ID: 956573518

View in Genome Browser
Species Human (GRCh38)
Location 3:70724846-70724868
Sequence TTGTTTCACTCTAATGCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956573515_956573518 19 Left 956573515 3:70724804-70724826 CCATTTTGATTTGATTTCTGTAT 0: 14
1: 406
2: 1341
3: 8620
4: 17976
Right 956573518 3:70724846-70724868 TTGTTTCACTCTAATGCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956573518 Original CRISPR TTGTTTCACTCTAATGCATG TGG Intergenic
No off target data available for this crispr