ID: 956581198

View in Genome Browser
Species Human (GRCh38)
Location 3:70816012-70816034
Sequence AGCATTATAAAAGGTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
956581198_956581206 -6 Left 956581198 3:70816012-70816034 CCCCACCCACCTTTTATAATGCT No data
Right 956581206 3:70816029-70816051 AATGCTTCTATCGGGAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
956581198 Original CRISPR AGCATTATAAAAGGTGGGTG GGG (reversed) Intergenic
No off target data available for this crispr