ID: 956576402

View in Genome Browser
Species Human (GRCh38)
Location 3:70757278-70757300
Sequence CACGTCACCCAGGCGCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956576399_956576402 -9 Left 956576399 3:70757264-70757286 CCTACATCACATGTCACGTCACC No data
Right 956576402 3:70757278-70757300 CACGTCACCCAGGCGCAAGGAGG No data
956576397_956576402 25 Left 956576397 3:70757230-70757252 CCTTCATTGTGAGTTCTGTGCTT No data
Right 956576402 3:70757278-70757300 CACGTCACCCAGGCGCAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956576402 Original CRISPR CACGTCACCCAGGCGCAAGG AGG Intergenic
No off target data available for this crispr