620, 4: 17976}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956573515_956573517 -6 Left 956573515 3:70724804-70724826 CCATTTTGATTTGATTTCTGTAT 0: 14
1: 406
2: 1341
3: 8620
4: 17976
Right 956573517 3:70724821-70724843 CTGTATATGGTGAGAGATACAGG No data
956573515_956573518 19 Left 956573515 3:70724804-70724826 CCATTTTGATTTGATTTCTGTAT 0: 14
1: 406
2: 1341
3: 8620
4: 17976
Right 956573518 3:70724846-70724868 TTGTTTCACTCTAATGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956573515 Original CRISPR ATACAGAAATCAAATCAAAA TGG (reversed) Intergenic
Too many off-targets to display for this crispr