ID: 956573518 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:70724846-70724868 |
| Sequence | TTGTTTCACTCTAATGCATG TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 956573515_956573518 | 19 | Left | 956573515 | 3:70724804-70724826 | CCATTTTGATTTGATTTCTGTAT | 0: 14 1: 406 2: 1341 3: 8620 4: 17976 |
||
| Right | 956573518 | 3:70724846-70724868 | TTGTTTCACTCTAATGCATGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 956573518 | Original CRISPR | TTGTTTCACTCTAATGCATG TGG | Intergenic | ||
| No off target data available for this crispr | |||||